{
"title": "pharmcat.example",
"timestamp": "2026-02-09T21:20:30.764Z",
"pharmcatVersion": "v3.1.1-7-g1b371646",
"dataVersion": "2026-02-09-10-28",
"genes": {
"ABCG2": {
"alleleDefinitionVersion": "2026-02-09-10-28",
"alleleDefinitionSource": "CLINPGX",
"phenotypeVersion": "2026-02-09-10-28",
"geneSymbol": "ABCG2",
"chr": "chr4",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [],
"relatedDrugs": [
{
"name": "allopurinol",
"id": "PA448320"
},
{
"name": "rosuvastatin",
"id": "PA134308647"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "ABCG2",
"name": "rs2231142 reference (G)",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "ABCG2",
"name": "rs2231142 reference (G)",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "ABCG2",
"matchScore": 2,
"phenotypes": [
"Normal Function"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Function"
],
"label": "rs2231142 reference (G)/rs2231142 reference (G)",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"rs2231142 reference (G)": 2.0
}
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "ABCG2",
"name": "rs2231142 reference (G)",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "ABCG2",
"name": "rs2231142 reference (G)",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "ABCG2",
"matchScore": 2,
"phenotypes": [
"Normal Function"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Function"
],
"label": "rs2231142 reference (G)/rs2231142 reference (G)",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"rs2231142 reference (G)": 2.0
}
}
],
"variants": [
{
"gene": "ABCG2",
"chromosome": "chr4",
"position": 88131171,
"dbSnpId": "rs2231142",
"call": "G/G",
"alleles": [
"rs2231142 variant (T)"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"CACNA1S": {
"alleleDefinitionVersion": "2026-02-09-10-28",
"alleleDefinitionSource": "CLINPGX",
"phenotypeVersion": "2026-02-09-10-28",
"geneSymbol": "CACNA1S",
"chr": "chr1",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "reference-allele",
"version": null,
"matches": null,
"exception_type": "note",
"message": "The CACNA1S Reference allele assignment is characterized by the absence of variants at the positions that are included in the underlying allele definitions."
}
],
"relatedDrugs": [
{
"name": "desflurane",
"id": "PA164749136"
},
{
"name": "enflurane",
"id": "PA449461"
},
{
"name": "halothane",
"id": "PA449845"
},
{
"name": "isoflurane",
"id": "PA450106"
},
{
"name": "methoxyflurane",
"id": "PA450434"
},
{
"name": "sevoflurane",
"id": "PA451341"
},
{
"name": "succinylcholine",
"id": "PA451522"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "CACNA1S",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CACNA1S",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CACNA1S",
"matchScore": 4,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "CACNA1S",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CACNA1S",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CACNA1S",
"matchScore": 4,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
],
"variants": [
{
"gene": "CACNA1S",
"chromosome": "chr1",
"position": 201060815,
"dbSnpId": "rs1800559",
"call": "C/C",
"alleles": [
"c.3257G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CACNA1S",
"chromosome": "chr1",
"position": 201091993,
"dbSnpId": "rs772226819",
"call": "G/G",
"alleles": [
"c.520C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"CFTR": {
"alleleDefinitionVersion": "2026-02-09-10-28",
"alleleDefinitionSource": "CLINPGX",
"phenotypeVersion": "2026-02-09-10-28",
"geneSymbol": "CFTR",
"chr": "chr7",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [],
"relatedDrugs": [
{
"name": "ivacaftor",
"id": "PA165950341"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "CFTR",
"name": "ivacaftor non-responsive CFTR sequence",
"function": "ivacaftor non-responsive",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CFTR",
"name": "ivacaftor non-responsive CFTR sequence",
"function": "ivacaftor non-responsive",
"reference": true,
"activityValue": "n/a"
},
"gene": "CFTR",
"matchScore": 186,
"phenotypes": [
"ivacaftor non-responsive in CF patients"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"ivacaftor non-responsive in CF patients"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"ivacaftor non-responsive CFTR sequence": 2.0
}
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "CFTR",
"name": "ivacaftor non-responsive CFTR sequence",
"function": "ivacaftor non-responsive",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CFTR",
"name": "ivacaftor non-responsive CFTR sequence",
"function": "ivacaftor non-responsive",
"reference": true,
"activityValue": "n/a"
},
"gene": "CFTR",
"matchScore": 186,
"phenotypes": [
"ivacaftor non-responsive in CF patients"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"ivacaftor non-responsive in CF patients"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"ivacaftor non-responsive CFTR sequence": 2.0
}
}
],
"variants": [
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117509035,
"dbSnpId": "rs397508256",
"call": "G/G",
"alleles": [
"E56K"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117509069,
"dbSnpId": "rs368505753",
"call": "C/C",
"alleles": [
"P67L"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117509089,
"dbSnpId": "rs115545701",
"call": "C/C",
"alleles": [
"R74W"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117509093,
"dbSnpId": "rs1800076",
"call": "G/G",
"alleles": [
"R75Q"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117530953,
"dbSnpId": "rs113993958",
"call": "G/G",
"alleles": [
"D110H"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117530955,
"dbSnpId": "rs397508537",
"call": "C/C",
"alleles": [
"D110E"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117530974,
"dbSnpId": "rs77834169",
"call": "C/C",
"alleles": [
"R117C",
"R117G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117530975,
"dbSnpId": "rs78655421",
"call": "G/G",
"alleles": [
"R117H",
"R117L",
"R117P"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117530983,
"dbSnpId": "rs201958172",
"call": "G/G",
"alleles": [
"A120T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117531068,
"dbSnpId": "rs35516286",
"call": "T/T",
"alleles": [
"I148T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117531079,
"dbSnpId": "rs397508721",
"call": "A/A",
"alleles": [
"M152V"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117534295,
"dbSnpId": "rs1800079",
"call": "G/G",
"alleles": [
"R170H"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117534309,
"dbSnpId": "rs397508744",
"call": "A/A",
"alleles": [
"I175V"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117534318,
"dbSnpId": "rs80282562",
"call": "G/G",
"alleles": [
"G178R"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117534319,
"dbSnpId": "rs397508748",
"call": "G/G",
"alleles": [
"G178E"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117534361,
"dbSnpId": "rs397508758",
"call": "A/A",
"alleles": [
"D192G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117534363,
"dbSnpId": "rs397508759",
"call": "G/G",
"alleles": [
"E193K"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117534368,
"dbSnpId": "rs397508761",
"call": "A/A",
"alleles": [
"711+3A->G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117535248,
"dbSnpId": "rs376008630",
"call": "G/G",
"alleles": [
"G194R(G>A)",
"G194R(G>C)"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117535285,
"dbSnpId": "rs121908752",
"call": "T/T",
"alleles": [
"L206W"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117535363,
"dbSnpId": "rs397508783",
"call": "T/T",
"alleles": [
"V232D"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117535369,
"dbSnpId": "rs769016520",
"call": "C/C",
"alleles": [
"A234D"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117535377,
"dbSnpId": "rs397508784",
"call": "C/C",
"alleles": [
"Q237E"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117535379,
"dbSnpId": "rs397508785",
"call": "G/G",
"alleles": [
"Q237H"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117540156,
"dbSnpId": null,
"call": "CCTT/CCTT",
"alleles": [
"F311del"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "CCTT",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117540161,
"dbSnpId": "rs2116683801",
"call": "T/T",
"alleles": [
"F311L"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117540171,
"dbSnpId": "rs75763344",
"call": "G/G",
"alleles": [
"G314E"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117540188,
"dbSnpId": "rs144476686",
"call": "T/T",
"alleles": [
"L320V"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117540243,
"dbSnpId": "rs77409459",
"call": "C/C",
"alleles": [
"T338I"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117540270,
"dbSnpId": "rs77932196",
"call": "G/G",
"alleles": [
"R347H",
"R347L"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117540276,
"dbSnpId": "rs121909021",
"call": "C/C",
"alleles": [
"A349V"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117540285,
"dbSnpId": "rs121908753",
"call": "G/G",
"alleles": [
"R352Q"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117540306,
"dbSnpId": "rs397508153",
"call": "A/A",
"alleles": [
"Q359R"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117548795,
"dbSnpId": "rs74551128",
"call": "C/C",
"alleles": [
"A455E"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117559594,
"dbSnpId": "rs74571530",
"call": "T/T",
"alleles": [
"F508C",
"F508C,S1251N"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117587799,
"dbSnpId": "rs121908757",
"call": "A/A",
"alleles": [
"S549R(A>C)"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117587800,
"dbSnpId": "rs121908755",
"call": "G/G",
"alleles": [
"S549N"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117587801,
"dbSnpId": "rs121909005",
"call": "T/T",
"alleles": [
"S549R(T>G)"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117587805,
"dbSnpId": "rs121909013",
"call": "G/G",
"alleles": [
"G551S"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117587806,
"dbSnpId": "rs75527207",
"call": "G/G",
"alleles": [
"G551D"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117587812,
"dbSnpId": "rs121909044",
"call": "G/G",
"alleles": [
"R553Q"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117590357,
"dbSnpId": "rs1800097",
"call": "G/G",
"alleles": [
"V562I"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117590400,
"dbSnpId": "rs1800098",
"call": "G/G",
"alleles": [
"G576A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117590409,
"dbSnpId": "rs397508288",
"call": "A/A",
"alleles": [
"D579G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117590439,
"dbSnpId": "rs397508300",
"call": "G/G",
"alleles": [
"S589N"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117592169,
"dbSnpId": "rs1800100",
"call": "C/C",
"alleles": [
"R668C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117592377,
"dbSnpId": "rs186089140",
"call": "C/C",
"alleles": [
"S737F"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117592427,
"dbSnpId": "rs150157202",
"call": "G/G",
"alleles": [
"V754M"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117592541,
"dbSnpId": "rs145449046",
"call": "C/C",
"alleles": [
"R792G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117592588,
"dbSnpId": "rs1800103",
"call": "A/A",
"alleles": [
"I807M"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117592631,
"dbSnpId": "rs397508378",
"call": "G/G",
"alleles": [
"E822K"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117594930,
"dbSnpId": "rs397508387",
"call": "G/G",
"alleles": [
"E831X"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117602868,
"dbSnpId": "rs80224560",
"call": "G/G",
"alleles": [
"2789+5G->A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117603644,
"dbSnpId": "rs201759207",
"call": "G/G",
"alleles": [
"D924N"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117603671,
"dbSnpId": "rs397508436",
"call": "A/A",
"alleles": [
"R933G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117603690,
"dbSnpId": "rs397508440",
"call": "A/A",
"alleles": [
"H939R"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117603708,
"dbSnpId": "rs397508442",
"call": "C/C",
"alleles": [
"S945L"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117603729,
"dbSnpId": "rs142773283",
"call": "T/T",
"alleles": [
"M952T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117603730,
"dbSnpId": "rs151048781",
"call": "G/G",
"alleles": [
"M952I(G>A)",
"M952I(G>C)",
"M952I(G>T)"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117603774,
"dbSnpId": "rs1800110",
"call": "T/T",
"alleles": [
"L967S"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117606674,
"dbSnpId": "rs386134230",
"call": "G/G",
"alleles": [
"G970D"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117606695,
"dbSnpId": "rs141033578",
"call": "C/C",
"alleles": [
"S977F"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117610521,
"dbSnpId": "rs1800111",
"call": "G/G",
"alleles": [
"L997F(G>C)",
"L997F(G>T)"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117610571,
"dbSnpId": "rs149279509",
"call": "A/A",
"alleles": [
"Y1014C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117610610,
"dbSnpId": "rs1800112",
"call": "T/T",
"alleles": [
"I1027T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117610625,
"dbSnpId": "rs144055758",
"call": "A/A",
"alleles": [
"Y1032C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117611555,
"dbSnpId": "rs76151804",
"call": "A/A",
"alleles": [
"3272-26A->G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117611595,
"dbSnpId": "rs150212784",
"call": "T/T",
"alleles": [
"F1052V"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117611599,
"dbSnpId": "rs140883683",
"call": "C/C",
"alleles": [
"T1053I"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117611620,
"dbSnpId": "rs397508513",
"call": "A/A",
"alleles": [
"K1060T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117611640,
"dbSnpId": "rs121909020",
"call": "G/G",
"alleles": [
"A1067T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117611646,
"dbSnpId": "rs200321110",
"call": "G/G",
"alleles": [
"G1069R"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117611649,
"dbSnpId": "rs202179988",
"call": "C/C",
"alleles": [
"R1070W"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117611650,
"dbSnpId": "rs78769542",
"call": "G/G",
"alleles": [
"R1070Q"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117611663,
"dbSnpId": "rs186045772",
"call": "T/T",
"alleles": [
"F1074L"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117614660,
"dbSnpId": "rs397508556",
"call": "A/A",
"alleles": [
"I1139V"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117614699,
"dbSnpId": "rs75541969",
"call": "G/G",
"alleles": [
"D1152H"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117627528,
"dbSnpId": "rs397508572",
"call": "T/T",
"alleles": [
"S1159P"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117627529,
"dbSnpId": "rs397508573",
"call": "C/C",
"alleles": [
"S1159F"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117627538,
"dbSnpId": "rs1800120",
"call": "G/G",
"alleles": [
"R1162L"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117639961,
"dbSnpId": "rs75039782",
"call": "C/C",
"alleles": [
"3849+10kbC->T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117642451,
"dbSnpId": "rs267606723",
"call": "G/G",
"alleles": [
"G1244E"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117642465,
"dbSnpId": "rs397508602",
"call": "G/G",
"alleles": [
"G1249R(G>A)",
"G1249R(G>C)"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117642472,
"dbSnpId": "rs74503330",
"call": "G/G",
"alleles": [
"F508C,S1251N",
"S1251N"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117642483,
"dbSnpId": "rs121909041",
"call": "T/T",
"alleles": [
"S1255P"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117642528,
"dbSnpId": "rs11971167",
"call": "G/G",
"alleles": [
"D1270N"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117642564,
"dbSnpId": "rs397508616",
"call": "T/T",
"alleles": [
"W1282R"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117642568,
"dbSnpId": "rs77902683",
"call": "G/G",
"alleles": [
"R1283M"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117642592,
"dbSnpId": "rs397508621",
"call": "A/A",
"alleles": [
"Q1291R"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117652846,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"V1293G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117664770,
"dbSnpId": "rs193922525",
"call": "G/G",
"alleles": [
"G1349D"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117664848,
"dbSnpId": "rs397508678",
"call": "A/A",
"alleles": [
"H1375P"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117667104,
"dbSnpId": "rs758818611",
"call": "T/T",
"alleles": [
"L1480P"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"CYP2B6": {
"alleleDefinitionVersion": "2026-02-09-10-28",
"alleleDefinitionSource": "CLINPGX",
"phenotypeVersion": "2026-02-09-10-28",
"geneSymbol": "CYP2B6",
"chr": "chr19",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "reference-allele",
"version": null,
"matches": null,
"exception_type": "note",
"message": "The CYP2B6 *1 allele assignment is characterized by the absence of variants at the positions that are included in the underlying allele definitions."
}
],
"relatedDrugs": [
{
"name": "efavirenz",
"id": "PA449441"
},
{
"name": "sertraline",
"id": "PA451333"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "CYP2B6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2B6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP2B6",
"matchScore": 96,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "CYP2B6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2B6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP2B6",
"matchScore": 96,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
],
"variants": [
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 40991224,
"dbSnpId": "rs34223104",
"call": "T/T",
"alleles": [
"*22",
"*34",
"*35",
"*36",
"*50"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 40991367,
"dbSnpId": "rs34883432",
"call": "A/A",
"alleles": [
"*10"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 40991369,
"dbSnpId": "rs8192709",
"call": "C/C",
"alleles": [
"*2",
"*10"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 40991381,
"dbSnpId": "rs33973337",
"call": "A/A",
"alleles": [
"*17"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 40991388,
"dbSnpId": "rs33980385",
"call": "A/A",
"alleles": [
"*17"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 40991390,
"dbSnpId": "rs33926104",
"call": "C/C",
"alleles": [
"*17"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 40991391,
"dbSnpId": "rs34284776",
"call": "G/G",
"alleles": [
"*17"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 40991441,
"dbSnpId": "rs35303484",
"call": "A/A",
"alleles": [
"*11"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41004015,
"dbSnpId": "rs281864907",
"call": "T/T",
"alleles": [
"*38"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41004125,
"dbSnpId": "rs36060847",
"call": "G/G",
"alleles": [
"*12"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41004133,
"dbSnpId": "rs148009906",
"call": "G/G",
"alleles": [
"*44"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41004158,
"dbSnpId": "rs186335453",
"call": "G/G",
"alleles": [
"*35"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41004303,
"dbSnpId": "rs139801276",
"call": "T/T",
"alleles": [
"*35"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41004377,
"dbSnpId": "rs12721655",
"call": "A/A",
"alleles": [
"*8",
"*13"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41004380,
"dbSnpId": "rs535039125",
"call": "C/C",
"alleles": [
"*39"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41004381,
"dbSnpId": "rs35773040",
"call": "G/G",
"alleles": [
"*14"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41004406,
"dbSnpId": "rs145884402",
"call": "G/G",
"alleles": [
"*35"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41004435,
"dbSnpId": "rs141666881",
"call": "G/G",
"alleles": [
"*50"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41006919,
"dbSnpId": "rs3826711",
"call": "C/C",
"alleles": [
"*26"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41006923,
"dbSnpId": "rs36056539",
"call": "C/C",
"alleles": [
"*20"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41006936,
"dbSnpId": "rs3745274",
"call": "G/G",
"alleles": [
"*6",
"*7",
"*9",
"*13",
"*19",
"*20",
"*26",
"*34",
"*36",
"*37",
"*38",
"*39",
"*40",
"*41",
"*42",
"*43"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41006967,
"dbSnpId": "rs58871670",
"call": "G/G",
"alleles": [
"*45"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41006968,
"dbSnpId": "rs373489637",
"call": "T/T",
"alleles": [
"*37"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41007013,
"dbSnpId": "rs36079186",
"call": "T/T",
"alleles": [
"*27",
"*35"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41009313,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"*46"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41009350,
"dbSnpId": "rs45482602",
"call": "C/C",
"alleles": [
"*3"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41009358,
"dbSnpId": "rs2279343",
"call": "A/A",
"alleles": [
"*4",
"*6",
"*7",
"*13",
"*18",
"*19",
"*20",
"*26",
"*34",
"*36",
"*37",
"*38",
"*39",
"*40",
"*41",
"*42",
"*43"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41010006,
"dbSnpId": "rs139029625",
"call": "G/G",
"alleles": [
"*35"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41010088,
"dbSnpId": "rs34698757",
"call": "C/C",
"alleles": [
"*28"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41010108,
"dbSnpId": "rs193922917",
"call": "C/C",
"alleles": [
"*31"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41012316,
"dbSnpId": "rs28399499",
"call": "T/T",
"alleles": [
"*18"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41012339,
"dbSnpId": "rs34826503",
"call": "C/C",
"alleles": [
"*19"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41012393,
"dbSnpId": "rs754621576",
"call": "T/T",
"alleles": [
"*47"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41012394,
"dbSnpId": "rs780991919",
"call": "A/A",
"alleles": [
"*47"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41012465,
"dbSnpId": "rs34097093",
"call": "C/C",
"alleles": [
"*28"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41012466,
"dbSnpId": "rs200458614",
"call": "G/G",
"alleles": [
"*40"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41012471,
"dbSnpId": "rs201500445",
"call": "T/T",
"alleles": [
"*41"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41012478,
"dbSnpId": "rs200238771",
"call": "T/T",
"alleles": [
"*48"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41012693,
"dbSnpId": "rs35979566",
"call": "T/T",
"alleles": [
"*15"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41012740,
"dbSnpId": "rs193922918",
"call": "G/G",
"alleles": [
"*32"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41012803,
"dbSnpId": "rs35010098",
"call": "C/C",
"alleles": [
"*21"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41016652,
"dbSnpId": "rs764288403",
"call": "G/G",
"alleles": [
"*49"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41016679,
"dbSnpId": "rs374099483",
"call": "G/G",
"alleles": [
"*42"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41016726,
"dbSnpId": "rs3211369",
"call": "A/A",
"alleles": [
"*23"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41016741,
"dbSnpId": "rs117872433",
"call": "G/G",
"alleles": [
"*43"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41016778,
"dbSnpId": "rs564083989",
"call": "G/G",
"alleles": [
"*24"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41016805,
"dbSnpId": "rs2516199080",
"call": "A/A",
"alleles": [
"*25"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41016810,
"dbSnpId": "rs3211371",
"call": "C/C",
"alleles": [
"*5",
"*7",
"*33",
"*34"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"CYP2C19": {
"alleleDefinitionVersion": "2026-02-09-10-28",
"alleleDefinitionSource": "CLINPGX",
"phenotypeVersion": "2026-02-09-10-28",
"geneSymbol": "CYP2C19",
"chr": "chr10",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "reference-allele",
"version": null,
"matches": null,
"exception_type": "note",
"message": "The CYP2C19 *38 allele assignment is characterized by the absence of variants at the positions that are included in the underlying allele definitions."
}
],
"relatedDrugs": [
{
"name": "abrocitinib",
"id": "PA166272921"
},
{
"name": "amitriptyline",
"id": "PA448385"
},
{
"name": "belzutifan",
"id": "PA166268761"
},
{
"name": "brivaracetam",
"id": "PA166153491"
},
{
"name": "carisoprodol",
"id": "PA448809"
},
{
"name": "citalopram",
"id": "PA449015"
},
{
"name": "clobazam",
"id": "PA10888"
},
{
"name": "clomipramine",
"id": "PA449048"
},
{
"name": "clopidogrel",
"id": "PA449053"
},
{
"name": "dexlansoprazole",
"id": "PA166110257"
},
{
"name": "diazepam",
"id": "PA449283"
},
{
"name": "doxepin",
"id": "PA449409"
},
{
"name": "escitalopram",
"id": "PA10074"
},
{
"name": "esomeprazole",
"id": "PA10075"
},
{
"name": "flibanserin",
"id": "PA166153431"
},
{
"name": "imipramine",
"id": "PA449969"
},
{
"name": "lansoprazole",
"id": "PA450180"
},
{
"name": "mavacamten",
"id": "PA166272922"
},
{
"name": "omeprazole",
"id": "PA450704"
},
{
"name": "pantoprazole",
"id": "PA450774"
},
{
"name": "rabeprazole",
"id": "PA451216"
},
{
"name": "sertraline",
"id": "PA451333"
},
{
"name": "trimipramine",
"id": "PA451791"
},
{
"name": "voriconazole",
"id": "PA10233"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*38",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*38",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 70,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*38/*38",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*38": 2.0
}
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*38",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*38",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 70,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*38/*38",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*38": 2.0
}
}
],
"variants": [
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94761900,
"dbSnpId": "rs12248560",
"call": "C/C",
"alleles": [
"*1",
"*4",
"*17"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94762706,
"dbSnpId": "rs28399504",
"call": "A/A",
"alleles": [
"*1",
"*4"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94762712,
"dbSnpId": "rs367543002",
"call": "C/C",
"alleles": [
"*1",
"*34",
"*40"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94762715,
"dbSnpId": "rs367543003",
"call": "T/T",
"alleles": [
"*1",
"*34",
"*40"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94762755,
"dbSnpId": "rs55752064",
"call": "T/T",
"alleles": [
"*1",
"*14"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94762760,
"dbSnpId": "rs17882687",
"call": "A/A",
"alleles": [
"*1",
"*15",
"*28",
"*35",
"*39"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94762788,
"dbSnpId": "rs1564656981",
"call": "A/A",
"alleles": [
"*1",
"*29"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94762856,
"dbSnpId": "rs1564657013",
"call": "A/A",
"alleles": [
"*1",
"*19"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94775106,
"dbSnpId": "rs145328984",
"call": "C/C",
"alleles": [
"*1",
"*30"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94775121,
"dbSnpId": "rs1564660997",
"call": "C/C",
"alleles": [
"*1",
"*31"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94775160,
"dbSnpId": "rs118203756",
"call": "G/G",
"alleles": [
"*1",
"*23"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94775185,
"dbSnpId": "rs1288601658",
"call": "A/A",
"alleles": [
"*1",
"*32"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94775367,
"dbSnpId": "rs12769205",
"call": "A/A",
"alleles": [
"*1",
"*2",
"*35"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94775416,
"dbSnpId": "rs41291556",
"call": "T/T",
"alleles": [
"*1",
"*8"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94775423,
"dbSnpId": "rs17885179",
"call": "A/A",
"alleles": [
"*1",
"*39"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94775453,
"dbSnpId": "rs72552267",
"call": "G/G",
"alleles": [
"*1",
"*6"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94775489,
"dbSnpId": "rs17884712",
"call": "G/G",
"alleles": [
"*1",
"*9"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94775507,
"dbSnpId": "rs58973490",
"call": "G/G",
"alleles": [
"*1",
"*2",
"*11"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94780544,
"dbSnpId": "rs57700608",
"call": "A/A",
"alleles": [
"*1",
"*41"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94780574,
"dbSnpId": "rs140278421",
"call": "G/G",
"alleles": [
"*1",
"*22"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94780579,
"dbSnpId": "rs370803989",
"call": "G/G",
"alleles": [
"*1",
"*33"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94780653,
"dbSnpId": "rs4986893",
"call": "G/G",
"alleles": [
"*1",
"*3"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94781858,
"dbSnpId": "rs6413438",
"call": "C/C",
"alleles": [
"*1",
"*10"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94781859,
"dbSnpId": "rs4244285",
"call": "G/G",
"alleles": [
"*1",
"*2"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94781944,
"dbSnpId": "rs375781227",
"call": "G/G",
"alleles": [
"*1",
"*26"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94781999,
"dbSnpId": "rs72558186",
"call": "T/T",
"alleles": [
"*1",
"*7"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94842861,
"dbSnpId": "rs138142612",
"call": "G/G",
"alleles": [
"*1",
"*18"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94842866,
"dbSnpId": "rs3758581",
"call": "A/A",
"alleles": [
"*1",
"*2",
"*3",
"*4",
"*5",
"*6",
"*7",
"*8",
"*9",
"*10",
"*11",
"*12",
"*13",
"*14",
"*15",
"*17",
"*18",
"*19",
"*22",
"*23",
"*24",
"*25",
"*26",
"*28",
"*29",
"*31",
"*32",
"*33",
"*35",
"*39",
"*40",
"*41"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94842879,
"dbSnpId": "rs118203757",
"call": "G/G",
"alleles": [
"*1",
"*24"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94842995,
"dbSnpId": "rs113934938",
"call": "G/G",
"alleles": [
"*1",
"*28"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94849995,
"dbSnpId": "rs17879685",
"call": "C/C",
"alleles": [
"*1",
"*13"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94852738,
"dbSnpId": "rs56337013",
"call": "C/C",
"alleles": [
"*1",
"*5"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94852765,
"dbSnpId": "rs192154563",
"call": "C/C",
"alleles": [
"*1",
"*16"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94852785,
"dbSnpId": "rs118203759",
"call": "C/C",
"alleles": [
"*1",
"*25"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94852914,
"dbSnpId": "rs55640102",
"call": "A/A",
"alleles": [
"*1",
"*12"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"CYP2C9": {
"alleleDefinitionVersion": "2026-02-09-10-28",
"alleleDefinitionSource": "CLINPGX",
"phenotypeVersion": "2026-02-09-10-28",
"geneSymbol": "CYP2C9",
"chr": "chr10",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "reference-allele",
"version": null,
"matches": null,
"exception_type": "note",
"message": "The CYP2C9 *1 allele assignment is characterized by the absence of variants at the positions that are included in the underlying allele definitions."
}
],
"relatedDrugs": [
{
"name": "avatrombopag",
"id": "PA166179849"
},
{
"name": "celecoxib",
"id": "PA448871"
},
{
"name": "deuruxolitinib",
"id": "PA166400021"
},
{
"name": "dronabinol",
"id": "PA449421"
},
{
"name": "erdafitinib",
"id": "PA166182720"
},
{
"name": "flurbiprofen",
"id": "PA449683"
},
{
"name": "fluvastatin",
"id": "PA449688"
},
{
"name": "fosphenytoin",
"id": "PA164746820"
},
{
"name": "ibuprofen",
"id": "PA449957"
},
{
"name": "lesinurad",
"id": "PA166160006"
},
{
"name": "lornoxicam",
"id": "PA165958395"
},
{
"name": "meloxicam",
"id": "PA450353"
},
{
"name": "nateglinide",
"id": "PA450600"
},
{
"name": "phenytoin",
"id": "PA450947"
},
{
"name": "piroxicam",
"id": "PA450985"
},
{
"name": "seladelpar",
"id": "PA166400041"
},
{
"name": "siponimod",
"id": "PA166182736"
},
{
"name": "tenoxicam",
"id": "PA131890625"
},
{
"name": "warfarin",
"id": "PA451906"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "CYP2C9",
"matchScore": 166,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "CYP2C9",
"matchScore": 166,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
],
"variants": [
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94938683,
"dbSnpId": "rs114071557",
"call": "A/A",
"alleles": [
"*36"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94938719,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"*80"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94938737,
"dbSnpId": "rs67807361",
"call": "C/C",
"alleles": [
"*7"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94938771,
"dbSnpId": "rs142240658",
"call": "C/C",
"alleles": [
"*21"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94938788,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"*83"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94938800,
"dbSnpId": "rs1364419386",
"call": "G/G",
"alleles": [
"*76"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94938803,
"dbSnpId": "rs2031308986",
"call": "A/A",
"alleles": [
"*22"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94938828,
"dbSnpId": "rs564813580",
"call": "A/A",
"alleles": [
"*37"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94941897,
"dbSnpId": "rs371055887",
"call": "G/G",
"alleles": [
"*20"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94941915,
"dbSnpId": "rs1216169538",
"call": "G/G",
"alleles": [
"*23"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94941958,
"dbSnpId": "rs72558187",
"call": "T/T",
"alleles": [
"*13"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94941975,
"dbSnpId": "rs2493006942",
"call": "G/G",
"alleles": [
"*77"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94941976,
"dbSnpId": "rs761033063",
"call": "G/G",
"alleles": [
"*38"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94941982,
"dbSnpId": "rs762239445",
"call": "G/G",
"alleles": [
"*39"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942018,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"*40"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942205,
"dbSnpId": "rs1304490498",
"call": "CAATGGAAAGA/CAATGGAAAGA",
"alleles": [
"*25"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "CAATGGAAAGA",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942216,
"dbSnpId": "rs774607211",
"call": "A/A",
"alleles": [
"*41"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942230,
"dbSnpId": "rs767576260",
"call": "C/C",
"alleles": [
"*43"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942231,
"dbSnpId": "rs12414460",
"call": "G/G",
"alleles": [
"*42"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942233,
"dbSnpId": "rs375805362",
"call": "C/C",
"alleles": [
"*62"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942234,
"dbSnpId": "rs72558189",
"call": "G/G",
"alleles": [
"*14",
"*35"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942240,
"dbSnpId": "rs530507053",
"call": "C/C",
"alleles": [
"*88"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942243,
"dbSnpId": "rs1375956433",
"call": "T/T",
"alleles": [
"*78"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942249,
"dbSnpId": "rs200965026",
"call": "C/C",
"alleles": [
"*26",
"*44"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942254,
"dbSnpId": "rs199523631",
"call": "C/C",
"alleles": [
"*45"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942255,
"dbSnpId": "rs200183364",
"call": "G/G",
"alleles": [
"*33"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942290,
"dbSnpId": "rs1799853",
"call": "C/C",
"alleles": [
"*2",
"*35",
"*61"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942291,
"dbSnpId": "rs141489852",
"call": "G/G",
"alleles": [
"*63"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942305,
"dbSnpId": "rs754487195",
"call": "G/G",
"alleles": [
"*46"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942306,
"dbSnpId": "rs1289704600",
"call": "C/C",
"alleles": [
"*72"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942308,
"dbSnpId": "rs17847037",
"call": "C/C",
"alleles": [
"*73"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942309,
"dbSnpId": "rs7900194",
"call": "G/G",
"alleles": [
"*8",
"*27"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94947782,
"dbSnpId": "rs72558190",
"call": "C/C",
"alleles": [
"*15"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94947785,
"dbSnpId": "rs774550549",
"call": "C/C",
"alleles": [
"*47"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94947869,
"dbSnpId": "rs2492587526",
"call": "A/A",
"alleles": [
"*69"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94947907,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"*57"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94947917,
"dbSnpId": "rs1326630788",
"call": "T/T",
"alleles": [
"*48"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94947938,
"dbSnpId": "rs2031531005",
"call": "A/A",
"alleles": [
"*28"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94947939,
"dbSnpId": "rs370100007",
"call": "G/G",
"alleles": [
"*74"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94949129,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"*49"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94949144,
"dbSnpId": "rs2492591692",
"call": "C/C",
"alleles": [
"*50"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94949145,
"dbSnpId": "rs772782449",
"call": "C/C",
"alleles": [
"*82"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94949161,
"dbSnpId": null,
"call": "AT/AT",
"alleles": [
"*85"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "AT",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94949184,
"dbSnpId": "rs369745682",
"call": "T/T",
"alleles": [
"*86"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94949217,
"dbSnpId": "rs2256871",
"call": "A/A",
"alleles": [
"*9"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94949280,
"dbSnpId": "rs9332130",
"call": "A/A",
"alleles": [
"*10",
"*71"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94949281,
"dbSnpId": "rs9332131",
"call": "GA/GA",
"alleles": [
"*6"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "GA",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94972119,
"dbSnpId": "rs182132442",
"call": "C/C",
"alleles": [
"*29"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94972123,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"*64"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94972134,
"dbSnpId": "rs2492634549",
"call": "A/A",
"alleles": [
"*51"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94972179,
"dbSnpId": "rs72558192",
"call": "A/A",
"alleles": [
"*16"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94972180,
"dbSnpId": "rs988617574",
"call": "C/C",
"alleles": [
"*52"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94972183,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"*81"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94972194,
"dbSnpId": "rs546318684",
"call": "A/A",
"alleles": [
"*87"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94972233,
"dbSnpId": "rs1237225311",
"call": "C/C",
"alleles": [
"*53"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94981199,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"*65"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94981201,
"dbSnpId": "rs57505750",
"call": "T/T",
"alleles": [
"*31"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94981224,
"dbSnpId": "rs28371685",
"call": "C/C",
"alleles": [
"*11"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94981225,
"dbSnpId": "rs367826293",
"call": "G/G",
"alleles": [
"*34"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94981230,
"dbSnpId": "rs1274535931",
"call": "C/C",
"alleles": [
"*58"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94981250,
"dbSnpId": "rs750820937",
"call": "C/C",
"alleles": [
"*54"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94981258,
"dbSnpId": "rs1297714792",
"call": "C/C",
"alleles": [
"*79"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94981281,
"dbSnpId": "rs749060448",
"call": "G/G",
"alleles": [
"*24"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94981296,
"dbSnpId": "rs1057910",
"call": "A/A",
"alleles": [
"*3",
"*18",
"*68"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94981297,
"dbSnpId": "rs56165452",
"call": "T/T",
"alleles": [
"*4"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94981301,
"dbSnpId": "rs28371686",
"call": "C/C",
"alleles": [
"*5",
"*36"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94981302,
"dbSnpId": "rs1250577724",
"call": "C/C",
"alleles": [
"*55"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94981305,
"dbSnpId": "rs578144976",
"call": "C/C",
"alleles": [
"*66"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94981365,
"dbSnpId": "rs2492650213",
"call": "C/C",
"alleles": [
"*17"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94981371,
"dbSnpId": "rs542577750",
"call": "G/G",
"alleles": [
"*68"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94986042,
"dbSnpId": "rs764211126",
"call": "A/A",
"alleles": [
"*56"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94986073,
"dbSnpId": "rs72558193",
"call": "A/A",
"alleles": [
"*18"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94986136,
"dbSnpId": "rs1254213342",
"call": "A/A",
"alleles": [
"*75"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94986174,
"dbSnpId": "rs1441296358",
"call": "G/G",
"alleles": [
"*84"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94988852,
"dbSnpId": "rs776908257",
"call": "C/C",
"alleles": [
"*67"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94988855,
"dbSnpId": "rs2492662738",
"call": "A/A",
"alleles": [
"*59"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94988880,
"dbSnpId": "rs2492662839",
"call": "G/G",
"alleles": [
"*70"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94988917,
"dbSnpId": "rs769942899",
"call": "G/G",
"alleles": [
"*19"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94988925,
"dbSnpId": "rs202201137",
"call": "A/A",
"alleles": [
"*61"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94988955,
"dbSnpId": "rs767284820",
"call": "T/T",
"alleles": [
"*60"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94988984,
"dbSnpId": "rs781583846",
"call": "G/G",
"alleles": [
"*30"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94989020,
"dbSnpId": "rs9332239",
"call": "C/C",
"alleles": [
"*12",
"*71"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94989023,
"dbSnpId": "rs868182778",
"call": "G/G",
"alleles": [
"*32"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94645745,
"dbSnpId": "rs12777823",
"call": "G/G",
"alleles": [],
"phased": false,
"phaseSet": null,
"referenceAllele": null,
"hasUndocumentedVariations": false,
"warnings": []
}
],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"CYP2D6": {
"alleleDefinitionVersion": null,
"alleleDefinitionSource": "UNKNOWN",
"phenotypeVersion": "2026-02-09-10-28",
"geneSymbol": "CYP2D6",
"chr": null,
"phased": false,
"effectivelyPhased": false,
"callSource": "OUTSIDE",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "pcat-outside-call",
"version": "1",
"matches": {
"gene": null,
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": []
},
"exception_type": "",
"message": "This comes from an outside data source which does not supply position-level detail. For specific disclaimers and limitations, see the original genotyping source."
}
],
"relatedDrugs": [
{
"name": "acetaminophen / caffeine / dihydrocodeine",
"id": "PA166246281"
},
{
"name": "amitriptyline",
"id": "PA448385"
},
{
"name": "amoxapine",
"id": "PA448405"
},
{
"name": "amphetamine",
"id": "PA448408"
},
{
"name": "aripiprazole",
"id": "PA10026"
},
{
"name": "aripiprazole lauroxil",
"id": "PA166161216"
},
{
"name": "atomoxetine",
"id": "PA134688071"
},
{
"name": "brexpiprazole",
"id": "PA166160053"
},
{
"name": "carvedilol",
"id": "PA448817"
},
{
"name": "cevimeline",
"id": "PA164754754"
},
{
"name": "clomipramine",
"id": "PA449048"
},
{
"name": "clozapine",
"id": "PA449061"
},
{
"name": "codeine",
"id": "PA449088"
},
{
"name": "darifenacin",
"id": "PA164774901"
},
{
"name": "desipramine",
"id": "PA449233"
},
{
"name": "deutetrabenazine",
"id": "PA166169881"
},
{
"name": "dextromethorphan / quinidine",
"id": "PA166175998"
},
{
"name": "dextromethorphan hydrobromide / bupropion hydrochloride",
"id": "PA166278341"
},
{
"name": "donepezil",
"id": "PA449394"
},
{
"name": "doxepin",
"id": "PA449409"
},
{
"name": "eliglustat",
"id": "PA166123486"
},
{
"name": "fesoterodine",
"id": "PA165958376"
},
{
"name": "flecainide",
"id": "PA449646"
},
{
"name": "fluoxetine",
"id": "PA449673"
},
{
"name": "fluoxetine / olanzapine",
"id": "PA166176027"
},
{
"name": "fluvoxamine",
"id": "PA449690"
},
{
"name": "galantamine",
"id": "PA449726"
},
{
"name": "gefitinib",
"id": "PA131301952"
},
{
"name": "haloperidol",
"id": "PA449841"
},
{
"name": "hydrocodone",
"id": "PA449900"
},
{
"name": "iloperidone",
"id": "PA161199368"
},
{
"name": "imipramine",
"id": "PA449969"
},
{
"name": "lofexidine",
"id": "PA164744510"
},
{
"name": "meclizine",
"id": "PA450338"
},
{
"name": "metoclopramide",
"id": "PA450475"
},
{
"name": "metoprolol",
"id": "PA450480"
},
{
"name": "mirabegron",
"id": "PA166177513"
},
{
"name": "nebivolol",
"id": "PA151958426"
},
{
"name": "nortriptyline",
"id": "PA450657"
},
{
"name": "oliceridine",
"id": "PA166223601"
},
{
"name": "ondansetron",
"id": "PA450705"
},
{
"name": "paroxetine",
"id": "PA450801"
},
{
"name": "perphenazine",
"id": "PA450882"
},
{
"name": "pimozide",
"id": "PA450965"
},
{
"name": "pitolisant",
"id": "PA166185163"
},
{
"name": "propafenone",
"id": "PA451131"
},
{
"name": "propranolol",
"id": "PA451145"
},
{
"name": "protriptyline",
"id": "PA451168"
},
{
"name": "risperidone",
"id": "PA451257"
},
{
"name": "tamoxifen",
"id": "PA451581"
},
{
"name": "tamsulosin",
"id": "PA451583"
},
{
"name": "tetrabenazine",
"id": "PA140222719"
},
{
"name": "thioridazine",
"id": "PA451666"
},
{
"name": "tolterodine",
"id": "PA164746757"
},
{
"name": "tramadol",
"id": "PA451735"
},
{
"name": "trimipramine",
"id": "PA451791"
},
{
"name": "tropisetron",
"id": "PA161925594"
},
{
"name": "valbenazine",
"id": "PA166170051"
},
{
"name": "venlafaxine",
"id": "PA451866"
},
{
"name": "viloxazine",
"id": "PA166251581"
},
{
"name": "vortioxetine",
"id": "PA166122595"
},
{
"name": "zuclopenthixol",
"id": "PA452629"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "CYP2D6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2D6",
"name": "*3",
"function": "No function",
"reference": false,
"activityValue": "0.0"
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "1.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"1.0"
],
"label": "*1/*3",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "CYP2D6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2D6",
"name": "*3",
"function": "No function",
"reference": false,
"activityValue": "0.0"
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "1.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"1.0"
],
"label": "*1/*3",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
],
"variants": [],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"CYP3A4": {
"alleleDefinitionVersion": "2026-02-09-10-28",
"alleleDefinitionSource": "CLINPGX",
"phenotypeVersion": "2026-02-09-10-28",
"geneSymbol": "CYP3A4",
"chr": "chr7",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "CYP3A4",
"version": "2",
"matches": {
"gene": "CYP3A4",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"quetiapine"
]
},
"exception_type": "note",
"message": "The CYP3A4 alleles are determined based on PharmVar CYP3A4 allele definitions. See PharmCAT disclaimer for further information."
},
{
"rule_name": "reference-allele",
"version": null,
"matches": null,
"exception_type": "note",
"message": "The CYP3A4 *1 allele assignment is characterized by the absence of variants at the positions that are included in the underlying allele definitions."
}
],
"relatedDrugs": [
{
"name": "quetiapine",
"id": "PA451201"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "CYP3A4",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP3A4",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP3A4",
"matchScore": 86,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "CYP3A4",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP3A4",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP3A4",
"matchScore": 86,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
],
"variants": [
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99758183,
"dbSnpId": "rs67666821",
"call": "G/G",
"alleles": [
"*20"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99758228,
"dbSnpId": "rs1584538410",
"call": "T/T",
"alleles": [
"*46"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99760836,
"dbSnpId": "rs4986913",
"call": "G/G",
"alleles": [
"*19"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99760901,
"dbSnpId": "rs4986910",
"call": "A/A",
"alleles": [
"*3",
"*37",
"*38"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99760956,
"dbSnpId": "rs774109750",
"call": "T/T",
"alleles": [
"*34"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99762047,
"dbSnpId": "rs4986909",
"call": "G/G",
"alleles": [
"*13"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99762054,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"*45"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99762069,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"*47"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99762177,
"dbSnpId": "rs12721629",
"call": "G/G",
"alleles": [
"*12"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99762186,
"dbSnpId": "rs756833413",
"call": "C/C",
"alleles": [
"*33"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99762206,
"dbSnpId": "rs67784355",
"call": "G/G",
"alleles": [
"*11",
"*38"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99762234,
"dbSnpId": "rs1318364992",
"call": "C/C",
"alleles": [
"*48"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99763877,
"dbSnpId": "rs368296206",
"call": "A/A",
"alleles": [
"*32"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99763909,
"dbSnpId": "rs1303250043",
"call": "G/G",
"alleles": [
"*31"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99763925,
"dbSnpId": "rs201821708",
"call": "T/T",
"alleles": [
"*21"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99764003,
"dbSnpId": "rs28371759",
"call": "A/A",
"alleles": [
"*18"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99766411,
"dbSnpId": "rs4646438",
"call": "G/G",
"alleles": [
"*6"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99766424,
"dbSnpId": "rs1429705359",
"call": "T/T",
"alleles": [
"*44"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99766439,
"dbSnpId": "rs145582851",
"call": "C/C",
"alleles": [
"*43"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99766440,
"dbSnpId": "rs138105638",
"call": "G/G",
"alleles": [
"*26"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99768360,
"dbSnpId": "rs55785340",
"call": "A/A",
"alleles": [
"*2"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99768371,
"dbSnpId": "rs55901263",
"call": "G/G",
"alleles": [
"*5"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99768424,
"dbSnpId": "rs113667357",
"call": "T/T",
"alleles": [
"*24"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99768447,
"dbSnpId": "rs3208361",
"call": "T/T",
"alleles": [
"*42"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99768458,
"dbSnpId": "rs4987161",
"call": "A/A",
"alleles": [
"*17"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99768470,
"dbSnpId": "rs12721627",
"call": "G/G",
"alleles": [
"*16"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99768693,
"dbSnpId": "rs35599367",
"call": "G/G",
"alleles": [
"*22",
"*37"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99769769,
"dbSnpId": "rs4986908",
"call": "C/C",
"alleles": [
"*10"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99769781,
"dbSnpId": "rs72552798",
"call": "C/C",
"alleles": [
"*9"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99769804,
"dbSnpId": "rs4986907",
"call": "C/C",
"alleles": [
"*15"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99769805,
"dbSnpId": "rs57409622",
"call": "G/G",
"alleles": [
"*23"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99770150,
"dbSnpId": "rs1483230173",
"call": "G/G",
"alleles": [
"*49"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99770165,
"dbSnpId": "rs72552799",
"call": "C/C",
"alleles": [
"*8"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99770166,
"dbSnpId": "rs778013004",
"call": "G/G",
"alleles": [
"*30"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99770196,
"dbSnpId": "rs2485889420",
"call": "T/T",
"alleles": [
"*41"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99770202,
"dbSnpId": "rs55951658",
"call": "T/T",
"alleles": [
"*4"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99770217,
"dbSnpId": "rs1449865051",
"call": "A/A",
"alleles": [
"*29"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99778079,
"dbSnpId": "rs56324128",
"call": "C/C",
"alleles": [
"*7"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99780036,
"dbSnpId": "rs2485908963",
"call": "G/G",
"alleles": [
"*40"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99784018,
"dbSnpId": "rs570051168",
"call": "G/G",
"alleles": [
"*28"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99784038,
"dbSnpId": "rs12721634",
"call": "A/A",
"alleles": [
"*14"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99784075,
"dbSnpId": "rs188389063",
"call": "G/G",
"alleles": [
"*35"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99784078,
"dbSnpId": "rs1226205448",
"call": "C/C",
"alleles": [
"*39"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"CYP3A5": {
"alleleDefinitionVersion": "2026-02-09-10-28",
"alleleDefinitionSource": "CLINPGX",
"phenotypeVersion": "2026-02-09-10-28",
"geneSymbol": "CYP3A5",
"chr": "chr7",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "CYP3A5 reverse complement footnote",
"version": "1",
"matches": {
"gene": "CYP3A5",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": []
},
"exception_type": "footnote",
"message": "The CYP3A5 gene is on the negative chromosomal strand, all genotype calls for CYP3A5 in this report refer to the positive chromosomal strand. Therefore, genotype calls are complemented from gene bases."
},
{
"rule_name": "reference-allele",
"version": null,
"matches": null,
"exception_type": "note",
"message": "The CYP3A5 *1 allele assignment is characterized by the absence of variants at the positions that are included in the underlying allele definitions."
}
],
"relatedDrugs": [
{
"name": "tacrolimus",
"id": "PA451578"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "CYP3A5",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP3A5",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP3A5",
"matchScore": 10,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "CYP3A5",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP3A5",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP3A5",
"matchScore": 10,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
],
"variants": [
{
"gene": "CYP3A5",
"chromosome": "chr7",
"position": 99652770,
"dbSnpId": "rs41303343",
"call": "T/T",
"alleles": [
"*7"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A5",
"chromosome": "chr7",
"position": 99660516,
"dbSnpId": "rs28383479",
"call": "C/C",
"alleles": [
"*9"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A5",
"chromosome": "chr7",
"position": 99665212,
"dbSnpId": "rs10264272",
"call": "C/C",
"alleles": [
"*6"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A5",
"chromosome": "chr7",
"position": 99672916,
"dbSnpId": "rs776746",
"call": "T/T",
"alleles": [
"*3"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A5",
"chromosome": "chr7",
"position": 99676198,
"dbSnpId": "rs55817950",
"call": "G/G",
"alleles": [
"*8"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"CYP4F2": {
"alleleDefinitionVersion": "2026-02-09-10-28",
"alleleDefinitionSource": "CLINPGX",
"phenotypeVersion": null,
"geneSymbol": "CYP4F2",
"chr": "chr19",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "reference-allele",
"version": null,
"matches": null,
"exception_type": "note",
"message": "The CYP4F2 *1 allele assignment is characterized by the absence of variants at the positions that are included in the underlying allele definitions."
}
],
"relatedDrugs": [
{
"name": "warfarin",
"id": "PA451906"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "CYP4F2",
"name": "*1",
"function": null,
"reference": true,
"activityValue": null
},
"allele2": {
"gene": "CYP4F2",
"name": "*1",
"function": null,
"reference": true,
"activityValue": null
},
"gene": "CYP4F2",
"matchScore": 40,
"phenotypes": [],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "CYP4F2",
"name": "*1",
"function": null,
"reference": true,
"activityValue": null
},
"allele2": {
"gene": "CYP4F2",
"name": "*1",
"function": null,
"reference": true,
"activityValue": null
},
"gene": "CYP4F2",
"matchScore": 40,
"phenotypes": [],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
],
"variants": [
{
"gene": "CYP4F2",
"chromosome": "chr19",
"position": 15878779,
"dbSnpId": "rs3093200",
"call": "G/G",
"alleles": [
"*5",
"*23"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP4F2",
"chromosome": "chr19",
"position": 15878886,
"dbSnpId": "rs3952537",
"call": "G/G",
"alleles": [
"*19"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP4F2",
"chromosome": "chr19",
"position": 15878920,
"dbSnpId": "rs4020346",
"call": "T/T",
"alleles": [
"*17"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP4F2",
"chromosome": "chr19",
"position": 15879412,
"dbSnpId": "rs138971789",
"call": "C/C",
"alleles": [
"*15"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP4F2",
"chromosome": "chr19",
"position": 15879413,
"dbSnpId": "rs142113670",
"call": "G/G",
"alleles": [
"*21"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP4F2",
"chromosome": "chr19",
"position": 15879621,
"dbSnpId": "rs2108622",
"call": "C/C",
"alleles": [
"*3",
"*4",
"*22"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP4F2",
"chromosome": "chr19",
"position": 15886018,
"dbSnpId": "rs145174239",
"call": "G/G",
"alleles": [
"*14"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP4F2",
"chromosome": "chr19",
"position": 15889671,
"dbSnpId": "rs144233412",
"call": "C/C",
"alleles": [
"*13"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP4F2",
"chromosome": "chr19",
"position": 15890405,
"dbSnpId": "rs3093153",
"call": "C/C",
"alleles": [
"*6"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP4F2",
"chromosome": "chr19",
"position": 15892379,
"dbSnpId": "rs200629062",
"call": "G/G",
"alleles": [
"*20"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP4F2",
"chromosome": "chr19",
"position": 15892398,
"dbSnpId": "rs556151888",
"call": "G/G",
"alleles": [
"*23"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP4F2",
"chromosome": "chr19",
"position": 15892541,
"dbSnpId": "rs145875499",
"call": "C/C",
"alleles": [
"*12"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP4F2",
"chromosome": "chr19",
"position": 15895526,
"dbSnpId": "rs148396222",
"call": "C/C",
"alleles": [
"*18"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP4F2",
"chromosome": "chr19",
"position": 15895527,
"dbSnpId": "rs114396708",
"call": "G/G",
"alleles": [
"*11"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP4F2",
"chromosome": "chr19",
"position": 15895551,
"dbSnpId": "rs150579280",
"call": "T/T",
"alleles": [
"*22"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP4F2",
"chromosome": "chr19",
"position": 15895560,
"dbSnpId": "rs144455532",
"call": "G/G",
"alleles": [
"*10"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP4F2",
"chromosome": "chr19",
"position": 15897466,
"dbSnpId": "rs201380574",
"call": "C/C",
"alleles": [
"*9"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP4F2",
"chromosome": "chr19",
"position": 15897473,
"dbSnpId": "rs115517770",
"call": "G/G",
"alleles": [
"*8"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP4F2",
"chromosome": "chr19",
"position": 15897566,
"dbSnpId": "rs114099324",
"call": "C/C",
"alleles": [
"*7"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP4F2",
"chromosome": "chr19",
"position": 15897578,
"dbSnpId": "rs3093105",
"call": "A/A",
"alleles": [
"*2",
"*4"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"DPYD": {
"alleleDefinitionVersion": "2026-02-09-10-28",
"alleleDefinitionSource": "CLINPGX",
"phenotypeVersion": "2026-02-09-10-28",
"geneSymbol": "DPYD",
"chr": "chr1",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "DPYD lowest activity score note",
"version": "2",
"matches": {
"gene": "DPYD",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": []
},
"exception_type": "note",
"message": "The two lowest activity values (variant activity scores, see CPIC guideline PMID:29152729) are used for unphased data and the lowest activity value per allele is used for phased data to determine the gene activity score and phenotype to retrieve prescribing recommendations. "
},
{
"rule_name": "DPYD reverse complement footnote",
"version": "1",
"matches": {
"gene": "DPYD",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": []
},
"exception_type": "footnote",
"message": "The DPYD gene is on the negative chromosomal strand, all genotype calls for DPYD in this report refer to the positive chromosomal strand. Therefore, genotype calls are complemented from gene bases."
},
{
"rule_name": "reference-allele",
"version": null,
"matches": null,
"exception_type": "note",
"message": "The DPYD Reference allele assignment is characterized by the absence of variants at the positions that are included in the underlying allele definitions."
}
],
"relatedDrugs": [
{
"name": "capecitabine",
"id": "PA448771"
},
{
"name": "flucytosine",
"id": "PA449654"
},
{
"name": "fluorouracil",
"id": "PA128406956"
},
{
"name": "tegafur",
"id": "PA452620"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "DPYD",
"matchScore": 166,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
],
"matcherComponentHaplotypes": [
{
"allele1": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": null,
"gene": "DPYD",
"matchScore": 83,
"phenotypes": [
"Indeterminate"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "n/a",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"n/a"
],
"label": "Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 1.0
}
}
],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "DPYD",
"matchScore": 0,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": [
{
"allele1": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "DPYD",
"matchScore": 166,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
],
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
],
"variants": [
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97078987,
"dbSnpId": "rs114096998",
"call": "G/G",
"alleles": [
"c.3067C>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97078993,
"dbSnpId": "rs148799944",
"call": "C/C",
"alleles": [
"c.3061G>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97079005,
"dbSnpId": "rs140114515",
"call": "C/C",
"alleles": [
"c.3049G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97079071,
"dbSnpId": "rs1801268",
"call": "C/C",
"alleles": [
"c.2983G>T (*10)"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97079076,
"dbSnpId": "rs139459586",
"call": "A/A",
"alleles": [
"c.2978T>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97079077,
"dbSnpId": "rs202144771",
"call": "G/G",
"alleles": [
"c.2977C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97079121,
"dbSnpId": "rs72547601",
"call": "T/T",
"alleles": [
"c.2933A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97079133,
"dbSnpId": "rs72547602",
"call": "T/T",
"alleles": [
"c.2921A>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97079139,
"dbSnpId": "rs145529148",
"call": "T/T",
"alleles": [
"c.2915A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97082365,
"dbSnpId": "rs141044036",
"call": "T/T",
"alleles": [
"c.2872A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97082391,
"dbSnpId": "rs67376798",
"call": "T/T",
"alleles": [
"c.2846A>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97098598,
"dbSnpId": "rs1801267",
"call": "C/C",
"alleles": [
"c.2657G>A (*9B)"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97098599,
"dbSnpId": "rs147545709",
"call": "G/G",
"alleles": [
"c.2656C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97098616,
"dbSnpId": "rs55674432",
"call": "C/C",
"alleles": [
"c.2639G>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97098632,
"dbSnpId": "rs201035051",
"call": "T/T",
"alleles": [
"c.2623A>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97193109,
"dbSnpId": "rs60139309",
"call": "T/T",
"alleles": [
"c.2582A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97193209,
"dbSnpId": "rs200687447",
"call": "C/C",
"alleles": [
"c.2482G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97234958,
"dbSnpId": "rs199634007",
"call": "G/G",
"alleles": [
"c.2336C>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97234991,
"dbSnpId": "rs56005131",
"call": "G/G",
"alleles": [
"c.2303C>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97305279,
"dbSnpId": "rs112766203",
"call": "G/G",
"alleles": [
"c.2279C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97305363,
"dbSnpId": "rs60511679",
"call": "A/A",
"alleles": [
"c.2195T>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97305364,
"dbSnpId": "rs1801160",
"call": "C/C",
"alleles": [
"c.2194G>A (*6)"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97305372,
"dbSnpId": "rs146529561",
"call": "G/G",
"alleles": [
"c.2186C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97306195,
"dbSnpId": "rs145548112",
"call": "C/C",
"alleles": [
"c.2161G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97373598,
"dbSnpId": "rs137999090",
"call": "C/C",
"alleles": [
"c.2021G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97373629,
"dbSnpId": "rs138545885",
"call": "C/C",
"alleles": [
"c.1990G>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97382461,
"dbSnpId": "rs55971861",
"call": "T/T",
"alleles": [
"c.1906A>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97450058,
"dbSnpId": "rs3918290",
"call": "C/C",
"alleles": [
"c.1905+1G>A (*2A)"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97450059,
"dbSnpId": "rs3918289",
"call": "G/G",
"alleles": [
"c.1905C>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97450065,
"dbSnpId": "rs72549303",
"call": "TG/TG",
"alleles": [
"c.1898delC (*3)"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "TG",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97450068,
"dbSnpId": "rs17376848",
"call": "A/A",
"alleles": [
"c.1896T>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97450168,
"dbSnpId": "rs147601618",
"call": "A/A",
"alleles": [
"c.1796T>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97450187,
"dbSnpId": "rs145773863",
"call": "C/C",
"alleles": [
"c.1777G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97450189,
"dbSnpId": "rs138616379",
"call": "C/C",
"alleles": [
"c.1775G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97450190,
"dbSnpId": "rs59086055",
"call": "G/G",
"alleles": [
"c.1774C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97515784,
"dbSnpId": "rs201615754",
"call": "C/C",
"alleles": [
"c.1682G>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97515787,
"dbSnpId": "rs55886062",
"call": "A/A",
"alleles": [
"c.1679T>G (*13)"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97515839,
"dbSnpId": "rs1801159",
"call": "T/T",
"alleles": [
"c.1627A>G (*5)"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97515851,
"dbSnpId": "rs142619737",
"call": "C/C",
"alleles": [
"c.1615G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97515865,
"dbSnpId": "rs1801158",
"call": "C/C",
"alleles": [
"c.1601G>A (*4)"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97515889,
"dbSnpId": "rs190951787",
"call": "G/G",
"alleles": [
"c.1577C>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97515923,
"dbSnpId": "rs148994843",
"call": "C/C",
"alleles": [
"c.1543G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97549565,
"dbSnpId": "rs138391898",
"call": "C/C",
"alleles": [
"c.1519G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97549600,
"dbSnpId": "rs111858276",
"call": "T/T",
"alleles": [
"c.1484A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97549609,
"dbSnpId": "rs72549304",
"call": "G/G",
"alleles": [
"c.1475C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97549681,
"dbSnpId": "rs199549923",
"call": "G/G",
"alleles": [
"c.1403C>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97549713,
"dbSnpId": "rs57918000",
"call": "G/G",
"alleles": [
"c.1371C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97549726,
"dbSnpId": "rs144395748",
"call": "G/G",
"alleles": [
"c.1358C>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97549735,
"dbSnpId": "rs72975710",
"call": "G/G",
"alleles": [
"c.1349C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97573785,
"dbSnpId": "rs186169810",
"call": "A/A",
"alleles": [
"c.1314T>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97573805,
"dbSnpId": "rs142512579",
"call": "C/C",
"alleles": [
"c.1294G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97573821,
"dbSnpId": "rs764666241",
"call": "C/C",
"alleles": [
"c.1278G>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97573839,
"dbSnpId": "rs200064537",
"call": "A/A",
"alleles": [
"c.1260T>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97573863,
"dbSnpId": "rs56038477",
"call": "C/C",
"alleles": [
"c.1129-5923C>G, c.1236G>A (HapB3)"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97573881,
"dbSnpId": "rs61622928",
"call": "C/C",
"alleles": [
"c.1218G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97573918,
"dbSnpId": "rs143815742",
"call": "C/C",
"alleles": [
"c.1181G>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97573919,
"dbSnpId": "rs140602333",
"call": "G/G",
"alleles": [
"c.1180C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97573943,
"dbSnpId": "rs78060119",
"call": "C/C",
"alleles": [
"c.1156G>T (*12)"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97579893,
"dbSnpId": "rs75017182",
"call": "G/G",
"alleles": [
"c.1129-5923C>G",
"c.1129-5923C>G, c.1236G>A (HapB3)"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97593238,
"dbSnpId": "rs72549305",
"call": "T/T",
"alleles": [
"c.1108A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97593289,
"dbSnpId": "rs143154602",
"call": "G/G",
"alleles": [
"c.1057C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97593322,
"dbSnpId": "rs183385770",
"call": "C/C",
"alleles": [
"c.1024G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97593343,
"dbSnpId": "rs72549306",
"call": "C/C",
"alleles": [
"c.1003G>T (*11)"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97593379,
"dbSnpId": "rs201018345",
"call": "C/C",
"alleles": [
"c.967G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97595083,
"dbSnpId": "rs145112791",
"call": "G/G",
"alleles": [
"c.934C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97595088,
"dbSnpId": "rs150437414",
"call": "A/A",
"alleles": [
"c.929T>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97595149,
"dbSnpId": "rs146356975",
"call": "T/T",
"alleles": [
"c.868A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97679170,
"dbSnpId": "rs45589337",
"call": "T/T",
"alleles": [
"c.775A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97691776,
"dbSnpId": "rs1801266",
"call": "G/G",
"alleles": [
"c.703C>T (*8)"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97699399,
"dbSnpId": "rs72549307",
"call": "T/T",
"alleles": [
"c.632A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97699430,
"dbSnpId": "rs72549308",
"call": "T/T",
"alleles": [
"c.601A>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97699474,
"dbSnpId": "rs115232898",
"call": "T/T",
"alleles": [
"c.557A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97699506,
"dbSnpId": "rs6670886",
"call": "C/C",
"alleles": [
"c.525G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97699533,
"dbSnpId": "rs139834141",
"call": "C/C",
"alleles": [
"c.498G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97699535,
"dbSnpId": "rs2297595",
"call": "T/T",
"alleles": [
"c.496A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97721542,
"dbSnpId": "rs200562975",
"call": "T/T",
"alleles": [
"c.451A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97721650,
"dbSnpId": "rs141462178",
"call": "T/T",
"alleles": [
"c.343A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97740400,
"dbSnpId": "rs150385342",
"call": "C/C",
"alleles": [
"c.313G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97740410,
"dbSnpId": "rs72549309",
"call": "GATGA/GATGA",
"alleles": [
"c.295_298delTCAT (*7)"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "GATGA",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97883329,
"dbSnpId": "rs1801265",
"call": "A/A",
"alleles": [
"c.85T>C (*9A)"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97883352,
"dbSnpId": "rs80081766",
"call": "C/C",
"alleles": [
"c.62G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97883353,
"dbSnpId": "rs72549310",
"call": "G/G",
"alleles": [
"c.61C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97883368,
"dbSnpId": "rs150036960",
"call": "G/G",
"alleles": [
"c.46C>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"G6PD": {
"alleleDefinitionVersion": "2026-02-09-10-28",
"alleleDefinitionSource": "CLINPGX",
"phenotypeVersion": "2026-02-09-10-28",
"geneSymbol": "G6PD",
"chr": "chrX",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "G6PD hemizygous samples",
"version": "2",
"matches": {
"gene": "G6PD",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"aminosalicylic acid",
"aspirin",
"chloramphenicol",
"chloroquine",
"ciprofloxacin",
"dapsone",
"dimercaprol",
"doxorubicin",
"furazolidone",
"glyburide",
"hydroxychloroquine",
"mafenide",
"methylene blue",
"nalidixic acid",
"nitrofurantoin",
"norfloxacin",
"ofloxacin",
"pegloticase",
"phenazopyridine",
"primaquine",
"quinine",
"rasburicase",
"sulfadiazine",
"sulfadimidine",
"sulfamethoxazole",
"trimethoprim",
"sulfanilamide",
"sulfasalazine",
"sulfisoxazole",
"tafenoquine",
"tolbutamide",
"toluidine blue",
"vitamin c",
"vitamin k"
]
},
"exception_type": "note",
"message": "PharmCAT reports based on VCF file input and some VCF files do not specify hemizygous (one X chromosome) and instead represent samples as homozygous. See PharmCAT FAQs (https://pharmcat.org/faqs/)."
},
{
"rule_name": "reference-allele",
"version": null,
"matches": null,
"exception_type": "note",
"message": "The G6PD B (reference) allele assignment is characterized by the absence of variants at the positions that are included in the underlying allele definitions."
}
],
"relatedDrugs": [
{
"name": "Ascorbic acid (vitamin C), combinations",
"id": "PA164712515"
},
{
"name": "Ascorbic acid (vitamin C), plain",
"id": "PA164712516"
},
{
"name": "articaine / epinephrine",
"id": "PA166182783"
},
{
"name": "bupivacaine",
"id": "PA135057240"
},
{
"name": "chloroquine",
"id": "PA448948"
},
{
"name": "chlorpropamide",
"id": "PA448966"
},
{
"name": "dabrafenib",
"id": "PA166114911"
},
{
"name": "dapsone",
"id": "PA449211"
},
{
"name": "flutamide",
"id": "PA449685"
},
{
"name": "glimepiride",
"id": "PA449761"
},
{
"name": "glipizide",
"id": "PA449762"
},
{
"name": "glyburide",
"id": "PA449782"
},
{
"name": "hydroxychloroquine",
"id": "PA164777036"
},
{
"name": "lidocaine / prilocaine",
"id": "PA166176018"
},
{
"name": "lidocaine and tetracaine",
"id": "PA166182735"
},
{
"name": "mepivacaine",
"id": "PA164748741"
},
{
"name": "methylene blue",
"id": "PA450457"
},
{
"name": "moviprep",
"id": "PA166163260"
},
{
"name": "nalidixic acid",
"id": "PA164746384"
},
{
"name": "nitrofurantoin",
"id": "PA450640"
},
{
"name": "oxymetazoline and tetracaine",
"id": "PA166182885"
},
{
"name": "pegloticase",
"id": "PA165963961"
},
{
"name": "primaquine",
"id": "PA451103"
},
{
"name": "rasburicase",
"id": "PA10176"
},
{
"name": "ropivacaine",
"id": "PA451271"
},
{
"name": "sodium ascorbate",
"id": "PA166163262"
},
{
"name": "sodium nitrite",
"id": "PA166115361"
},
{
"name": "sulfasalazine",
"id": "PA451547"
},
{
"name": "tafenoquine",
"id": "PA166115580"
},
{
"name": "tolazamide",
"id": "PA164774902"
},
{
"name": "tolbutamide",
"id": "PA451718"
},
{
"name": "toluidine blue",
"id": "PA166268821"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "G6PD",
"name": "B (reference)",
"function": "IV/Normal",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "G6PD",
"name": "B (reference)",
"function": "IV/Normal",
"reference": true,
"activityValue": "n/a"
},
"gene": "G6PD",
"matchScore": 342,
"phenotypes": [
"Normal"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal"
],
"label": "B (reference)/B (reference)",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"B (reference)": 2.0
}
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "G6PD",
"name": "B (reference)",
"function": "IV/Normal",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "G6PD",
"name": "B (reference)",
"function": "IV/Normal",
"reference": true,
"activityValue": "n/a"
},
"gene": "G6PD",
"matchScore": 342,
"phenotypes": [
"Normal"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal"
],
"label": "B (reference)/B (reference)",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"B (reference)": 2.0
}
}
],
"variants": [
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532046,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"Bangkok Noi"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532055,
"dbSnpId": null,
"call": "CTCT/CTCT",
"alleles": [
"Brighton"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "CTCT",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532082,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Arakawa"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532083,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Buenos Aires"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532085,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Campinas"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532086,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Fukaya"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532203,
"dbSnpId": "rs137852348",
"call": "G/G",
"alleles": [
"Split"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532231,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"Laibin"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532245,
"dbSnpId": "rs137852344",
"call": "G/G",
"alleles": [
"Neapolis"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532257,
"dbSnpId": "rs72554664",
"call": "C/C",
"alleles": [
"Kaiping, Anant, Dhon, Sapporo-like, Wosera"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532258,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Flores",
"Kamiube, Keelung"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532264,
"dbSnpId": "rs782608284",
"call": "C/C",
"alleles": [
"Yunan"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532265,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Nice"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532269,
"dbSnpId": "rs72554665",
"call": "C/C",
"alleles": [
"Bangkok Noi",
"Canton, Taiwan-Hakka, Gifu-like, Agrigento-like",
"Cosenza"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532278,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"Amiens"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532279,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Figuera da Foz"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532389,
"dbSnpId": "rs137852324",
"call": "C/C",
"alleles": [
"Andalus"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532390,
"dbSnpId": "rs398123546",
"call": "G/G",
"alleles": [
"Hermoupolis",
"Honiara",
"Union,Maewo, Chinese-2, Kalo"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532392,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"Harima"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532403,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Cassano",
"Hermoupolis"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532408,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"S. Antioco"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532411,
"dbSnpId": "rs137852317",
"call": "C/C",
"alleles": [
"Santiago de Cuba, Morioka"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532432,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Telti, Kobe"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532434,
"dbSnpId": "rs137852337",
"call": "C/C",
"alleles": [
"Pawnee"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532458,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"Sumare"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532459,
"dbSnpId": "rs782098548",
"call": "C/C",
"alleles": [
"Surabaya"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532570,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Georgia"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532590,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"202G>A_376A>G_1264C>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532608,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Tokyo, Fukushima"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532623,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"Munich"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532625,
"dbSnpId": "rs137852336",
"call": "C/C",
"alleles": [
"Japan, Shinagawa",
"Kawasaki"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532626,
"dbSnpId": "rs137852323",
"call": "C/C",
"alleles": [
"Riverside"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532628,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Suwalki"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532629,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Utrecht"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532634,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"Abeno"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532639,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Clinic"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532649,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Covao do Lobo"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532661,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"Anadia"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532662,
"dbSnpId": "rs137852325",
"call": "C/C",
"alleles": [
"Puerto Limon"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532667,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Bari"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532674,
"dbSnpId": "rs137852335",
"call": "C/C",
"alleles": [
"Alhambra"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532676,
"dbSnpId": "rs137852316",
"call": "C/C",
"alleles": [
"Nashville, Anaheim, Portici"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532677,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Wisconsin"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532679,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"Krakow"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532688,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"Praha"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532692,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"Hartford"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532694,
"dbSnpId": "rs137852321",
"call": "C/C",
"alleles": [
"Beverly Hills, Genova, Iwate, Niigata, Yamaguchi"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532695,
"dbSnpId": "rs137852334",
"call": "G/G",
"alleles": [
"Guadalajara",
"Mt Sinai"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532698,
"dbSnpId": "rs137852320",
"call": "T/T",
"alleles": [
"Iowa, Walter Reed, Springfield"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532699,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Madrid"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532700,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Lynwood"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532701,
"dbSnpId": "rs137852322",
"call": "A/A",
"alleles": [
"Tomah"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532713,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"Olomouc"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532715,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"Riley"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532716,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"Calvo Mackenna"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532722,
"dbSnpId": "rs371489738",
"call": "C/C",
"alleles": [
"Montpellier"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532752,
"dbSnpId": null,
"call": "CGGCCTTGCGCTCGTTCAG/CGGCCTTGCGCTCGTTCAG",
"alleles": [
"Tondela"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "CGGCCTTGCGCTCGTTCAG",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532758,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"Tenri"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532765,
"dbSnpId": "rs137852329",
"call": "G/G",
"alleles": [
"Aachen",
"Loma Linda"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532772,
"dbSnpId": "rs137852345",
"call": "G/G",
"alleles": [
"Serres"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532773,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Iwatsuki"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532797,
"dbSnpId": "rs137852333",
"call": "G/G",
"alleles": [
"Ierapetra"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532802,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Partenope"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532945,
"dbSnpId": "rs34193178",
"call": "C/C",
"alleles": [
"Mira d'Aire"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532956,
"dbSnpId": "rs398123544",
"call": "T/T",
"alleles": [
"Cincinnati"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532969,
"dbSnpId": "rs137852342",
"call": "G/G",
"alleles": [
"Chinese-5"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532987,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"Torun"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532989,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Fushan"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532990,
"dbSnpId": "rs5030869",
"call": "C/C",
"alleles": [
"Chatham"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533004,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Insuli"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533012,
"dbSnpId": null,
"call": "CGTGGGGTCGTCCAGGTACCCTTTG/CGTGGGGTCGTCCAGGTACCCTTTG",
"alleles": [
"Nara"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "CGTGGGGTCGTCCAGGTACCCTTTG",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533016,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Farroupilha"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533025,
"dbSnpId": "rs76723693",
"call": "A/A",
"alleles": [
"A- 968C_376G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533029,
"dbSnpId": "rs137852347",
"call": "A/A",
"alleles": [
"Rehevot"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533031,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Manhattan"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533044,
"dbSnpId": "rs137852339",
"call": "C/C",
"alleles": [
"Kalyan-Kerala, Jamnaga, Rohini"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533064,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Ludhiana"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533072,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Omiya"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533077,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Seoul"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533083,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"West Virginia"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533122,
"dbSnpId": "rs137852327",
"call": "C/C",
"alleles": [
"Ananindeua",
"Hechi",
"Viangchan, Jammu"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533586,
"dbSnpId": "rs74575103",
"call": "C/C",
"alleles": [
"Montalbano"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533587,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Osaka"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533589,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"Piotrkow"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533591,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Papua"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533592,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"Mizushima"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533596,
"dbSnpId": "rs137852318",
"call": "C/C",
"alleles": [
"Bajo Maumere",
"Seattle, Lodi, Modena, Ferrara II, Athens-like"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533605,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"Chinese-1",
"Haikou"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533607,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Wexham"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533608,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"La Jolla"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533614,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Sugao"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533615,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Bangkok"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533619,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"Lille"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533620,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Cleveland Corum"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533629,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Roubaix"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533634,
"dbSnpId": "rs137852346",
"call": "C/C",
"alleles": [
"Aveiro"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534036,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Wayne"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534074,
"dbSnpId": null,
"call": "TCAGTGC/TCAGTGC",
"alleles": [
"Stonybrook"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "TCAGTGC",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534092,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"Durham"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534102,
"dbSnpId": "rs782757170",
"call": "G/G",
"alleles": [
"Nanning"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534110,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Asahikawa"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534116,
"dbSnpId": null,
"call": "ATGT/ATGT",
"alleles": [
"North Dallas"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "ATGT",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534125,
"dbSnpId": "rs137852328",
"call": "C/C",
"alleles": [
"A- 680T_376G",
"Mexico City"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534126,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Radlowo"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534157,
"dbSnpId": "rs137852319",
"call": "A/A",
"alleles": [
"Harilaou"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534345,
"dbSnpId": "rs137852326",
"call": "C/C",
"alleles": [
"Cincinnati",
"Minnesota, Marion, Gastonia, LeJeune"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534348,
"dbSnpId": "rs782754619",
"call": "T/T",
"alleles": [
"Sibari"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534387,
"dbSnpId": "rs781865768",
"call": "T/T",
"alleles": [
"Dagua"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534389,
"dbSnpId": "rs137852332",
"call": "C/C",
"alleles": [
"Nilgiri",
"Santiago"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534390,
"dbSnpId": "rs137852330",
"call": "G/G",
"alleles": [
"Coimbra Shunde",
"Vancouver"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534409,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Pedoplis-Ckaro"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534414,
"dbSnpId": null,
"call": "GGGA/GGGA",
"alleles": [
"Tsukui"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "GGGA",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534419,
"dbSnpId": "rs5030868",
"call": "G/G",
"alleles": [
"Mediterranean, Dallas, Panama, Sassari, Cagliari, Birmingham"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534438,
"dbSnpId": "rs267606836",
"call": "G/G",
"alleles": [
"Vancouver"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534440,
"dbSnpId": "rs5030872",
"call": "T/T",
"alleles": [
"Malaga",
"Santa Maria"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534447,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"Chikugo"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534455,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"Shinshu"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534463,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Miaoli"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534465,
"dbSnpId": "rs137852343",
"call": "A/A",
"alleles": [
"Nankang"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534468,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Volendam"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534485,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Naone"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534486,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Toledo"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534489,
"dbSnpId": "rs137852331",
"call": "T/T",
"alleles": [
"Taipei, Chinese-3"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534494,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Plymouth"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534495,
"dbSnpId": "rs137852314",
"call": "C/C",
"alleles": [
"Mahidol"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535176,
"dbSnpId": "rs370918918",
"call": "C/C",
"alleles": [
"Gond"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535180,
"dbSnpId": "rs782487723",
"call": "C/C",
"alleles": [
"Shenzen"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535187,
"dbSnpId": "rs137852313",
"call": "C/C",
"alleles": [
"Ilesha"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535190,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Acrokorinthos"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535211,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Liuzhou"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535244,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Belem"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535247,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Valladolid"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535249,
"dbSnpId": "rs782322505",
"call": "T/T",
"alleles": [
"Cairo"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535261,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Quing Yan"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535269,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Crispim"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535270,
"dbSnpId": "rs78365220",
"call": "A/A",
"alleles": [
"Crispim",
"Salerno Pyrgos",
"Vanua Lava"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535274,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Crispim"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535277,
"dbSnpId": "rs1050829",
"call": "T/T",
"alleles": [
"202G>A_376A>G_1264C>G",
"A",
"A- 202A_376G",
"A- 680T_376G",
"A- 968C_376G",
"Acrokorinthos",
"Ananindeua",
"Mt Sinai",
"Santa Maria",
"Sierra Leone"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535278,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Crispim"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535301,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"Bao Loc"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535316,
"dbSnpId": "rs5030870",
"call": "C/C",
"alleles": [
"Sao Borja"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535330,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"Hammersmith"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535336,
"dbSnpId": "rs267606835",
"call": "G/G",
"alleles": [
"Vancouver"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535342,
"dbSnpId": "rs181277621",
"call": "C/C",
"alleles": [
"Sierra Leone"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535367,
"dbSnpId": null,
"call": "GCTT/GCTT",
"alleles": [
"Urayasu"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "GCTT",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535379,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Guangzhou"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535962,
"dbSnpId": "rs782308266",
"call": "C/C",
"alleles": [
"Lagosanto"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535963,
"dbSnpId": "rs138687036",
"call": "G/G",
"alleles": [
"Ube Konan"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535980,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"Swansea"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535995,
"dbSnpId": "rs782090947",
"call": "T/T",
"alleles": [
"Murcia Oristano"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535996,
"dbSnpId": "rs137852349",
"call": "A/A",
"alleles": [
"Namouru"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154536002,
"dbSnpId": "rs1050828",
"call": "C/C",
"alleles": [
"202G>A_376A>G_1264C>G",
"A- 202A_376G",
"Asahi",
"Hechi"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154536008,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"Songklanagarind"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154536019,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Amazonia",
"Musashino"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154536021,
"dbSnpId": null,
"call": "CAGA/CAGA",
"alleles": [
"Amsterdam"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "CAGA",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154536025,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"Costanzo"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154536032,
"dbSnpId": "rs137852315",
"call": "C/C",
"alleles": [
"Metaponto"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154536034,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Palestrina"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154536035,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Kamogawa"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154536045,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Kozukata"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154536151,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Kambos"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154536156,
"dbSnpId": "rs76645461",
"call": "A/A",
"alleles": [
"Aures"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154536168,
"dbSnpId": "rs78478128",
"call": "G/G",
"alleles": [
"Orissa"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154536169,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Rignano"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154546045,
"dbSnpId": "rs137852338",
"call": "CATG/CATG",
"alleles": [
"Sunderland"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "CATG",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154546046,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"Gidra"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154546057,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"Honiara"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154546061,
"dbSnpId": "rs137852340",
"call": "T/T",
"alleles": [
"Gaohe"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154546116,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Lages"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154546122,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Sinnai"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154546131,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"No name"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"HLA-A": {
"alleleDefinitionVersion": null,
"alleleDefinitionSource": "UNKNOWN",
"phenotypeVersion": null,
"geneSymbol": "HLA-A",
"chr": null,
"phased": false,
"effectivelyPhased": false,
"callSource": "NONE",
"uncalledHaplotypes": [],
"messages": [],
"relatedDrugs": [
{
"name": "carbamazepine",
"id": "PA448785"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "HLA-A",
"name": "Unknown",
"function": null,
"reference": false,
"activityValue": null
},
"allele2": {
"gene": "HLA-A",
"name": "Unknown",
"function": null,
"reference": false,
"activityValue": null
},
"gene": "HLA-A",
"matchScore": 0,
"phenotypes": [],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"No Result"
],
"label": "Unknown/Unknown",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Unknown": 2.0
}
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "HLA-A",
"name": "Unknown",
"function": null,
"reference": false,
"activityValue": null
},
"allele2": {
"gene": "HLA-A",
"name": "Unknown",
"function": null,
"reference": false,
"activityValue": null
},
"gene": "HLA-A",
"matchScore": 0,
"phenotypes": [],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"No Result"
],
"label": "Unknown/Unknown",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Unknown": 2.0
}
}
],
"variants": [],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"HLA-B": {
"alleleDefinitionVersion": null,
"alleleDefinitionSource": "UNKNOWN",
"phenotypeVersion": null,
"geneSymbol": "HLA-B",
"chr": null,
"phased": false,
"effectivelyPhased": false,
"callSource": "OUTSIDE",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "pcat-outside-call",
"version": "1",
"matches": {
"gene": null,
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": []
},
"exception_type": "",
"message": "This comes from an outside data source which does not supply position-level detail. For specific disclaimers and limitations, see the original genotyping source."
}
],
"relatedDrugs": [
{
"name": "abacavir",
"id": "PA448004"
},
{
"name": "allopurinol",
"id": "PA448320"
},
{
"name": "carbamazepine",
"id": "PA448785"
},
{
"name": "flucloxacillin",
"id": "PA164781042"
},
{
"name": "fosphenytoin",
"id": "PA164746820"
},
{
"name": "lamotrigine",
"id": "PA450164"
},
{
"name": "oxcarbazepine",
"id": "PA450732"
},
{
"name": "pazopanib",
"id": "PA165291492"
},
{
"name": "phenytoin",
"id": "PA450947"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "HLA-B",
"name": "*15:02",
"function": null,
"reference": false,
"activityValue": null
},
"allele2": {
"gene": "HLA-B",
"name": "*57:01",
"function": null,
"reference": false,
"activityValue": null
},
"gene": "HLA-B",
"matchScore": 0,
"phenotypes": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"label": "*15:02/*57:01",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "HLA-B",
"name": "*15:02",
"function": null,
"reference": false,
"activityValue": null
},
"allele2": {
"gene": "HLA-B",
"name": "*57:01",
"function": null,
"reference": false,
"activityValue": null
},
"gene": "HLA-B",
"matchScore": 0,
"phenotypes": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"label": "*15:02/*57:01",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
],
"variants": [],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"IFNL3": {
"alleleDefinitionVersion": "2026-02-09-10-28",
"alleleDefinitionSource": "CLINPGX",
"phenotypeVersion": "2026-02-09-10-28",
"geneSymbol": "IFNL3",
"chr": "chr19",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "IFNL3 reverse complement footnote",
"version": "1",
"matches": {
"gene": "IFNL3",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": []
},
"exception_type": "footnote",
"message": "The IFNL3 gene is on the negative chromosomal strand, all genotype calls for IFNL3 in this report refer to the positive chromosomal strand. Therefore, genotype calls are complemented from gene bases."
}
],
"relatedDrugs": [
{
"name": "peginterferon alfa-2a",
"id": "PA164749390"
},
{
"name": "peginterferon alfa-2b",
"id": "PA164784024"
},
{
"name": "ribavirin",
"id": "PA451241"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "IFNL3",
"name": "rs12979860 reference (C)",
"function": "Favorable response allele",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "IFNL3",
"name": "rs12979860 reference (C)",
"function": "Favorable response allele",
"reference": true,
"activityValue": "n/a"
},
"gene": "IFNL3",
"matchScore": 2,
"phenotypes": [
"n/a"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"n/a"
],
"label": "rs12979860 reference (C)/rs12979860 reference (C)",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"rs12979860 reference (C)": 2.0
}
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "IFNL3",
"name": "rs12979860 reference (C)",
"function": "Favorable response allele",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "IFNL3",
"name": "rs12979860 reference (C)",
"function": "Favorable response allele",
"reference": true,
"activityValue": "n/a"
},
"gene": "IFNL3",
"matchScore": 2,
"phenotypes": [
"n/a"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"n/a"
],
"label": "rs12979860 reference (C)/rs12979860 reference (C)",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"rs12979860 reference (C)": 2.0
}
}
],
"variants": [
{
"gene": "IFNL3",
"chromosome": "chr19",
"position": 39248147,
"dbSnpId": "rs12979860",
"call": "C/C",
"alleles": [
"rs12979860 variant (T)"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"MT-RNR1": {
"alleleDefinitionVersion": null,
"alleleDefinitionSource": "UNKNOWN",
"phenotypeVersion": "2026-02-09-10-28",
"geneSymbol": "MT-RNR1",
"chr": null,
"phased": false,
"effectivelyPhased": false,
"callSource": "OUTSIDE",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "pcat-outside-call",
"version": "1",
"matches": {
"gene": null,
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": []
},
"exception_type": "",
"message": "This comes from an outside data source which does not supply position-level detail. For specific disclaimers and limitations, see the original genotyping source."
}
],
"relatedDrugs": [
{
"name": "amikacin",
"id": "PA164744372"
},
{
"name": "dibekacin",
"id": "PA166292901"
},
{
"name": "gentamicin",
"id": "PA449753"
},
{
"name": "kanamycin",
"id": "PA450137"
},
{
"name": "neomycin",
"id": "PA450608"
},
{
"name": "netilmicin",
"id": "PA164754913"
},
{
"name": "paromomycin",
"id": "PA164784023"
},
{
"name": "plazomicin",
"id": "PA166228921"
},
{
"name": "ribostamycin",
"id": "PA166292902"
},
{
"name": "streptomycin",
"id": "PA451512"
},
{
"name": "tobramycin",
"id": "PA451704"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "MT-RNR1",
"name": "1555A>G",
"function": "Unassigned function",
"reference": false,
"activityValue": "n/a"
},
"allele2": null,
"gene": "MT-RNR1",
"matchScore": 0,
"phenotypes": [
"n/a"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"n/a"
],
"label": "1555A>G",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "MT-RNR1",
"name": "1555A>G",
"function": "Unassigned function",
"reference": false,
"activityValue": "n/a"
},
"allele2": null,
"gene": "MT-RNR1",
"matchScore": 0,
"phenotypes": [
"n/a"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"n/a"
],
"label": "1555A>G",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
],
"variants": [],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"NAT2": {
"alleleDefinitionVersion": "2026-02-09-10-28",
"alleleDefinitionSource": "CLINPGX",
"phenotypeVersion": "2026-02-09-10-28",
"geneSymbol": "NAT2",
"chr": "chr8",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "reference-allele",
"version": null,
"matches": null,
"exception_type": "note",
"message": "The NAT2 *1 allele assignment is characterized by the absence of variants at the positions that are included in the underlying allele definitions."
}
],
"relatedDrugs": [
{
"name": "amifampridine",
"id": "PA166185150"
},
{
"name": "amifampridine phosphate",
"id": "PA166182002"
},
{
"name": "hydralazine",
"id": "PA449894"
},
{
"name": "isoniazid",
"id": "PA450112"
},
{
"name": "procainamide",
"id": "PA451108"
},
{
"name": "sulfamethoxazole / trimethoprim",
"id": "PA10715"
},
{
"name": "sulfasalazine",
"id": "PA451547"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "NAT2",
"name": "*1",
"function": "Increased function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "NAT2",
"name": "*1",
"function": "Increased function",
"reference": true,
"activityValue": "n/a"
},
"gene": "NAT2",
"matchScore": 94,
"phenotypes": [
"Rapid Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Rapid Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "NAT2",
"name": "*1",
"function": "Increased function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "NAT2",
"name": "*1",
"function": "Increased function",
"reference": true,
"activityValue": "n/a"
},
"gene": "NAT2",
"matchScore": 94,
"phenotypes": [
"Rapid Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Rapid Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
],
"variants": [
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400010,
"dbSnpId": "rs200893121",
"call": "A/A",
"alleles": [
"*50"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400032,
"dbSnpId": "rs72466456",
"call": "T/T",
"alleles": [
"*45",
"*54"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400054,
"dbSnpId": "rs201339185",
"call": "C/C",
"alleles": [
"*55"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400061,
"dbSnpId": "rs532310930",
"call": "G/G",
"alleles": [
"*56"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400070,
"dbSnpId": "rs1464413878",
"call": "A/A",
"alleles": [
"*72"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400073,
"dbSnpId": "rs45477599",
"call": "T/T",
"alleles": [
"*31"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400124,
"dbSnpId": "rs149283608",
"call": "A/A",
"alleles": [
"*51"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400155,
"dbSnpId": "rs72466457",
"call": "G/G",
"alleles": [
"*35"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400193,
"dbSnpId": "rs1805158",
"call": "C/C",
"alleles": [
"*19"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400194,
"dbSnpId": "rs1801279",
"call": "G/G",
"alleles": [
"*14",
"*15",
"*29",
"*46",
"*47"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400206,
"dbSnpId": "rs72466458",
"call": "G/G",
"alleles": [
"*32"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400251,
"dbSnpId": "rs561124342",
"call": "G/G",
"alleles": [
"*53"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400267,
"dbSnpId": "rs2535896050",
"call": "G/G",
"alleles": [
"*75"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400324,
"dbSnpId": "rs549917500",
"call": "C/C",
"alleles": [
"*57"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400344,
"dbSnpId": "rs1801280",
"call": "T/T",
"alleles": [
"*5",
"*16",
"*29",
"*30",
"*31",
"*32",
"*33",
"*49",
"*69",
"*70",
"*72",
"*73",
"*75"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400349,
"dbSnpId": "rs183409091",
"call": "G/G",
"alleles": [
"*58"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400367,
"dbSnpId": "rs4986996",
"call": "G/G",
"alleles": [
"*48"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400406,
"dbSnpId": "rs12720065",
"call": "C/C",
"alleles": [
"*36",
"*44"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400461,
"dbSnpId": "rs72466460",
"call": "C/C",
"alleles": [
"*21"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400475,
"dbSnpId": "rs139351995",
"call": "A/A",
"alleles": [
"*33"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400478,
"dbSnpId": "rs537007806",
"call": "T/T",
"alleles": [
"*59"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400494,
"dbSnpId": "rs139512288",
"call": "T/T",
"alleles": [
"*60"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400502,
"dbSnpId": "rs72554617",
"call": "G/G",
"alleles": [
"*10"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400509,
"dbSnpId": "rs200585149",
"call": "A/A",
"alleles": [
"*61"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400521,
"dbSnpId": "rs369500066",
"call": "A/A",
"alleles": [
"*52"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400539,
"dbSnpId": "rs572750517",
"call": "A/A",
"alleles": [
"*62"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400581,
"dbSnpId": "rs79050330",
"call": "C/C",
"alleles": [
"*41",
"*49"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400583,
"dbSnpId": "rs774002627",
"call": "C/C",
"alleles": [
"*68"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400592,
"dbSnpId": "rs375746304",
"call": "C/C",
"alleles": [
"*27",
"*69"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400593,
"dbSnpId": "rs1799930",
"call": "G/G",
"alleles": [
"*6",
"*15",
"*30",
"*34",
"*35",
"*36",
"*37",
"*38",
"*39",
"*50",
"*52",
"*53",
"*56",
"*58",
"*62",
"*63",
"*64",
"*66",
"*67"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400599,
"dbSnpId": "rs761741098",
"call": "T/T",
"alleles": [
"*70"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400612,
"dbSnpId": "rs45618543",
"call": "G/G",
"alleles": [
"*43"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400616,
"dbSnpId": "rs45607939",
"call": "A/A",
"alleles": [
"*65"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400625,
"dbSnpId": "rs56387565",
"call": "T/T",
"alleles": [
"*42"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400641,
"dbSnpId": "rs138707146",
"call": "C/C",
"alleles": [
"*37"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400653,
"dbSnpId": "rs568110818",
"call": "T/T",
"alleles": [
"*63"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400685,
"dbSnpId": "rs150329557",
"call": "C/C",
"alleles": [
"*66"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400686,
"dbSnpId": "rs45518335",
"call": "C/C",
"alleles": [
"*47"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400707,
"dbSnpId": "rs756616433",
"call": "T/T",
"alleles": [
"*71"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400769,
"dbSnpId": "rs55700793",
"call": "A/A",
"alleles": [
"*38"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400799,
"dbSnpId": "rs539346244",
"call": "G/G",
"alleles": [
"*64"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400805,
"dbSnpId": "rs910738034",
"call": "A/A",
"alleles": [
"*73"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400806,
"dbSnpId": "rs1208",
"call": "G/G",
"alleles": [
"*4",
"*6",
"*7",
"*10",
"*14",
"*15",
"*16",
"*19",
"*21",
"*27",
"*30",
"*35",
"*36",
"*37",
"*38",
"*39",
"*47",
"*50",
"*52",
"*53",
"*54",
"*55",
"*56",
"*57",
"*58",
"*59",
"*60",
"*61",
"*62",
"*63",
"*64",
"*65",
"*66",
"*67",
"*68",
"*74"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400826,
"dbSnpId": "rs148566670",
"call": "T/T",
"alleles": [
"*67"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400841,
"dbSnpId": "rs56393504",
"call": "G/G",
"alleles": [
"*39"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400848,
"dbSnpId": "rs56054745",
"call": "A/A",
"alleles": [
"*74"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400860,
"dbSnpId": "rs1799931",
"call": "G/G",
"alleles": [
"*7",
"*40",
"*59",
"*68"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"NUDT15": {
"alleleDefinitionVersion": "2026-02-09-10-28",
"alleleDefinitionSource": "CLINPGX",
"phenotypeVersion": "2026-02-09-10-28",
"geneSymbol": "NUDT15",
"chr": "chr13",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "reference-allele",
"version": null,
"matches": null,
"exception_type": "note",
"message": "The NUDT15 *1 allele assignment is characterized by the absence of variants at the positions that are included in the underlying allele definitions."
}
],
"relatedDrugs": [
{
"name": "azathioprine",
"id": "PA448515"
},
{
"name": "mercaptopurine",
"id": "PA450379"
},
{
"name": "thioguanine",
"id": "PA451663"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "NUDT15",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "NUDT15",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "NUDT15",
"matchScore": 36,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "NUDT15",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "NUDT15",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "NUDT15",
"matchScore": 36,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
],
"variants": [
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48037748,
"dbSnpId": "rs769369441",
"call": "T/T",
"alleles": [
"*10"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48037749,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"*19"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48037782,
"dbSnpId": "rs746071566",
"call": "AGGAGTC/AGGAGTC",
"alleles": [
"*3",
"*6",
"*9"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "AGGAGTC",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48037798,
"dbSnpId": "rs186364861",
"call": "G/G",
"alleles": [
"*5"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48037825,
"dbSnpId": "rs777311140",
"call": "C/C",
"alleles": [
"*14"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48037834,
"dbSnpId": "rs1202487323",
"call": "C/C",
"alleles": [
"*16"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48037847,
"dbSnpId": "rs766023281",
"call": "G/G",
"alleles": [
"*7"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48037849,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"*8"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48037885,
"dbSnpId": "rs1950545307",
"call": "G/G",
"alleles": [
"*11"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48037902,
"dbSnpId": "rs149436418",
"call": "C/C",
"alleles": [
"*12"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48040977,
"dbSnpId": "rs1457579126",
"call": "GA/GA",
"alleles": [
"*18"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "GA",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48041103,
"dbSnpId": "rs761191455",
"call": "T/T",
"alleles": [
"*13"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48041113,
"dbSnpId": "rs1368252918",
"call": "G/G",
"alleles": [
"*17"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48045690,
"dbSnpId": "rs768324690",
"call": "C/C",
"alleles": [
"*20"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48045714,
"dbSnpId": "rs1185228044",
"call": "G/G",
"alleles": [
"*21"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48045719,
"dbSnpId": "rs116855232",
"call": "C/C",
"alleles": [
"*3"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48045720,
"dbSnpId": "rs147390019",
"call": "G/G",
"alleles": [
"*4"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48045771,
"dbSnpId": "rs139551410",
"call": "T/T",
"alleles": [
"*15"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"RYR1": {
"alleleDefinitionVersion": "2026-02-09-10-28",
"alleleDefinitionSource": "CLINPGX",
"phenotypeVersion": "2026-02-09-10-28",
"geneSymbol": "RYR1",
"chr": "chr19",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "reference-allele",
"version": null,
"matches": null,
"exception_type": "note",
"message": "The RYR1 Reference allele assignment is characterized by the absence of variants at the positions that are included in the underlying allele definitions."
}
],
"relatedDrugs": [
{
"name": "desflurane",
"id": "PA164749136"
},
{
"name": "enflurane",
"id": "PA449461"
},
{
"name": "halothane",
"id": "PA449845"
},
{
"name": "isoflurane",
"id": "PA450106"
},
{
"name": "methoxyflurane",
"id": "PA450434"
},
{
"name": "sevoflurane",
"id": "PA451341"
},
{
"name": "succinylcholine",
"id": "PA451522"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "RYR1",
"matchScore": 626,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
],
"matcherComponentHaplotypes": [
{
"allele1": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": null,
"gene": "RYR1",
"matchScore": 313,
"phenotypes": [
"n/a"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"n/a"
],
"label": "Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 1.0
}
}
],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "RYR1",
"matchScore": 0,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": [
{
"allele1": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "RYR1",
"matchScore": 626,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
],
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
],
"variants": [
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38433867,
"dbSnpId": "rs193922744",
"call": "T/T",
"alleles": [
"c.38T>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38440747,
"dbSnpId": "rs193922745",
"call": "CGAT/CGAT",
"alleles": [
"c.51_53del"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "CGAT",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38440796,
"dbSnpId": "rs193922746",
"call": "A/A",
"alleles": [
"c.97A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38440802,
"dbSnpId": "rs193922747",
"call": "T/T",
"alleles": [
"c.103T>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38440818,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.119G>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38440829,
"dbSnpId": "rs193922748",
"call": "C/C",
"alleles": [
"c.130C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38440830,
"dbSnpId": "rs139161723",
"call": "G/G",
"alleles": [
"c.131G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38440851,
"dbSnpId": "rs193922749",
"call": "C/C",
"alleles": [
"c.152C>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38442361,
"dbSnpId": "rs118192160",
"call": "G/G",
"alleles": [
"c.178G>A",
"c.178G>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38442373,
"dbSnpId": "rs995399438",
"call": "T/T",
"alleles": [
"c.190T>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38442395,
"dbSnpId": "rs118192113",
"call": "C/C",
"alleles": [
"c.212C>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38442434,
"dbSnpId": "rs186983396",
"call": "C/C",
"alleles": [
"c.251C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38443790,
"dbSnpId": "rs142474192",
"call": "G/G",
"alleles": [
"c.418G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38444179,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"c.455C>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38444187,
"dbSnpId": "rs193922750",
"call": "C/C",
"alleles": [
"c.463C>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38444191,
"dbSnpId": "rs193922751",
"call": "G/G",
"alleles": [
"c.467G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38444203,
"dbSnpId": "rs193922752",
"call": "A/A",
"alleles": [
"c.479A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38444211,
"dbSnpId": "rs118192161",
"call": "C/C",
"alleles": [
"c.487C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38444212,
"dbSnpId": "rs193922753",
"call": "G/G",
"alleles": [
"c.488G>A",
"c.488G>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38444217,
"dbSnpId": "rs193922754",
"call": "G/G",
"alleles": [
"c.493G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38444220,
"dbSnpId": "rs193922755",
"call": "G/G",
"alleles": [
"c.496G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38444221,
"dbSnpId": "rs193922756",
"call": "A/A",
"alleles": [
"c.497A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38444250,
"dbSnpId": "rs761616815",
"call": "G/G",
"alleles": [
"c.526G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38444252,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.528G>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38444253,
"dbSnpId": "rs193922757",
"call": "C/C",
"alleles": [
"c.529C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38444257,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"c.533A>C",
"c.533A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38444671,
"dbSnpId": "rs771058055",
"call": "G/G",
"alleles": [
"c.625G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38446481,
"dbSnpId": "rs727504129",
"call": "C/C",
"alleles": [
"c.641C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38446492,
"dbSnpId": "rs193922759",
"call": "G/G",
"alleles": [
"c.652G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38446517,
"dbSnpId": "rs112596687",
"call": "T/T",
"alleles": [
"c.677T>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38446520,
"dbSnpId": "rs193922760",
"call": "A/A",
"alleles": [
"c.680A>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38446710,
"dbSnpId": "rs1801086",
"call": "G/G",
"alleles": [
"c.742G>A",
"c.742G>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38448500,
"dbSnpId": "rs752652072",
"call": "C/C",
"alleles": [
"c.946C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38448501,
"dbSnpId": "rs193922761",
"call": "G/G",
"alleles": [
"c.947G>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38448673,
"dbSnpId": "rs193922762",
"call": "C/C",
"alleles": [
"c.982C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38448680,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"c.992_994dup"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38448712,
"dbSnpId": "rs121918592",
"call": "G/G",
"alleles": [
"c.1021G>A",
"c.1021G>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38448715,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.1024G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38448791,
"dbSnpId": "rs113332073",
"call": "G/G",
"alleles": [
"c.1100G>A",
"c.1100G>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38451785,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"c.1144C>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38451842,
"dbSnpId": "rs193922764",
"call": "C/C",
"alleles": [
"c.1201C>A",
"c.1201C>G",
"c.1201C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38451843,
"dbSnpId": "rs193922766",
"call": "G/G",
"alleles": [
"c.1202G>A",
"c.1202G>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38451850,
"dbSnpId": "rs118192116",
"call": "C/C",
"alleles": [
"c.1209C>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38452985,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"c.1411C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38452996,
"dbSnpId": "rs193922767",
"call": "G/G",
"alleles": [
"c.1422G>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38455247,
"dbSnpId": "rs147723844",
"call": "A/A",
"alleles": [
"c.1453A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38455253,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"c.1459C>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38455254,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"c.1460T>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38455269,
"dbSnpId": "rs901087791",
"call": "G/G",
"alleles": [
"c.1475G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38455347,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"c.1553T>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38455359,
"dbSnpId": "rs118192162",
"call": "A/A",
"alleles": [
"c.1565A>C",
"c.1565A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38455463,
"dbSnpId": "rs111888148",
"call": "G/G",
"alleles": [
"c.1589G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38455471,
"dbSnpId": "rs193922768",
"call": "C/C",
"alleles": [
"c.1597C>A",
"c.1597C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38455472,
"dbSnpId": "rs144336148",
"call": "G/G",
"alleles": [
"c.1598G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38455489,
"dbSnpId": "rs193922769",
"call": "T/T",
"alleles": [
"c.1615T>C",
"c.1615T>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38455504,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.1630G>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38455528,
"dbSnpId": "rs193922770",
"call": "C/C",
"alleles": [
"c.1654C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38457539,
"dbSnpId": "rs118204423",
"call": "G/G",
"alleles": [
"c.1834G>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38457545,
"dbSnpId": "rs118192172",
"call": "C/C",
"alleles": [
"c.1840C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38457546,
"dbSnpId": "rs193922772",
"call": "G/G",
"alleles": [
"c.1841G>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38458175,
"dbSnpId": "rs747177274",
"call": "G/G",
"alleles": [
"c.2050G>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38458247,
"dbSnpId": "rs138874610",
"call": "G/G",
"alleles": [
"c.2122G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38460461,
"dbSnpId": "rs376149732",
"call": "C/C",
"alleles": [
"c.2447C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38460551,
"dbSnpId": "rs193922775",
"call": "C/C",
"alleles": [
"c.2537C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38463499,
"dbSnpId": "rs370634440",
"call": "G/G",
"alleles": [
"c.2654G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38464649,
"dbSnpId": "rs148623597",
"call": "G/G",
"alleles": [
"c.2797G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38466144,
"dbSnpId": "rs778241277",
"call": "G/G",
"alleles": [
"c.2924G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38466216,
"dbSnpId": "rs180714609",
"call": "G/G",
"alleles": [
"c.2996G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38466315,
"dbSnpId": "rs141942845",
"call": "G/G",
"alleles": [
"c.3095G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38466347,
"dbSnpId": "rs111272095",
"call": "C/C",
"alleles": [
"c.3127C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38466386,
"dbSnpId": "rs2145447772",
"call": "G/G",
"alleles": [
"c.3166G>A",
"c.3166G>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38466392,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.3172G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38467655,
"dbSnpId": "rs749040743",
"call": "G/G",
"alleles": [
"c.3224G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38469002,
"dbSnpId": "rs193922776",
"call": "C/C",
"alleles": [
"c.3418C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38469111,
"dbSnpId": "rs549201486",
"call": "C/C",
"alleles": [
"c.3527C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38469404,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"c.3656A>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38469415,
"dbSnpId": "rs936513262",
"call": "G/G",
"alleles": [
"c.3667G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38473635,
"dbSnpId": "rs34694816",
"call": "A/A",
"alleles": [
"c.4024A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38475335,
"dbSnpId": "rs137933390",
"call": "A/A",
"alleles": [
"c.4178A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38477816,
"dbSnpId": "rs145573319",
"call": "A/A",
"alleles": [
"c.4400A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38483293,
"dbSnpId": "rs146429605",
"call": "A/A",
"alleles": [
"c.4711A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38483329,
"dbSnpId": "rs754476250",
"call": "C/C",
"alleles": [
"c.4747C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38483345,
"dbSnpId": "rs151029675",
"call": "C/C",
"alleles": [
"c.4763C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38483357,
"dbSnpId": "rs193922777",
"call": "C/C",
"alleles": [
"c.4775C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38485679,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"c.5024T>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38485688,
"dbSnpId": "rs781104539",
"call": "A/A",
"alleles": [
"c.5033A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38485691,
"dbSnpId": "rs146504767",
"call": "G/G",
"alleles": [
"c.5036G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38485787,
"dbSnpId": "rs754785770",
"call": "A/A",
"alleles": [
"c.5132A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38485838,
"dbSnpId": "rs193922781",
"call": "C/C",
"alleles": [
"c.5183C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38485841,
"dbSnpId": "rs193922782",
"call": "T/T",
"alleles": [
"c.5186T>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38485972,
"dbSnpId": "rs192863857",
"call": "C/C",
"alleles": [
"c.5317C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38485996,
"dbSnpId": "rs372958050",
"call": "T/T",
"alleles": [
"c.5341T>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38486015,
"dbSnpId": "rs34934920",
"call": "C/C",
"alleles": [
"c.5360C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38486095,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"c.5440A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38486096,
"dbSnpId": "rs193922783",
"call": "T/T",
"alleles": [
"c.5441T>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38490151,
"dbSnpId": "rs145801146",
"call": "C/C",
"alleles": [
"c.5890C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38490642,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"c.6037A>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38492540,
"dbSnpId": "rs35364374",
"call": "G/G",
"alleles": [
"c.6178G>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38494379,
"dbSnpId": "rs746818096",
"call": "T/T",
"alleles": [
"c.6302T>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38494381,
"dbSnpId": "rs770593660",
"call": "G/G",
"alleles": [
"c.6304G>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38494426,
"dbSnpId": "rs193922788",
"call": "G/G",
"alleles": [
"c.6349G>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38494454,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.6377G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38494464,
"dbSnpId": "rs117886618",
"call": "C/C",
"alleles": [
"c.6387C>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38494465,
"dbSnpId": "rs193922789",
"call": "G/G",
"alleles": [
"c.6388G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38494555,
"dbSnpId": "rs143398211",
"call": "G/G",
"alleles": [
"c.6478G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38494564,
"dbSnpId": "rs118192175",
"call": "C/C",
"alleles": [
"c.6487C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38494565,
"dbSnpId": "rs118192163",
"call": "G/G",
"alleles": [
"c.6488G>A",
"c.6488G>C",
"c.6488G>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38494579,
"dbSnpId": "rs118192176",
"call": "G/G",
"alleles": [
"c.6502G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38494621,
"dbSnpId": "rs193922790",
"call": "A/A",
"alleles": [
"c.6544A>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38494625,
"dbSnpId": "rs959170123",
"call": "G/G",
"alleles": [
"c.6548G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38496265,
"dbSnpId": "rs193922791",
"call": "C/C",
"alleles": [
"c.6599C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38496278,
"dbSnpId": "rs141646642",
"call": "C/C",
"alleles": [
"c.6612C>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38496283,
"dbSnpId": "rs118192177",
"call": "C/C",
"alleles": [
"c.6617C>G",
"c.6617C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38496294,
"dbSnpId": "rs193922792",
"call": "G/G",
"alleles": [
"c.6628G>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38496301,
"dbSnpId": "rs193922793",
"call": "T/T",
"alleles": [
"c.6635T>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38496306,
"dbSnpId": "rs193922795",
"call": "G/G",
"alleles": [
"c.6640G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38496415,
"dbSnpId": "rs199870223",
"call": "C/C",
"alleles": [
"c.6670C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38496416,
"dbSnpId": "rs537994744",
"call": "G/G",
"alleles": [
"c.6671G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38496455,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.6710G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38496487,
"dbSnpId": "rs763352221",
"call": "C/C",
"alleles": [
"c.6742C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38496488,
"dbSnpId": "rs140152019",
"call": "G/G",
"alleles": [
"c.6743G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38496502,
"dbSnpId": "rs917523269",
"call": "C/C",
"alleles": [
"c.6757C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38496901,
"dbSnpId": "rs193922797",
"call": "G/G",
"alleles": [
"c.6838G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38496910,
"dbSnpId": "rs118192121",
"call": "A/A",
"alleles": [
"c.6847A>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499177,
"dbSnpId": "rs34390345",
"call": "A/A",
"alleles": [
"c.6961A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499223,
"dbSnpId": "rs112563513",
"call": "G/G",
"alleles": [
"c.7007G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499234,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"c.7018T>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499241,
"dbSnpId": "rs147213895",
"call": "A/A",
"alleles": [
"c.7025A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499639,
"dbSnpId": "rs193922798",
"call": "G/G",
"alleles": [
"c.7032G>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499642,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"c.7035C>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499643,
"dbSnpId": "rs193922799",
"call": "G/G",
"alleles": [
"c.7036G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499644,
"dbSnpId": "rs121918596",
"call": "TGGA/TGGA",
"alleles": [
"c.7042_7044delGAG"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "TGGA",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499650,
"dbSnpId": "rs193922801",
"call": "A/A",
"alleles": [
"c.7043A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499655,
"dbSnpId": "rs193922802",
"call": "G/G",
"alleles": [
"c.7048G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499667,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.7060G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499670,
"dbSnpId": "rs193922803",
"call": "C/C",
"alleles": [
"c.7063C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499680,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"c.7073T>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499682,
"dbSnpId": "rs769482889",
"call": "C/C",
"alleles": [
"c.7075C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499683,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.7076G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499691,
"dbSnpId": "rs762401851",
"call": "G/G",
"alleles": [
"c.7084G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499692,
"dbSnpId": "rs193922804",
"call": "A/A",
"alleles": [
"c.7085A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499696,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"c.7089C>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499697,
"dbSnpId": "rs193922805",
"call": "T/T",
"alleles": [
"c.7090T>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499704,
"dbSnpId": "rs193922806",
"call": "C/C",
"alleles": [
"c.7097C>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499706,
"dbSnpId": "rs146306934",
"call": "G/G",
"alleles": [
"c.7099G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499719,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"c.7112A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499730,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.7123G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499731,
"dbSnpId": "rs193922807",
"call": "G/G",
"alleles": [
"c.7124G>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499806,
"dbSnpId": "rs976108591",
"call": "A/A",
"alleles": [
"c.7199A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499817,
"dbSnpId": "rs111364296",
"call": "G/G",
"alleles": [
"c.7210G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499975,
"dbSnpId": "rs193922809",
"call": "G/G",
"alleles": [
"c.7282G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499984,
"dbSnpId": "rs193922810",
"call": "G/G",
"alleles": [
"c.7291G>A",
"c.7291G>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499985,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"c.7292A>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499993,
"dbSnpId": "rs121918593",
"call": "G/G",
"alleles": [
"c.7300G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499997,
"dbSnpId": "rs28933396",
"call": "G/G",
"alleles": [
"c.7304G>A",
"c.7304G>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38500000,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.7307G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38500003,
"dbSnpId": "rs193922812",
"call": "C/C",
"alleles": [
"c.7310C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38500010,
"dbSnpId": "rs193922813",
"call": "G/G",
"alleles": [
"c.7317G>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38500636,
"dbSnpId": "rs118192124",
"call": "C/C",
"alleles": [
"c.7354C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38500637,
"dbSnpId": "rs193922815",
"call": "G/G",
"alleles": [
"c.7355G>A",
"c.7355G>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38500640,
"dbSnpId": "rs118192123",
"call": "T/T",
"alleles": [
"c.7358T>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38500642,
"dbSnpId": "rs193922816",
"call": "C/C",
"alleles": [
"c.7360C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38500643,
"dbSnpId": "rs118192122",
"call": "G/G",
"alleles": [
"c.7361G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38500654,
"dbSnpId": "rs28933397",
"call": "C/C",
"alleles": [
"c.7372C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38500655,
"dbSnpId": "rs121918594",
"call": "G/G",
"alleles": [
"c.7373G>A",
"c.7373G>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38500667,
"dbSnpId": "rs551223467",
"call": "C/C",
"alleles": [
"c.7385C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38500863,
"dbSnpId": "rs193922817",
"call": "C/C",
"alleles": [
"c.7487C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38500898,
"dbSnpId": "rs118192178",
"call": "C/C",
"alleles": [
"c.7522C>G",
"c.7522C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38500899,
"dbSnpId": "rs193922818",
"call": "G/G",
"alleles": [
"c.7523G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38500904,
"dbSnpId": "rs193922819",
"call": "T/T",
"alleles": [
"c.7528T>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38502652,
"dbSnpId": "rs767553612",
"call": "A/A",
"alleles": [
"c.7760A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38502663,
"dbSnpId": "rs193922822",
"call": "C/C",
"alleles": [
"c.7771C>G",
"c.7771C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38502669,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"c.7777C>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38502670,
"dbSnpId": "rs751180702",
"call": "G/G",
"alleles": [
"c.7778G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38502679,
"dbSnpId": "rs193922824",
"call": "C/C",
"alleles": [
"c.7787C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38502708,
"dbSnpId": "rs748575133",
"call": "T/T",
"alleles": [
"c.7816T>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38502923,
"dbSnpId": "rs914804033",
"call": "G/G",
"alleles": [
"c.7879G>A",
"c.7879G>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38504298,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.8005G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38504319,
"dbSnpId": "rs193922826",
"call": "C/C",
"alleles": [
"c.8026C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38504347,
"dbSnpId": "rs781126470",
"call": "C/C",
"alleles": [
"c.8054C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38504868,
"dbSnpId": "rs193922827",
"call": "G/G",
"alleles": [
"c.8188G>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38504869,
"dbSnpId": "rs112196644",
"call": "A/A",
"alleles": [
"c.8189A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38504878,
"dbSnpId": "rs193922828",
"call": "G/G",
"alleles": [
"c.8198G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38505061,
"dbSnpId": "rs193922829",
"call": "G/G",
"alleles": [
"c.8290G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38505325,
"dbSnpId": "rs147707463",
"call": "C/C",
"alleles": [
"c.8327C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38505358,
"dbSnpId": "rs35180584",
"call": "C/C",
"alleles": [
"c.8360C>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38505923,
"dbSnpId": "rs193922830",
"call": "C/C",
"alleles": [
"c.8518C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38505932,
"dbSnpId": "rs768535909",
"call": "T/T",
"alleles": [
"c.8527T>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38506361,
"dbSnpId": "rs193922831",
"call": "T/T",
"alleles": [
"c.8600T>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38506492,
"dbSnpId": "rs112772310",
"call": "G/G",
"alleles": [
"c.8638G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38506508,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"c.8654C>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38506865,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"c.8729C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38507821,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"c.8926C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38511590,
"dbSnpId": "rs147303895",
"call": "G/G",
"alleles": [
"c.9152G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38512279,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.9268G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38512321,
"dbSnpId": "rs193922832",
"call": "G/G",
"alleles": [
"c.9310G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38512367,
"dbSnpId": "rs193922833",
"call": "G/G",
"alleles": [
"c.9356G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38515052,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"c.9499C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38516167,
"dbSnpId": "rs199738299",
"call": "A/A",
"alleles": [
"c.9635A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38516181,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"c.9649T>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38516184,
"dbSnpId": "rs553055844",
"call": "G/G",
"alleles": [
"c.9652G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38516208,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.9676G>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38517431,
"dbSnpId": "rs375626634",
"call": "T/T",
"alleles": [
"c.9758T>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38517470,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"c.9797T>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38517521,
"dbSnpId": "rs757753317",
"call": "G/G",
"alleles": [
"c.9848G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38517523,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"c.9850T>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38517541,
"dbSnpId": "rs112151058",
"call": "G/G",
"alleles": [
"c.9868G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38519237,
"dbSnpId": "rs118204421",
"call": "C/C",
"alleles": [
"c.10042C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38519238,
"dbSnpId": "rs193922834",
"call": "G/G",
"alleles": [
"c.10043G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38519292,
"dbSnpId": "rs137932199",
"call": "G/G",
"alleles": [
"c.10097G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38519295,
"dbSnpId": "rs118192126",
"call": "A/A",
"alleles": [
"c.10100A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38519424,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"c.10229C>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38519432,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"c.10237A>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38519447,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"c.10252A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38525432,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"c.10556C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38525492,
"dbSnpId": "rs143987857",
"call": "G/G",
"alleles": [
"c.10616G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38527707,
"dbSnpId": "rs55876273",
"call": "G/G",
"alleles": [
"c.10747G>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38527710,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.10750G>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38528372,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.10891G>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38529002,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.11086G>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38529036,
"dbSnpId": "rs193922838",
"call": "G/G",
"alleles": [
"c.11120G>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38529042,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"c.11126C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38529048,
"dbSnpId": "rs375915752",
"call": "C/C",
"alleles": [
"c.11132C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38534726,
"dbSnpId": "rs4802584",
"call": "C/C",
"alleles": [
"c.11266C>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38534774,
"dbSnpId": "rs763112609",
"call": "C/C",
"alleles": [
"c.11314C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38534775,
"dbSnpId": "rs193922839",
"call": "G/G",
"alleles": [
"c.11315G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38535197,
"dbSnpId": "rs111565359",
"call": "G/G",
"alleles": [
"c.11416G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38535998,
"dbSnpId": "rs140616359",
"call": "G/G",
"alleles": [
"c.11518G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38543365,
"dbSnpId": "rs148399313",
"call": "G/G",
"alleles": [
"c.11708G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38543380,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"c.11723A>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38543405,
"dbSnpId": "rs193922840",
"call": "T/T",
"alleles": [
"c.11748T>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38543551,
"dbSnpId": "rs147136339",
"call": "A/A",
"alleles": [
"c.11798A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38543566,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.11813G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38543810,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"c.11947C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38543816,
"dbSnpId": "rs118204422",
"call": "T/T",
"alleles": [
"c.11953T>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38543821,
"dbSnpId": "rs193922842",
"call": "C/C",
"alleles": [
"c.11958C>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38543832,
"dbSnpId": "rs193922843",
"call": "G/G",
"alleles": [
"c.11969G>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38546460,
"dbSnpId": "rs755088027",
"call": "G/G",
"alleles": [
"c.12028G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38546496,
"dbSnpId": "rs773040531",
"call": "A/A",
"alleles": [
"c.12064A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38548253,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"c.12115A>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38548259,
"dbSnpId": "rs144685735",
"call": "C/C",
"alleles": [
"c.12121C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38548287,
"dbSnpId": "rs193922844",
"call": "C/C",
"alleles": [
"c.12149C>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38548380,
"dbSnpId": "rs373406011",
"call": "C/C",
"alleles": [
"c.12242C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38561140,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.12310G>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38561185,
"dbSnpId": "rs193922848",
"call": "A/A",
"alleles": [
"c.12355A>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38561213,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"c.12383C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38561228,
"dbSnpId": "rs201321695",
"call": "A/A",
"alleles": [
"c.12398A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38561236,
"dbSnpId": "rs193922849",
"call": "C/C",
"alleles": [
"c.12406C>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38561243,
"dbSnpId": "rs193922850",
"call": "T/T",
"alleles": [
"c.12413T>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38561362,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.12532G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38561363,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.12533G>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38561383,
"dbSnpId": "rs151119428",
"call": "G/G",
"alleles": [
"c.12553G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38565023,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"c.12689T>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38565034,
"dbSnpId": "rs193922852",
"call": "G/G",
"alleles": [
"c.12700G>C",
"c.12700G>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38565182,
"dbSnpId": "rs193922853",
"call": "A/A",
"alleles": [
"c.12848A>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38565215,
"dbSnpId": "rs587784372",
"call": "C/C",
"alleles": [
"c.12881C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38565218,
"dbSnpId": "rs193922855",
"call": "C/C",
"alleles": [
"c.12884C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38566978,
"dbSnpId": "rs139647387",
"call": "A/A",
"alleles": [
"c.13505A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38566986,
"dbSnpId": "rs150396398",
"call": "G/G",
"alleles": [
"c.13513G>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38570619,
"dbSnpId": "rs771741606",
"call": "C/C",
"alleles": [
"c.13672C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38570620,
"dbSnpId": "rs118192130",
"call": "G/G",
"alleles": [
"c.13673G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38570649,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"c.13702C>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38572032,
"dbSnpId": "rs143520367",
"call": "C/C",
"alleles": [
"c.13760C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38572185,
"dbSnpId": "rs118192135",
"call": "G/G",
"alleles": [
"c.13913G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38572190,
"dbSnpId": "rs756850145",
"call": "A/A",
"alleles": [
"c.13918A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38572206,
"dbSnpId": "rs193922860",
"call": "G/G",
"alleles": [
"c.13934G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38572262,
"dbSnpId": "rs759500310",
"call": "T/T",
"alleles": [
"c.13990T>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38572266,
"dbSnpId": "rs193922862",
"call": "TC/TC",
"alleles": [
"c.13994_13995delTCinsCT"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "TC",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38573180,
"dbSnpId": "rs193922863",
"call": "C/C",
"alleles": [
"c.14002C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38573229,
"dbSnpId": "rs193922864",
"call": "T/T",
"alleles": [
"c.14051T>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38573304,
"dbSnpId": "rs118192140",
"call": "C/C",
"alleles": [
"c.14126C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38575957,
"dbSnpId": "rs200766617",
"call": "G/G",
"alleles": [
"c.14168G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38577931,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"c.14186A>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38577942,
"dbSnpId": "rs193922865",
"call": "T/T",
"alleles": [
"c.14197T>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38577946,
"dbSnpId": "rs193922866",
"call": "G/G",
"alleles": [
"c.14201G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38577954,
"dbSnpId": "rs193922867",
"call": "C/C",
"alleles": [
"c.14209C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38577955,
"dbSnpId": "rs193922868",
"call": "G/G",
"alleles": [
"c.14210G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38578015,
"dbSnpId": "rs768360593",
"call": "G/G",
"alleles": [
"c.14270G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38578205,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.14364+1G>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38580004,
"dbSnpId": "rs118192167",
"call": "A/A",
"alleles": [
"c.14387A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38580039,
"dbSnpId": null,
"call": "TT/TT",
"alleles": [
"c.14422_14423delinsAA"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "TT",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38580041,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"c.14424C>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38580066,
"dbSnpId": "rs143988412",
"call": "A/A",
"alleles": [
"c.14449A>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38580075,
"dbSnpId": "rs193922873",
"call": "G/G",
"alleles": [
"c.14458G>A",
"c.14458G>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38580088,
"dbSnpId": "rs193922874",
"call": "T/T",
"alleles": [
"c.14471T>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38580094,
"dbSnpId": "rs121918595",
"call": "C/C",
"alleles": [
"c.14477C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38580114,
"dbSnpId": "rs193922876",
"call": "C/C",
"alleles": [
"c.14497C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38580126,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"c.14509C>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38580370,
"dbSnpId": "rs193922878",
"call": "C/C",
"alleles": [
"c.14512C>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38580382,
"dbSnpId": "rs193922879",
"call": "G/G",
"alleles": [
"c.14524G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38580397,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.14539G>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38580403,
"dbSnpId": "rs118192168",
"call": "G/G",
"alleles": [
"c.14545G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38580416,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"c.14558C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38580425,
"dbSnpId": "rs193922880",
"call": "C/C",
"alleles": [
"c.14567C>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38580439,
"dbSnpId": "rs118192181",
"call": "C/C",
"alleles": [
"c.14581C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38580440,
"dbSnpId": "rs63749869",
"call": "G/G",
"alleles": [
"c.14582G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38580485,
"dbSnpId": "rs113210953",
"call": "A/A",
"alleles": [
"c.14627A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38580497,
"dbSnpId": "rs193922883",
"call": "T/T",
"alleles": [
"c.14639T>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38584974,
"dbSnpId": "rs118192151",
"call": "G/G",
"alleles": [
"c.14678G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38584976,
"dbSnpId": "rs193922888",
"call": "G/G",
"alleles": [
"c.14680G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38584989,
"dbSnpId": "rs118192170",
"call": "T/T",
"alleles": [
"c.14693T>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38585078,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"c.14782A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38585099,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.14803G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38585947,
"dbSnpId": "rs111657878",
"call": "T/T",
"alleles": [
"c.14813T>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38585948,
"dbSnpId": "rs118192159",
"call": "C/C",
"alleles": [
"c.14814C>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38585951,
"dbSnpId": "rs193922895",
"call": "C/C",
"alleles": [
"c.14817C>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38585952,
"dbSnpId": "rs118192158",
"call": "G/G",
"alleles": [
"c.14818G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38585959,
"dbSnpId": "rs193922896",
"call": "G/G",
"alleles": [
"c.14825G>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38586101,
"dbSnpId": "rs193922898",
"call": "T/T",
"alleles": [
"c.14879T>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38586140,
"dbSnpId": "rs146876145",
"call": "C/C",
"alleles": [
"c.14918C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38586190,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"c.14968A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38587362,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.15059G>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38587363,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.15060G>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"SLCO1B1": {
"alleleDefinitionVersion": "2026-02-09-10-28",
"alleleDefinitionSource": "CLINPGX",
"phenotypeVersion": "2026-02-09-10-28",
"geneSymbol": "SLCO1B1",
"chr": "chr12",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "SLCO1B1-drug text",
"version": "1",
"matches": {
"gene": "SLCO1B1",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"simvastatin",
"rosuvastatin",
"pravastatin",
"pitavastatin",
"lovastatin",
"fluvastatin",
"atorvastatin"
]
},
"exception_type": "note",
"message": "The SLCO1B1 genotype (star nomenclature) will be displayed if determinable with the provided VCF based on the SLCO1B1 star allele definition published by CPIC and recommendations are provided based on the genotype.
In case no genotype can be determined, recommendations are based on the rs4149056 genotype alone as per guideline. The minor C allele at rs4149056 defines SLCO1B1*5."
},
{
"rule_name": "reference-allele",
"version": null,
"matches": null,
"exception_type": "note",
"message": "The SLCO1B1 *1 allele assignment is characterized by the absence of variants at the positions that are included in the underlying allele definitions."
}
],
"relatedDrugs": [
{
"name": "atorvastatin",
"id": "PA448500"
},
{
"name": "elagolix",
"id": "PA166182348"
},
{
"name": "fluvastatin",
"id": "PA449688"
},
{
"name": "lovastatin",
"id": "PA450272"
},
{
"name": "pitavastatin",
"id": "PA142650384"
},
{
"name": "pravastatin",
"id": "PA451089"
},
{
"name": "rosuvastatin",
"id": "PA134308647"
},
{
"name": "simvastatin",
"id": "PA451363"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "SLCO1B1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "SLCO1B1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "SLCO1B1",
"matchScore": 70,
"phenotypes": [
"Normal Function"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Function"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "SLCO1B1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "SLCO1B1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "SLCO1B1",
"matchScore": 70,
"phenotypes": [
"Normal Function"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Function"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
],
"variants": [
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21141575,
"dbSnpId": "rs185905373",
"call": "A/A",
"alleles": [
"*56"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21172675,
"dbSnpId": "rs556524705",
"call": "G/G",
"alleles": [
"*57"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21172734,
"dbSnpId": "rs139257324",
"call": "C/C",
"alleles": [
"*33"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21172735,
"dbSnpId": "rs61760182",
"call": "G/G",
"alleles": [
"*58"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21172776,
"dbSnpId": "rs373327528",
"call": "G/G",
"alleles": [
"*23"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21172782,
"dbSnpId": "rs56101265",
"call": "T/T",
"alleles": [
"*2"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21176804,
"dbSnpId": "rs2306283",
"call": "A/A",
"alleles": [
"*14",
"*15",
"*20",
"*24",
"*25",
"*27",
"*28",
"*29",
"*30",
"*31",
"*32",
"*33",
"*37",
"*39",
"*42",
"*43",
"*44",
"*45",
"*47",
"*52",
"*53",
"*54",
"*55",
"*56",
"*57"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21176868,
"dbSnpId": "rs2306282",
"call": "A/A",
"alleles": [
"*16"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21176871,
"dbSnpId": "rs145144129",
"call": "G/G",
"alleles": [
"*55"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21176879,
"dbSnpId": "rs11045819",
"call": "C/C",
"alleles": [
"*4",
"*14",
"*25",
"*32",
"*43",
"*53",
"*55"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21176898,
"dbSnpId": "rs77271279",
"call": "G/G",
"alleles": [
"*41"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21178612,
"dbSnpId": "rs141467543",
"call": "A/A",
"alleles": [
"*42"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21178615,
"dbSnpId": "rs4149056",
"call": "T/T",
"alleles": [
"*5",
"*15",
"*40",
"*45",
"*47"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21178653,
"dbSnpId": "rs200331427",
"call": "C/C",
"alleles": [
"*50"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21178926,
"dbSnpId": "rs201722521",
"call": "A/A",
"alleles": [
"*54"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21178957,
"dbSnpId": "rs79135870",
"call": "A/A",
"alleles": [
"*30"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21196951,
"dbSnpId": "rs11045852",
"call": "A/A",
"alleles": [
"*24",
"*25",
"*28",
"*32",
"*33",
"*43",
"*44",
"*54"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21196975,
"dbSnpId": "rs183501729",
"call": "C/C",
"alleles": [
"*39"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21196976,
"dbSnpId": "rs11045853",
"call": "G/G",
"alleles": [
"*25",
"*28",
"*33"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21200544,
"dbSnpId": "rs72559747",
"call": "C/C",
"alleles": [
"*47"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21200595,
"dbSnpId": "rs55901008",
"call": "T/T",
"alleles": [
"*6"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21200673,
"dbSnpId": "rs756393362",
"call": "G/G",
"alleles": [
"*52"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21202553,
"dbSnpId": "rs1228465562",
"call": "T/T",
"alleles": [
"*36"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21202555,
"dbSnpId": "rs59113707",
"call": "C/C",
"alleles": [
"*27",
"*53",
"*55"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21202664,
"dbSnpId": "rs142965323",
"call": "G/G",
"alleles": [
"*26"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21205921,
"dbSnpId": "rs72559748",
"call": "A/A",
"alleles": [
"*8"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21205999,
"dbSnpId": "rs59502379",
"call": "G/G",
"alleles": [
"*9",
"*31"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21206031,
"dbSnpId": "rs74064213",
"call": "A/A",
"alleles": [
"*43",
"*44"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21222355,
"dbSnpId": "rs71581941",
"call": "C/C",
"alleles": [
"*45"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21224840,
"dbSnpId": "rs200994482",
"call": "G/G",
"alleles": [
"*51"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21239042,
"dbSnpId": "rs34671512",
"call": "A/A",
"alleles": [
"*19",
"*20",
"*40",
"*54"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21239077,
"dbSnpId": "rs56199088",
"call": "A/A",
"alleles": [
"*10"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21239113,
"dbSnpId": "rs55737008",
"call": "A/A",
"alleles": [
"*11"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21239145,
"dbSnpId": "rs200995543",
"call": "C/C",
"alleles": [
"*34"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21239158,
"dbSnpId": "rs140790673",
"call": "C/C",
"alleles": [
"*29"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"TPMT": {
"alleleDefinitionVersion": "2026-02-09-10-28",
"alleleDefinitionSource": "CLINPGX",
"phenotypeVersion": "2026-02-09-10-28",
"geneSymbol": "TPMT",
"chr": "chr6",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "TPMT reverse complement footnote",
"version": "1",
"matches": {
"gene": "TPMT",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": []
},
"exception_type": "footnote",
"message": "The TPMT gene is on the negative chromosomal strand, all genotype calls for TPMT in this report refer to the positive chromosomal strand. Therefore, genotype calls are complemented from gene bases."
},
{
"rule_name": "reference-allele",
"version": null,
"matches": null,
"exception_type": "note",
"message": "The TPMT *1 allele assignment is characterized by the absence of variants at the positions that are included in the underlying allele definitions."
}
],
"relatedDrugs": [
{
"name": "azathioprine",
"id": "PA448515"
},
{
"name": "mercaptopurine",
"id": "PA450379"
},
{
"name": "thioguanine",
"id": "PA451663"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "TPMT",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "TPMT",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "TPMT",
"matchScore": 90,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "TPMT",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "TPMT",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "TPMT",
"matchScore": 90,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
],
"variants": [
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18130687,
"dbSnpId": "rs1142345",
"call": "T/T",
"alleles": [
"*3A",
"*3C",
"*41"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18130694,
"dbSnpId": "rs150900439",
"call": "T/T",
"alleles": [
"*20"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18130725,
"dbSnpId": "rs72552736",
"call": "A/A",
"alleles": [
"*7"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18130729,
"dbSnpId": "rs139392616",
"call": "C/C",
"alleles": [
"*40"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18130730,
"dbSnpId": "rs761990479",
"call": "G/G",
"alleles": [
"*45"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18130758,
"dbSnpId": "rs398122996",
"call": "A/A",
"alleles": [
"*37"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18130762,
"dbSnpId": "rs56161402",
"call": "C/C",
"alleles": [
"*8",
"*46"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18130772,
"dbSnpId": "rs377085266",
"call": "A/A",
"alleles": [
"*25"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18130781,
"dbSnpId": "rs1800584",
"call": "C/C",
"alleles": [
"*4"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18132136,
"dbSnpId": "rs72556347",
"call": "A/A",
"alleles": [
"*26"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18132147,
"dbSnpId": "rs79901429",
"call": "A/A",
"alleles": [
"*31"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18132163,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"*36"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18133845,
"dbSnpId": "rs75543815",
"call": "T/T",
"alleles": [
"*6"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18133847,
"dbSnpId": "rs6921269",
"call": "C/C",
"alleles": [
"*24"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18133870,
"dbSnpId": "rs772832951",
"call": "A/A",
"alleles": [
"*38"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18133884,
"dbSnpId": "rs74423290",
"call": "G/G",
"alleles": [
"*23"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18133887,
"dbSnpId": "rs201695576",
"call": "T/T",
"alleles": [
"*44"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18133890,
"dbSnpId": "rs9333570",
"call": "C/C",
"alleles": [
"*15"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18138969,
"dbSnpId": "rs144041067",
"call": "C/C",
"alleles": [
"*16",
"*22"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18138970,
"dbSnpId": "rs112339338",
"call": "G/G",
"alleles": [
"*33",
"*46"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18138997,
"dbSnpId": "rs1800460",
"call": "C/C",
"alleles": [
"*3A",
"*3B"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18139027,
"dbSnpId": "rs72552737",
"call": "C/C",
"alleles": [
"*10"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18139689,
"dbSnpId": "rs72552738",
"call": "C/C",
"alleles": [
"*11"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18139710,
"dbSnpId": "rs200220210",
"call": "G/G",
"alleles": [
"*12"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18143597,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"*19"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18143606,
"dbSnpId": "rs151149760",
"call": "T/T",
"alleles": [
"*9"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18143613,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"*28"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18143622,
"dbSnpId": "rs115106679",
"call": "C/C",
"alleles": [
"*32"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18143643,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"*27"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18143700,
"dbSnpId": "rs753545734",
"call": "C/C",
"alleles": [
"*43"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18143718,
"dbSnpId": "rs111901354",
"call": "G/G",
"alleles": [
"*34"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18143724,
"dbSnpId": "rs1800462",
"call": "C/C",
"alleles": [
"*2"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18143728,
"dbSnpId": "rs1256618794",
"call": "C/C",
"alleles": [
"*43"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18147838,
"dbSnpId": "rs281874771",
"call": "G/G",
"alleles": [
"*39"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18147845,
"dbSnpId": "rs777686348",
"call": "C/C",
"alleles": [
"*18"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18147851,
"dbSnpId": "rs200591577",
"call": "G/G",
"alleles": [
"*21"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18147856,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"*35"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18147910,
"dbSnpId": "rs72552740",
"call": "A/A",
"alleles": [
"*5"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18149004,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"*17"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18149022,
"dbSnpId": "rs750424422",
"call": "C/C",
"alleles": [
"*30"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18149032,
"dbSnpId": "rs759836180",
"call": "C/C",
"alleles": [
"*42"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18149045,
"dbSnpId": "rs72552742",
"call": "T/T",
"alleles": [
"*13"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18149103,
"dbSnpId": null,
"call": "CAAGT/CAAGT",
"alleles": [
"*47"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "CAAGT",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18149126,
"dbSnpId": "rs267607275",
"call": "A/A",
"alleles": [
"*29"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18149127,
"dbSnpId": "rs9333569",
"call": "T/T",
"alleles": [
"*14"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"UGT1A1": {
"alleleDefinitionVersion": "2026-02-09-10-28",
"alleleDefinitionSource": "CLINPGX",
"phenotypeVersion": "2026-02-09-10-28",
"geneSymbol": "UGT1A1",
"chr": "chr2",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "UGT1A1 repeat warning",
"version": "1",
"matches": {
"gene": "UGT1A1",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": []
},
"exception_type": "footnote",
"message": "Some alleles in UGT1A1 are distinguished by a repeat sequence; some genotyping technologies may not accurately call the repeat."
},
{
"rule_name": "reference-allele",
"version": null,
"matches": null,
"exception_type": "note",
"message": "The UGT1A1 *1 allele assignment is characterized by the absence of variants at the positions that are included in the underlying allele definitions."
}
],
"relatedDrugs": [
{
"name": "atazanavir",
"id": "PA10251"
},
{
"name": "belinostat",
"id": "PA165971474"
},
{
"name": "dolutegravir",
"id": "PA166114961"
},
{
"name": "irinotecan",
"id": "PA450085"
},
{
"name": "nilotinib",
"id": "PA165958345"
},
{
"name": "pazopanib",
"id": "PA165291492"
},
{
"name": "raltegravir",
"id": "PA164888966"
},
{
"name": "sacituzumab govitecan",
"id": "PA166225061"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "UGT1A1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "UGT1A1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "UGT1A1",
"matchScore": 8,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "UGT1A1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "UGT1A1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "UGT1A1",
"matchScore": 8,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
],
"variants": [
{
"gene": "UGT1A1",
"chromosome": "chr2",
"position": 233759924,
"dbSnpId": "rs887829",
"call": "C/C",
"alleles": [
"*80",
"*80+*28",
"*80+*37"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "UGT1A1",
"chromosome": "chr2",
"position": 233760233,
"dbSnpId": "rs3064744",
"call": "CAT/CAT",
"alleles": [
"*28",
"*36",
"*37",
"*80+*28",
"*80+*37"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "CAT",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "UGT1A1",
"chromosome": "chr2",
"position": 233760498,
"dbSnpId": "rs4148323",
"call": "G/G",
"alleles": [
"*6"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "UGT1A1",
"chromosome": "chr2",
"position": 233760973,
"dbSnpId": "rs35350960",
"call": "C/C",
"alleles": [
"*27"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"VKORC1": {
"alleleDefinitionVersion": "2026-02-09-10-28",
"alleleDefinitionSource": "CLINPGX",
"phenotypeVersion": "2026-02-09-10-28",
"geneSymbol": "VKORC1",
"chr": "chr16",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "VKORC1 reverse complement footnote",
"version": "1",
"matches": {
"gene": "VKORC1",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": []
},
"exception_type": "footnote",
"message": "The VKORC1 gene is on the negative chromosomal strand, all genotype calls for VKORC1 in this report refer to the positive chromosomal strand. Therefore, genotype calls are complemented from gene bases."
}
],
"relatedDrugs": [
{
"name": "acenocoumarol",
"id": "PA452632"
},
{
"name": "phenprocoumon",
"id": "PA450921"
},
{
"name": "warfarin",
"id": "PA451906"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "VKORC1",
"name": "rs9923231 reference (C)",
"function": "Normal coumarin sensitivity",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "VKORC1",
"name": "rs9923231 reference (C)",
"function": "Normal coumarin sensitivity",
"reference": true,
"activityValue": "n/a"
},
"gene": "VKORC1",
"matchScore": 2,
"phenotypes": [
"-1639 GG"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"-1639 GG"
],
"label": "rs9923231 reference (C)/rs9923231 reference (C)",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"rs9923231 reference (C)": 2.0
}
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "VKORC1",
"name": "rs9923231 reference (C)",
"function": "Normal coumarin sensitivity",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "VKORC1",
"name": "rs9923231 reference (C)",
"function": "Normal coumarin sensitivity",
"reference": true,
"activityValue": "n/a"
},
"gene": "VKORC1",
"matchScore": 2,
"phenotypes": [
"-1639 GG"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"-1639 GG"
],
"label": "rs9923231 reference (C)/rs9923231 reference (C)",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"rs9923231 reference (C)": 2.0
}
}
],
"variants": [
{
"gene": "VKORC1",
"chromosome": "chr16",
"position": 31096368,
"dbSnpId": "rs9923231",
"call": "C/C",
"alleles": [
"rs9923231 variant (T)"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
}
},
"drugs": {
"CPIC Guideline Annotation": {
"abacavir": {
"name": "abacavir",
"id": "PA448004",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104997"
],
"citations": [
{
"pmid": "22378157",
"title": "Clinical pharmacogenetics implementation consortium guidelines for HLA-B genotype and abacavir dosing.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2012,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3374459"
},
{
"pmid": "24561393",
"title": "Clinical Pharmacogenetics Implementation Consortium Guidelines for HLA-B Genotype and Abacavir Dosing: 2014 update.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2014,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3994233"
}
],
"guidelines": [
{
"id": "PA166104997",
"name": "Annotation of CPIC Guideline for abacavir and HLA-B",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104997",
"annotations": [
{
"implications": [
"HLA-B: Significantly increased risk of abacavir hypersensitivity"
],
"drugRecommendation": "Abacavir is not recommended",
"classification": "Strong",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "HLA-B",
"name": "*15:02",
"function": null,
"reference": false,
"activityValue": null
},
"allele2": {
"gene": "HLA-B",
"name": "*57:01",
"function": null,
"reference": false,
"activityValue": null
},
"gene": "HLA-B",
"matchScore": 0,
"phenotypes": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"label": "*15:02/*57:01",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": true,
"otherPrescribingGuidance": false,
"phenotypes": {},
"lookupKey": [
{
"HLA-B": "*57:01 positive"
}
]
}
]
}
]
},
"allopurinol": {
"name": "allopurinol",
"id": "PA448320",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166105003"
],
"citations": [
{
"pmid": "23232549",
"title": "Clinical Pharmacogenetics Implementation Consortium guidelines for human leukocyte antigen-B genotype and allopurinol dosing.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2013,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3564416"
},
{
"pmid": "26094938",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) guidelines for human leukocyte antigen B (HLA-B) genotype and allopurinol dosing: 2015 update.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2016,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4675696"
}
],
"guidelines": [
{
"id": "PA166105003",
"name": "Annotation of CPIC Guideline for allopurinol and HLA-B",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166105003",
"annotations": [
{
"implications": [
"HLA-B: Low or reduced risk of allopurinol-induced SCAR"
],
"drugRecommendation": "Use allopurinol per standard dosing guidelines",
"classification": "Strong",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "HLA-B",
"name": "*15:02",
"function": null,
"reference": false,
"activityValue": null
},
"allele2": {
"gene": "HLA-B",
"name": "*57:01",
"function": null,
"reference": false,
"activityValue": null
},
"gene": "HLA-B",
"matchScore": 0,
"phenotypes": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"label": "*15:02/*57:01",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"HLA-B": "*58:01 negative"
},
"lookupKey": [
{
"HLA-B": "*58:01 negative"
}
]
}
]
}
]
},
"amikacin": {
"name": "amikacin",
"id": "PA164744372",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166229081"
],
"citations": [
{
"pmid": "34032273",
"title": "Clinical Pharmacogenetics Implementation Consortium Guideline for the Use of Aminoglycosides Based on MT-RNR1 Genotype.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2022,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8613315"
}
],
"guidelines": [
{
"id": "PA166229081",
"name": "Annotation of CPIC Guideline for amikacin, dibekacin, gentamicin, kanamycin, neomycin, netilmicin, paromomycin, plazomicin, ribostamycin, streptomycin, tobramycin and MT-RNR1",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166229081",
"annotations": []
}
]
},
"amitriptyline": {
"name": "amitriptyline",
"id": "PA448385",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166105006"
],
"citations": [
{
"pmid": "23486447",
"title": "Clinical Pharmacogenetics Implementation Consortium guideline for CYP2D6 and CYP2C19 genotypes and dosing of tricyclic antidepressants.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2013,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3689226"
},
{
"pmid": "27997040",
"title": "Clinical pharmacogenetics implementation consortium guideline (CPIC) for CYP2D6 and CYP2C19 genotypes and dosing of tricyclic antidepressants: 2016 update.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2017,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5478479"
}
],
"guidelines": [
{
"id": "PA166105006",
"name": "Annotation of CPIC Guideline for amitriptyline and CYP2C19, CYP2D6",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166105006",
"annotations": [
{
"implications": [
"CYP2C19: Normal metabolism of tertiary amines",
"CYP2D6: Reduced metabolism of TCAs to less active compounds compared to normal metabolizers; Higher plasma concentrations of active drug will increase the probability of side effects"
],
"drugRecommendation": "Consider a 25% reduction of recommended starting dose. Utilize therapeutic drug monitoring to guide dose adjustments.",
"classification": "Moderate",
"activityScore": {
"CYP2C19": "n/a",
"CYP2D6": "1.0"
},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*38",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*38",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 70,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*38/*38",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*38": 2.0
}
},
{
"allele1": {
"gene": "CYP2D6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2D6",
"name": "*3",
"function": "No function",
"reference": false,
"activityValue": "0.0"
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "1.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"1.0"
],
"label": "*1/*3",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Normal Metabolizer",
"CYP2D6": "Intermediate Metabolizer"
},
"lookupKey": [
{
"CYP2D6": "1.0",
"CYP2C19": "Normal Metabolizer"
}
]
}
]
}
]
},
"atazanavir": {
"name": "atazanavir",
"id": "PA10251",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166128738"
],
"citations": [
{
"pmid": "26417955",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for UGT1A1 and Atazanavir Prescribing.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2016,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4785051"
}
],
"guidelines": [
{
"id": "PA166128738",
"name": "Annotation of CPIC Guideline for atazanavir and UGT1A1",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166128738",
"annotations": [
{
"implications": [
"UGT1A1: Reference UGT1A1 activity; very low likelihood of bilirubin-related discontinuation of atazanavir."
],
"drugRecommendation": "There is no need to avoid prescribing of atazanavir based on UGT1A1 genetic test result. Inform the patient that some patients stop atazanavir because of jaundice (yellow eyes and skin), but that this patient’s genotype makes this unlikely (less than about a 1 in 20 chance of stopping atazanavir because of jaundice).",
"classification": "Strong",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "UGT1A1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "UGT1A1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "UGT1A1",
"matchScore": 8,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": true,
"phenotypes": {
"UGT1A1": "Normal Metabolizer"
},
"lookupKey": [
{
"UGT1A1": "Normal Metabolizer"
}
]
}
]
}
]
},
"atomoxetine": {
"name": "atomoxetine",
"id": "PA134688071",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166181885"
],
"citations": [
{
"pmid": "30801677",
"title": "Clinical Pharmacogenetics Implementation Consortium Guideline for Cytochrome P450 (CYP)2D6 Genotype and Atomoxetine Therapy.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2019,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6612570"
}
],
"guidelines": [
{
"id": "PA166181885",
"name": "Annotation of CPIC Guideline for atomoxetine and CYP2D6",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166181885",
"annotations": [
{
"implications": [
"CYP2D6: Possibly higher atomoxetine concentrations as compared to normal metabolizers but questionable clinical significance. Intermediate metabolizers with an activity score of 1 may be at an increased risk of discontinuation as compared to poor metabolizers."
],
"drugRecommendation": "Initiate with a dose of 40 mg/day and increase to 80 mg/day after 3 days. If no clinical response and in the absence of adverse events after 2 weeks, consider increasing dose to 100 mg/day. If no clinical response observed after 2 weeks, consider obtaining a peak plasma concentration (1 to 2 hours after dose administered). If <200 ng/mL, consider a proportional increase in dose to approach 400 ng/mL. Dosages greater than 100 mg/day may be needed to achieve target concentrations.",
"classification": "Moderate",
"activityScore": {
"CYP2D6": "1.0"
},
"population": "adults",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2D6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2D6",
"name": "*3",
"function": "No function",
"reference": false,
"activityValue": "0.0"
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "1.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"1.0"
],
"label": "*1/*3",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2D6": "Intermediate Metabolizer"
},
"lookupKey": [
{
"CYP2D6": "1.0"
}
]
},
{
"implications": [
"CYP2D6: Possibly higher atomoxetine concentrations as compared to normal metabolizers but questionable clinical significance. Intermediate metabolizers with an activity score of 1 may be at an increased risk of discontinuation as compared to poor metabolizers."
],
"drugRecommendation": "Initiate with a dose of 0.5 mg/kg/day and increase to 1.2 mg/kg/day after 3 days. If no clinical response and in the absence of adverse events after 2 weeks, consider obtaining a peak plasma concentration (1 to 2 hours after dose administered). If < 200 ng/mL, consider a proportional increase in dose to approach 400 ng/mL.",
"classification": "Moderate",
"activityScore": {
"CYP2D6": "1.0"
},
"population": "pediatrics",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2D6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2D6",
"name": "*3",
"function": "No function",
"reference": false,
"activityValue": "0.0"
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "1.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"1.0"
],
"label": "*1/*3",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2D6": "Intermediate Metabolizer"
},
"lookupKey": [
{
"CYP2D6": "1.0"
}
]
}
]
}
]
},
"atorvastatin": {
"name": "atorvastatin",
"id": "PA448500",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "SLCO1B1-drug text",
"version": "1",
"matches": {
"gene": "SLCO1B1",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"simvastatin",
"rosuvastatin",
"pravastatin",
"pitavastatin",
"lovastatin",
"fluvastatin",
"atorvastatin"
]
},
"exception_type": "note",
"message": "The SLCO1B1 genotype (star nomenclature) will be displayed if determinable with the provided VCF based on the SLCO1B1 star allele definition published by CPIC and recommendations are provided based on the genotype.
In case no genotype can be determined, recommendations are based on the rs4149056 genotype alone as per guideline. The minor C allele at rs4149056 defines SLCO1B1*5."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166262221"
],
"citations": [
{
"pmid": "35152405",
"title": "The Clinical Pharmacogenetics Implementation Consortium Guideline for SLCO1B1, ABCG2, and CYP2C9 genotypes and Statin-Associated Musculoskeletal Symptoms.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2022,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9035072"
}
],
"guidelines": [
{
"id": "PA166262221",
"name": "Annotation of CPIC Guideline for atorvastatin and SLCO1B1",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166262221",
"annotations": [
{
"implications": [
"SLCO1B1: Typical myopathy risk and statin exposure"
],
"drugRecommendation": "Prescribe desired starting dose and adjust doses based on disease-specific guidelines.",
"classification": "Strong",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "SLCO1B1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "SLCO1B1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "SLCO1B1",
"matchScore": 70,
"phenotypes": [
"Normal Function"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Function"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"SLCO1B1": "Normal Function"
},
"lookupKey": [
{
"SLCO1B1": "Normal Function"
}
]
}
]
}
]
},
"azathioprine": {
"name": "azathioprine",
"id": "PA448515",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104933"
],
"citations": [
{
"pmid": "21270794",
"title": "Clinical Pharmacogenetics Implementation Consortium guidelines for thiopurine methyltransferase genotype and thiopurine dosing.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3098761"
},
{
"pmid": "23422873",
"title": "Clinical pharmacogenetics implementation consortium guidelines for thiopurine methyltransferase genotype and thiopurine dosing: 2013 update.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2013,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3604643"
},
{
"pmid": "30447069",
"title": "Clinical Pharmacogenetics Implementation Consortium Guideline for Thiopurine Dosing Based on TPMT and NUDT15 Genotypes: 2018 Update.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2019,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6576267"
},
{
"pmid": "41618934",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for Thiopurine Dosing Based on TPMT and NUDT15 Genotypes: 2025 Update.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2026,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/41618934"
}
],
"guidelines": [
{
"id": "PA166104933",
"name": "Annotation of CPIC Guideline for azathioprine and NUDT15, TPMT",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104933",
"annotations": [
{
"implications": [
"Normal risk of thiopurine-related leukopenia, neutropenia and myelosuppression.",
"TPMT NMs have lower erythrocyte concentrations of TGN metabolites and higher concentrations of MeMPNs compared to TPMT IMs and TPMT PMs. This is the 'normal' pattern."
],
"drugRecommendation": "Initiate therapy with standard starting dose (e.g., 2 mg/kg/day for autoimmune diseases). During therapy, adjust doses of azathioprine based on disease-specific guidelines. It usually takes at least 2 weeks to reach steady state after each dose adjustment.",
"classification": "Strong",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "NUDT15",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "NUDT15",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "NUDT15",
"matchScore": 36,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
},
{
"allele1": {
"gene": "TPMT",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "TPMT",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "TPMT",
"matchScore": 90,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"NUDT15": "Normal Metabolizer",
"TPMT": "Normal Metabolizer"
},
"lookupKey": [
{
"TPMT": "Normal Metabolizer",
"NUDT15": "Normal Metabolizer"
}
]
}
]
}
]
},
"capecitabine": {
"name": "capecitabine",
"id": "PA448771",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166109594"
],
"citations": [
{
"pmid": "23988873",
"title": "Clinical Pharmacogenetics Implementation Consortium guidelines for dihydropyrimidine dehydrogenase genotype and fluoropyrimidine dosing.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2013,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3831181"
},
{
"pmid": "29152729",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for Dihydropyrimidine Dehydrogenase Genotype and Fluoropyrimidine Dosing: 2017 Update.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2018,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5760397"
}
],
"guidelines": [
{
"id": "PA166109594",
"name": "Annotation of CPIC Guideline for capecitabine and DPYD",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166109594",
"annotations": [
{
"implications": [
"DPYD: Normal DPD activity and \"normal\" risk for fluoropyrimidine toxicity"
],
"drugRecommendation": "Based on genotype, there is no indication to change dose or therapy. Use label-recommended dosage and administration.",
"classification": "Strong",
"activityScore": {
"DPYD": "2.0"
},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "DPYD",
"matchScore": 0,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": [
{
"allele1": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "DPYD",
"matchScore": 166,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
],
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"DPYD": "Normal Metabolizer"
},
"lookupKey": [
{
"DPYD": "2.0"
}
]
}
]
}
]
},
"carbamazepine": {
"name": "carbamazepine",
"id": "PA448785",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166105008"
],
"citations": [
{
"pmid": "23695185",
"title": "Clinical Pharmacogenetics Implementation Consortium guidelines for HLA-B genotype and carbamazepine dosing.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2013,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3748365"
},
{
"pmid": "29392710",
"title": "Clinical Pharmacogenetics Implementation Consortium Guideline for HLA Genotype and Use of Carbamazepine and Oxcarbazepine: 2017 Update.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2018,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5847474"
}
],
"guidelines": [
{
"id": "PA166105008",
"name": "Annotation of CPIC Guideline for carbamazepine and HLA-A, HLA-B",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166105008",
"annotations": [
{
"implications": [
"HLA-A: n/a",
"HLA-B: Greater risk of carbamazepine-induced SJS/TEN"
],
"drugRecommendation": "If patient is carbamazepine-naïve, do not use carbamazepine.",
"classification": "Strong",
"activityScore": {},
"population": "CBZ naive",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "HLA-A",
"name": "Unknown",
"function": null,
"reference": false,
"activityValue": null
},
"allele2": {
"gene": "HLA-A",
"name": "Unknown",
"function": null,
"reference": false,
"activityValue": null
},
"gene": "HLA-A",
"matchScore": 0,
"phenotypes": [],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"No Result"
],
"label": "Unknown/Unknown",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Unknown": 2.0
}
},
{
"allele1": {
"gene": "HLA-B",
"name": "*15:02",
"function": null,
"reference": false,
"activityValue": null
},
"allele2": {
"gene": "HLA-B",
"name": "*57:01",
"function": null,
"reference": false,
"activityValue": null
},
"gene": "HLA-B",
"matchScore": 0,
"phenotypes": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"label": "*15:02/*57:01",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": true,
"otherPrescribingGuidance": false,
"phenotypes": {
"HLA-B": "*15:02 positive"
},
"lookupKey": [
{
"HLA-A": "No Result",
"HLA-B": "*15:02 positive"
}
]
},
{
"implications": [
"HLA-A: n/a",
"HLA-B: Greater risk of carbamazepine-induced SJS/TEN"
],
"drugRecommendation": "The latency period for drug-induced SJS/TEN is short with continuous dosing and adherence to therapy (~4-28 days), and cases usually occur within three months of dosing; therefore, if the patient has previously used carbamazepine consistently for longer than three months without incidence of cutaneous adverse reactions, cautiously consider use of carbamazepine in the future.",
"classification": "Optional",
"activityScore": {},
"population": "CBZ use >3mos",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "HLA-A",
"name": "Unknown",
"function": null,
"reference": false,
"activityValue": null
},
"allele2": {
"gene": "HLA-A",
"name": "Unknown",
"function": null,
"reference": false,
"activityValue": null
},
"gene": "HLA-A",
"matchScore": 0,
"phenotypes": [],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"No Result"
],
"label": "Unknown/Unknown",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Unknown": 2.0
}
},
{
"allele1": {
"gene": "HLA-B",
"name": "*15:02",
"function": null,
"reference": false,
"activityValue": null
},
"allele2": {
"gene": "HLA-B",
"name": "*57:01",
"function": null,
"reference": false,
"activityValue": null
},
"gene": "HLA-B",
"matchScore": 0,
"phenotypes": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"label": "*15:02/*57:01",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": true,
"phenotypes": {
"HLA-B": "*15:02 positive"
},
"lookupKey": [
{
"HLA-A": "No Result",
"HLA-B": "*15:02 positive"
}
]
},
{
"implications": [
"HLA-A: n/a",
"HLA-B: Greater risk of carbamazepine-induced SJS/TEN"
],
"drugRecommendation": "If patient is carbamazepine-naïve, do not use carbamazepine.",
"classification": "Strong",
"activityScore": {},
"population": "CBZ-no alternatives",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "HLA-A",
"name": "Unknown",
"function": null,
"reference": false,
"activityValue": null
},
"allele2": {
"gene": "HLA-A",
"name": "Unknown",
"function": null,
"reference": false,
"activityValue": null
},
"gene": "HLA-A",
"matchScore": 0,
"phenotypes": [],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"No Result"
],
"label": "Unknown/Unknown",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Unknown": 2.0
}
},
{
"allele1": {
"gene": "HLA-B",
"name": "*15:02",
"function": null,
"reference": false,
"activityValue": null
},
"allele2": {
"gene": "HLA-B",
"name": "*57:01",
"function": null,
"reference": false,
"activityValue": null
},
"gene": "HLA-B",
"matchScore": 0,
"phenotypes": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"label": "*15:02/*57:01",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": true,
"otherPrescribingGuidance": false,
"phenotypes": {
"HLA-B": "*15:02 positive"
},
"lookupKey": [
{
"HLA-A": "No Result",
"HLA-B": "*15:02 positive"
}
]
}
]
}
]
},
"celecoxib": {
"name": "celecoxib",
"id": "PA448871",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166191841"
],
"citations": [
{
"pmid": "32189324",
"title": "Clinical Pharmacogenetics Implementation Consortium Guideline (CPIC) for CYP2C9 and Nonsteroidal Anti-Inflammatory Drugs.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2020,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8080882"
}
],
"guidelines": [
{
"id": "PA166191841",
"name": "Annotation of CPIC Guideline for celecoxib, flurbiprofen, ibuprofen, lornoxicam and CYP2C9",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166191841",
"annotations": [
{
"implications": [
"CYP2C9: Normal metabolism"
],
"drugRecommendation": "Initiate therapy with recommended starting dose. In accordance with the prescribing information, use the lowest effective dosage for shortest duration consistent with individual patient treatment goals.",
"classification": "Strong",
"activityScore": {
"CYP2C9": "2.0"
},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "CYP2C9",
"matchScore": 166,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C9": "Normal Metabolizer"
},
"lookupKey": [
{
"CYP2C9": "2.0"
}
]
}
]
}
]
},
"citalopram": {
"name": "citalopram",
"id": "PA449015",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166127638"
],
"citations": [
{
"pmid": "25974703",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for CYP2D6 and CYP2C19 Genotypes and Dosing of Selective Serotonin Reuptake Inhibitors.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2015,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4512908"
},
{
"pmid": "37032427",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for CYP2D6, CYP2C19, CYP2B6, SLC6A4, and HTR2A Genotypes and Serotonin Reuptake Inhibitor Antidepressants.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2023,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10564324"
}
],
"guidelines": [
{
"id": "PA166127638",
"name": "Annotation of CPIC Guideline for citalopram, escitalopram and CYP2C19",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166127638",
"annotations": [
{
"implications": [
"CYP2C19: Normal metabolism"
],
"drugRecommendation": "Initiate therapy with recommended starting dose",
"classification": "Strong",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*38",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*38",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 70,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*38/*38",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*38": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Normal Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Normal Metabolizer"
}
]
}
]
}
]
},
"clomipramine": {
"name": "clomipramine",
"id": "PA449048",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166105007"
],
"citations": [
{
"pmid": "23486447",
"title": "Clinical Pharmacogenetics Implementation Consortium guideline for CYP2D6 and CYP2C19 genotypes and dosing of tricyclic antidepressants.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2013,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3689226"
},
{
"pmid": "27997040",
"title": "Clinical pharmacogenetics implementation consortium guideline (CPIC) for CYP2D6 and CYP2C19 genotypes and dosing of tricyclic antidepressants: 2016 update.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2017,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5478479"
}
],
"guidelines": [
{
"id": "PA166105007",
"name": "Annotation of CPIC Guideline for clomipramine and CYP2C19, CYP2D6",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166105007",
"annotations": [
{
"implications": [
"CYP2C19: Normal metabolism of tertiary amines",
"CYP2D6: Reduced metabolism of TCAs to less active compounds compared to normal metabolizers; Higher plasma concentrations of active drug will increase the probability of side effects"
],
"drugRecommendation": "Consider a 25% reduction of recommended starting dose. Utilize therapeutic drug monitoring to guide dose adjustments.",
"classification": "Optional",
"activityScore": {
"CYP2C19": "n/a",
"CYP2D6": "1.0"
},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*38",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*38",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 70,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*38/*38",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*38": 2.0
}
},
{
"allele1": {
"gene": "CYP2D6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2D6",
"name": "*3",
"function": "No function",
"reference": false,
"activityValue": "0.0"
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "1.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"1.0"
],
"label": "*1/*3",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Normal Metabolizer",
"CYP2D6": "Intermediate Metabolizer"
},
"lookupKey": [
{
"CYP2D6": "1.0",
"CYP2C19": "Normal Metabolizer"
}
]
}
]
}
]
},
"clopidogrel": {
"name": "clopidogrel",
"id": "PA449053",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104948"
],
"citations": [
{
"pmid": "21716271",
"title": "Clinical Pharmacogenetics Implementation Consortium guidelines for cytochrome P450-2C19 (CYP2C19) genotype and clopidogrel therapy.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3234301"
},
{
"pmid": "23698643",
"title": "Clinical Pharmacogenetics Implementation Consortium guidelines for CYP2C19 genotype and clopidogrel therapy: 2013 update.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2013,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3748366"
},
{
"pmid": "35034351",
"title": "Clinical Pharmacogenetics Implementation Consortium Guideline for CYP2C19 Genotype and Clopidogrel Therapy: 2022 Update.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2022,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9287492"
}
],
"guidelines": [
{
"id": "PA166104948",
"name": "Annotation of CPIC Guideline for clopidogrel and CYP2C19",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104948",
"annotations": [
{
"implications": [
"CYP2C19: Normal clopidogrel active metabolite formation; normal on-treatment platelet reactivity"
],
"drugRecommendation": "If considering clopidogrel, use at standard dose (75 mg/day)",
"classification": "Strong",
"activityScore": {},
"population": "CVI ACS PCI",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*38",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*38",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 70,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*38/*38",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*38": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Normal Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Normal Metabolizer"
}
]
},
{
"implications": [
"CYP2C19: Normal clopidogrel active metabolite formation; normal on-treatment platelet reactivity"
],
"drugRecommendation": "If considering clopidogrel, use at standard dose (75 mg/day)",
"classification": "Strong",
"activityScore": {},
"population": "CVI non-ACS non-PCI",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*38",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*38",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 70,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*38/*38",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*38": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Normal Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Normal Metabolizer"
}
]
},
{
"implications": [
"CYP2C19: Normal clopidogrel active metabolite formation; normal on-treatment platelet reactivity"
],
"drugRecommendation": "If considering clopidogrel, use at standard dose (75 mg/day)",
"classification": "Strong",
"activityScore": {},
"population": "NVI",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*38",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*38",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 70,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*38/*38",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*38": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Normal Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Normal Metabolizer"
}
]
}
]
}
]
},
"codeine": {
"name": "codeine",
"id": "PA449088",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104996"
],
"citations": [
{
"pmid": "22205192",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) guidelines for codeine therapy in the context of cytochrome P450 2D6 (CYP2D6) genotype.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2012,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3289963"
},
{
"pmid": "24458010",
"title": "Clinical Pharmacogenetics Implementation Consortium guidelines for cytochrome P450 2D6 genotype and codeine therapy: 2014 update.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2014,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3975212"
},
{
"pmid": "33387367",
"title": "Clinical Pharmacogenetics Implementation Consortium Guideline for CYP2D6, OPRM1, and COMT Genotypes and Select Opioid Therapy.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2021,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8249478"
}
],
"guidelines": [
{
"id": "PA166104996",
"name": "Annotation of CPIC Guideline for codeine and CYP2D6",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104996",
"annotations": [
{
"implications": [
"CYP2D6: Reduced morphine formation"
],
"drugRecommendation": "Use codeine label recommended age- or weight-specific dosing. If no response and opioid use is warranted, consider a non-tramadol opioid.",
"classification": "Moderate",
"activityScore": {
"CYP2D6": "1.0"
},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2D6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2D6",
"name": "*3",
"function": "No function",
"reference": false,
"activityValue": "0.0"
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "1.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"1.0"
],
"label": "*1/*3",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": true,
"phenotypes": {
"CYP2D6": "Intermediate Metabolizer"
},
"lookupKey": [
{
"CYP2D6": "1.0"
}
]
}
]
}
]
},
"dapsone": {
"name": "dapsone",
"id": "PA449211",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "G6PD hemizygous samples",
"version": "2",
"matches": {
"gene": "G6PD",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"aminosalicylic acid",
"aspirin",
"chloramphenicol",
"chloroquine",
"ciprofloxacin",
"dapsone",
"dimercaprol",
"doxorubicin",
"furazolidone",
"glyburide",
"hydroxychloroquine",
"mafenide",
"methylene blue",
"nalidixic acid",
"nitrofurantoin",
"norfloxacin",
"ofloxacin",
"pegloticase",
"phenazopyridine",
"primaquine",
"quinine",
"rasburicase",
"sulfadiazine",
"sulfadimidine",
"sulfamethoxazole",
"trimethoprim",
"sulfanilamide",
"sulfasalazine",
"sulfisoxazole",
"tafenoquine",
"tolbutamide",
"toluidine blue",
"vitamin c",
"vitamin k"
]
},
"exception_type": "note",
"message": "PharmCAT reports based on VCF file input and some VCF files do not specify hemizygous (one X chromosome) and instead represent samples as homozygous. See PharmCAT FAQs (https://pharmcat.org/faqs/)."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166119846"
],
"citations": [
{
"pmid": "24787449",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) guidelines for rasburicase therapy in the context of G6PD deficiency genotype.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2014,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4111801"
},
{
"pmid": "36049896",
"title": "Expanded Clinical Pharmacogenetics Implementation Consortium Guideline for Medication Use in the Context of G6PD Genotype.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2023,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10281211"
}
],
"guidelines": [
{
"id": "PA166119846",
"name": "Annotation of CPIC Guideline for dapsone, methylene blue, pegloticase, rasburicase, tafenoquine, toluidine blue and G6PD",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166119846",
"annotations": [
{
"implications": [
"G6PD: Low risk of acute hemolytic anemia"
],
"drugRecommendation": "No reason to avoid based on G6PD status",
"classification": "Strong",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "G6PD",
"name": "B (reference)",
"function": "IV/Normal",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "G6PD",
"name": "B (reference)",
"function": "IV/Normal",
"reference": true,
"activityValue": "n/a"
},
"gene": "G6PD",
"matchScore": 342,
"phenotypes": [
"Normal"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal"
],
"label": "B (reference)/B (reference)",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"B (reference)": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"G6PD": "Normal"
},
"lookupKey": [
{
"G6PD": "Normal"
}
]
}
]
}
]
},
"desflurane": {
"name": "desflurane",
"id": "PA164749136",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166303941"
],
"citations": [
{
"pmid": "30499100",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for the Use of Potent Volatile Anesthetic Agents and Succinylcholine in the Context of RYR1 or CACNA1S Genotypes.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2019,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6513720"
}
],
"guidelines": [
{
"id": "PA166303941",
"name": "Annotation of CPIC Guideline for desflurane, enflurane, halothane, isoflurane, methoxyflurane, sevoflurane, succinylcholine and CACNA1S, RYR1",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166303941",
"annotations": [
{
"implications": [
"These results do not eliminate the chance that this patient is susceptible to malignant hyperthermia (MH). The genetic cause of about half of all MH survivors, with MH susceptibility confirmed by contracture test, remains unknown (PMID 28902675)."
],
"drugRecommendation": "Clinical findings, family history, further genetic testing and other laboratory data should guide use of halogenated volatile anesthetics or depolarizing muscle relaxants.",
"classification": "Strong",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CACNA1S",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CACNA1S",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CACNA1S",
"matchScore": 4,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
},
{
"allele1": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "RYR1",
"matchScore": 0,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": [
{
"allele1": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "RYR1",
"matchScore": 626,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
],
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": true,
"phenotypes": {
"CACNA1S": "Uncertain Susceptibility",
"RYR1": "Uncertain Susceptibility"
},
"lookupKey": [
{
"RYR1": "Uncertain Susceptibility",
"CACNA1S": "Uncertain Susceptibility"
}
]
}
]
}
]
},
"desipramine": {
"name": "desipramine",
"id": "PA449233",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166105002"
],
"citations": [
{
"pmid": "23486447",
"title": "Clinical Pharmacogenetics Implementation Consortium guideline for CYP2D6 and CYP2C19 genotypes and dosing of tricyclic antidepressants.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2013,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3689226"
},
{
"pmid": "27997040",
"title": "Clinical pharmacogenetics implementation consortium guideline (CPIC) for CYP2D6 and CYP2C19 genotypes and dosing of tricyclic antidepressants: 2016 update.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2017,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5478479"
}
],
"guidelines": [
{
"id": "PA166105002",
"name": "Annotation of CPIC Guideline for desipramine and CYP2D6",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166105002",
"annotations": [
{
"implications": [
"CYP2D6: Reduced metabolism of TCAs to less active compounds compared to normal metabolizers. Higher plasma concentrations of active drug will increase the probability of side effects."
],
"drugRecommendation": "Consider a 25% reduction of recommended starting dose. Titrate dose to observed clinical response with symptom improvement and minimal (if any) side effects. Utilize therapeutic drug monitoring to guide dose adjustments.",
"classification": "Optional",
"activityScore": {
"CYP2D6": "1.0"
},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2D6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2D6",
"name": "*3",
"function": "No function",
"reference": false,
"activityValue": "0.0"
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "1.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"1.0"
],
"label": "*1/*3",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2D6": "Intermediate Metabolizer"
},
"lookupKey": [
{
"CYP2D6": "1.0"
}
]
}
]
}
]
},
"dexlansoprazole": {
"name": "dexlansoprazole",
"id": "PA166110257",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166219301"
],
"citations": [
{
"pmid": "32770672",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for CYP2C19 and Proton Pump Inhibitor Dosing.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2021,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7868475"
}
],
"guidelines": [
{
"id": "PA166219301",
"name": "Annotation of CPIC Guideline for dexlansoprazole and CYP2C19",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166219301",
"annotations": [
{
"implications": [
"CYP2C19: Normal PPI metabolism; may be at increased risk of therapeutic failure compared to CYP2C19 IMs and PMs"
],
"drugRecommendation": "Initiate standard starting daily dose. Consider increasing dose by 50-100% for the treatment of H. pylori infection and erosive esophagitis. Daily dose may be given in divided doses.\nMonitor for efficacy.",
"classification": "Optional",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*38",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*38",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 70,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*38/*38",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*38": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Normal Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Normal Metabolizer"
}
]
}
]
}
]
},
"dibekacin": {
"name": "dibekacin",
"id": "PA166292901",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166229081"
],
"citations": [
{
"pmid": "34032273",
"title": "Clinical Pharmacogenetics Implementation Consortium Guideline for the Use of Aminoglycosides Based on MT-RNR1 Genotype.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2022,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8613315"
}
],
"guidelines": [
{
"id": "PA166229081",
"name": "Annotation of CPIC Guideline for amikacin, dibekacin, gentamicin, kanamycin, neomycin, netilmicin, paromomycin, plazomicin, ribostamycin, streptomycin, tobramycin and MT-RNR1",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166229081",
"annotations": []
}
]
},
"doxepin": {
"name": "doxepin",
"id": "PA449409",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166105000"
],
"citations": [
{
"pmid": "23486447",
"title": "Clinical Pharmacogenetics Implementation Consortium guideline for CYP2D6 and CYP2C19 genotypes and dosing of tricyclic antidepressants.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2013,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3689226"
},
{
"pmid": "27997040",
"title": "Clinical pharmacogenetics implementation consortium guideline (CPIC) for CYP2D6 and CYP2C19 genotypes and dosing of tricyclic antidepressants: 2016 update.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2017,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5478479"
}
],
"guidelines": [
{
"id": "PA166105000",
"name": "Annotation of CPIC Guideline for doxepin and CYP2C19, CYP2D6",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166105000",
"annotations": [
{
"implications": [
"CYP2C19: Normal metabolism of tertiary amines",
"CYP2D6: Reduced metabolism of TCAs to less active compounds compared to normal metabolizers; Higher plasma concentrations of active drug will increase the probability of side effects"
],
"drugRecommendation": "Consider a 25% reduction of recommended starting dose. Utilize therapeutic drug monitoring to guide dose adjustments.",
"classification": "Optional",
"activityScore": {
"CYP2C19": "n/a",
"CYP2D6": "1.0"
},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*38",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*38",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 70,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*38/*38",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*38": 2.0
}
},
{
"allele1": {
"gene": "CYP2D6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2D6",
"name": "*3",
"function": "No function",
"reference": false,
"activityValue": "0.0"
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "1.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"1.0"
],
"label": "*1/*3",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Normal Metabolizer",
"CYP2D6": "Intermediate Metabolizer"
},
"lookupKey": [
{
"CYP2D6": "1.0",
"CYP2C19": "Normal Metabolizer"
}
]
}
]
}
]
},
"efavirenz": {
"name": "efavirenz",
"id": "PA449441",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166182603"
],
"citations": [
{
"pmid": "31006110",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for CYP2B6 and Efavirenz-Containing Antiretroviral Therapy.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2019,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6739160"
}
],
"guidelines": [
{
"id": "PA166182603",
"name": "Annotation of CPIC Guideline for efavirenz and CYP2B6",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166182603",
"annotations": [
{
"implications": [
"CYP2B6: Normal efavirenz metabolism"
],
"drugRecommendation": "Initiate efavirenz with standard dosing (600 mg/day)",
"classification": "Strong",
"activityScore": {},
"population": "child >40kg_adult",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2B6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2B6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP2B6",
"matchScore": 96,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2B6": "Normal Metabolizer"
},
"lookupKey": [
{
"CYP2B6": "Normal Metabolizer"
}
]
}
]
}
]
},
"enflurane": {
"name": "enflurane",
"id": "PA449461",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166303941"
],
"citations": [
{
"pmid": "30499100",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for the Use of Potent Volatile Anesthetic Agents and Succinylcholine in the Context of RYR1 or CACNA1S Genotypes.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2019,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6513720"
}
],
"guidelines": [
{
"id": "PA166303941",
"name": "Annotation of CPIC Guideline for desflurane, enflurane, halothane, isoflurane, methoxyflurane, sevoflurane, succinylcholine and CACNA1S, RYR1",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166303941",
"annotations": [
{
"implications": [
"These results do not eliminate the chance that this patient is susceptible to malignant hyperthermia (MH). The genetic cause of about half of all MH survivors, with MH susceptibility confirmed by contracture test, remains unknown (PMID 28902675)."
],
"drugRecommendation": "Clinical findings, family history, further genetic testing and other laboratory data should guide use of halogenated volatile anesthetics or depolarizing muscle relaxants.",
"classification": "Strong",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CACNA1S",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CACNA1S",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CACNA1S",
"matchScore": 4,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
},
{
"allele1": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "RYR1",
"matchScore": 0,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": [
{
"allele1": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "RYR1",
"matchScore": 626,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
],
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": true,
"phenotypes": {
"CACNA1S": "Uncertain Susceptibility",
"RYR1": "Uncertain Susceptibility"
},
"lookupKey": [
{
"RYR1": "Uncertain Susceptibility",
"CACNA1S": "Uncertain Susceptibility"
}
]
}
]
}
]
},
"escitalopram": {
"name": "escitalopram",
"id": "PA10074",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166127638"
],
"citations": [
{
"pmid": "25974703",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for CYP2D6 and CYP2C19 Genotypes and Dosing of Selective Serotonin Reuptake Inhibitors.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2015,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4512908"
},
{
"pmid": "37032427",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for CYP2D6, CYP2C19, CYP2B6, SLC6A4, and HTR2A Genotypes and Serotonin Reuptake Inhibitor Antidepressants.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2023,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10564324"
}
],
"guidelines": [
{
"id": "PA166127638",
"name": "Annotation of CPIC Guideline for citalopram, escitalopram and CYP2C19",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166127638",
"annotations": [
{
"implications": [
"CYP2C19: Normal metabolism"
],
"drugRecommendation": "Initiate therapy with recommended starting dose",
"classification": "Strong",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*38",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*38",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 70,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*38/*38",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*38": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Normal Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Normal Metabolizer"
}
]
}
]
}
]
},
"fluorouracil": {
"name": "fluorouracil",
"id": "PA128406956",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166122686"
],
"citations": [
{
"pmid": "23988873",
"title": "Clinical Pharmacogenetics Implementation Consortium guidelines for dihydropyrimidine dehydrogenase genotype and fluoropyrimidine dosing.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2013,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3831181"
},
{
"pmid": "29152729",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for Dihydropyrimidine Dehydrogenase Genotype and Fluoropyrimidine Dosing: 2017 Update.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2018,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5760397"
}
],
"guidelines": [
{
"id": "PA166122686",
"name": "Annotation of CPIC Guideline for fluorouracil and DPYD",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166122686",
"annotations": [
{
"implications": [
"DPYD: Normal DPD activity and \"normal\" risk for fluoropyrimidine toxicity"
],
"drugRecommendation": "Based on genotype, there is no indication to change dose or therapy. Use label-recommended dosage and administration.",
"classification": "Strong",
"activityScore": {
"DPYD": "2.0"
},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "DPYD",
"matchScore": 0,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": [
{
"allele1": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "DPYD",
"matchScore": 166,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
],
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"DPYD": "Normal Metabolizer"
},
"lookupKey": [
{
"DPYD": "2.0"
}
]
}
]
}
]
},
"flurbiprofen": {
"name": "flurbiprofen",
"id": "PA449683",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166191841"
],
"citations": [
{
"pmid": "32189324",
"title": "Clinical Pharmacogenetics Implementation Consortium Guideline (CPIC) for CYP2C9 and Nonsteroidal Anti-Inflammatory Drugs.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2020,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8080882"
}
],
"guidelines": [
{
"id": "PA166191841",
"name": "Annotation of CPIC Guideline for celecoxib, flurbiprofen, ibuprofen, lornoxicam and CYP2C9",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166191841",
"annotations": [
{
"implications": [
"CYP2C9: Normal metabolism"
],
"drugRecommendation": "Initiate therapy with recommended starting dose. In accordance with the prescribing information, use the lowest effective dosage for shortest duration consistent with individual patient treatment goals.",
"classification": "Strong",
"activityScore": {
"CYP2C9": "2.0"
},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "CYP2C9",
"matchScore": 166,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C9": "Normal Metabolizer"
},
"lookupKey": [
{
"CYP2C9": "2.0"
}
]
}
]
}
]
},
"fluvastatin": {
"name": "fluvastatin",
"id": "PA449688",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "SLCO1B1-drug text",
"version": "1",
"matches": {
"gene": "SLCO1B1",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"simvastatin",
"rosuvastatin",
"pravastatin",
"pitavastatin",
"lovastatin",
"fluvastatin",
"atorvastatin"
]
},
"exception_type": "note",
"message": "The SLCO1B1 genotype (star nomenclature) will be displayed if determinable with the provided VCF based on the SLCO1B1 star allele definition published by CPIC and recommendations are provided based on the genotype.
In case no genotype can be determined, recommendations are based on the rs4149056 genotype alone as per guideline. The minor C allele at rs4149056 defines SLCO1B1*5."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166262341"
],
"citations": [
{
"pmid": "35152405",
"title": "The Clinical Pharmacogenetics Implementation Consortium Guideline for SLCO1B1, ABCG2, and CYP2C9 genotypes and Statin-Associated Musculoskeletal Symptoms.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2022,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9035072"
}
],
"guidelines": [
{
"id": "PA166262341",
"name": "Annotation of CPIC Guideline for fluvastatin and CYP2C9, SLCO1B1",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166262341",
"annotations": [
{
"implications": [
"CYP2C9: Normal exposure.",
"SLCO1B1: Typical myopathy risk and statin exposure."
],
"drugRecommendation": "Prescribe desired starting dose and adjust doses of fluvastatin based on disease-specific guidelines.",
"classification": "Strong",
"activityScore": {
"CYP2C9": "2.0",
"SLCO1B1": "n/a"
},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "CYP2C9",
"matchScore": 166,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
},
{
"allele1": {
"gene": "SLCO1B1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "SLCO1B1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "SLCO1B1",
"matchScore": 70,
"phenotypes": [
"Normal Function"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Function"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C9": "Normal Metabolizer",
"SLCO1B1": "Normal Function"
},
"lookupKey": [
{
"CYP2C9": "2.0",
"SLCO1B1": "Normal Function"
}
]
}
]
}
]
},
"fluvoxamine": {
"name": "fluvoxamine",
"id": "PA449690",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166127637"
],
"citations": [
{
"pmid": "25974703",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for CYP2D6 and CYP2C19 Genotypes and Dosing of Selective Serotonin Reuptake Inhibitors.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2015,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4512908"
},
{
"pmid": "37032427",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for CYP2D6, CYP2C19, CYP2B6, SLC6A4, and HTR2A Genotypes and Serotonin Reuptake Inhibitor Antidepressants.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2023,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10564324"
}
],
"guidelines": [
{
"id": "PA166127637",
"name": "Annotation of CPIC Guideline for fluvoxamine and CYP2D6",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166127637",
"annotations": [
{
"implications": [
"CYP2D6: Reduced metabolism of fluvoxamine to less active compounds when compared to CYP2D6 normal metabolizers. Higher plasma concentrations may increase the probability of side effects."
],
"drugRecommendation": "Initiate therapy with recommended starting dose.",
"classification": "Moderate",
"activityScore": {
"CYP2D6": "1.0"
},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2D6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2D6",
"name": "*3",
"function": "No function",
"reference": false,
"activityValue": "0.0"
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "1.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"1.0"
],
"label": "*1/*3",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2D6": "Intermediate Metabolizer"
},
"lookupKey": [
{
"CYP2D6": "1.0"
}
]
}
]
}
]
},
"fosphenytoin": {
"name": "fosphenytoin",
"id": "PA164746820",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "Phenytoin_HLA-B warning",
"version": "1",
"matches": {
"gene": null,
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"phenytoin",
"fosphenytoin"
]
},
"exception_type": "note",
"message": "The displayed recommendation for CYP2C9 and phenytoin is ONLY valid for non-carriers of the HLA-B*15:02 high-risk allele. PharmCAT Named Allele Matcher does not determine HLA status. CPIC guidance: Fos-/Phenytoin is contraindicated in individuals with the HLA-B*15:02 variant allele (\"HLA-B*15:02-positive\") due to significantly increased risk of fos-/phenytoin-induced cutaneous adverse reactions of Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN). In HLA-B*15:02 carriers, carbamazepine should not be used as an alternative. Alternative medications such as oxcarbazepine, eslicarbazepine acetate, and lamotrigine have some evidence linking SJS/TEN with the HLA-B*15:02 allele, and thus caution should be used in choosing alternatives to phenytoin."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166122806"
],
"citations": [
{
"pmid": "25099164",
"title": "Clinical pharmacogenetics implementation consortium guidelines for CYP2C9 and HLA-B genotypes and phenytoin dosing.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2014,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4206662"
},
{
"pmid": "32779747",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for CYP2C9 and HLA-B Genotypes and Phenytoin Dosing: 2020 Update.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2021,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7831382"
}
],
"guidelines": [
{
"id": "PA166122806",
"name": "Annotation of CPIC Guideline for fosphenytoin, phenytoin and CYP2C9, HLA-B",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166122806",
"annotations": [
{
"implications": [
"CYP2C9: Normal phenytoin metabolism",
"HLA-B: Increased risk of phenytoin-induced SJS/TEN"
],
"drugRecommendation": "If patient is phenytoin-naive, do not use phenytoin/fosphenytoin. Avoid carbamazepine and oxcarbazepine.",
"classification": "Strong",
"activityScore": {
"CYP2C9": "2.0",
"HLA-B": "n/a"
},
"population": "PHT naive",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "CYP2C9",
"matchScore": 166,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
},
{
"allele1": {
"gene": "HLA-B",
"name": "*15:02",
"function": null,
"reference": false,
"activityValue": null
},
"allele2": {
"gene": "HLA-B",
"name": "*57:01",
"function": null,
"reference": false,
"activityValue": null
},
"gene": "HLA-B",
"matchScore": 0,
"phenotypes": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"label": "*15:02/*57:01",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": true,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C9": "Normal Metabolizer",
"HLA-B": "*15:02 positive"
},
"lookupKey": [
{
"HLA-B": "*15:02 positive",
"CYP2C9": "2.0"
}
]
},
{
"implications": [
"CYP2C9: Normal phenytoin metabolism",
"HLA-B: Increased risk of phenytoin-induced SJS/TEN"
],
"drugRecommendation": "If the patient has previously used phenytoin continuously for longer than three months without incidence of cutaneous adverse reactions, cautiously consider use of phenytoin in the future. The latency period for drug-induced SJS/TEN is short with continuous dosing and adherence to therapy (4-28 days), and cases usually occur within three months of dosing.",
"classification": "Optional",
"activityScore": {
"CYP2C9": "2.0",
"HLA-B": "n/a"
},
"population": "PHT use >3mos",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "CYP2C9",
"matchScore": 166,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
},
{
"allele1": {
"gene": "HLA-B",
"name": "*15:02",
"function": null,
"reference": false,
"activityValue": null
},
"allele2": {
"gene": "HLA-B",
"name": "*57:01",
"function": null,
"reference": false,
"activityValue": null
},
"gene": "HLA-B",
"matchScore": 0,
"phenotypes": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"label": "*15:02/*57:01",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": true,
"phenotypes": {
"CYP2C9": "Normal Metabolizer",
"HLA-B": "*15:02 positive"
},
"lookupKey": [
{
"HLA-B": "*15:02 positive",
"CYP2C9": "2.0"
}
]
}
]
}
]
},
"gentamicin": {
"name": "gentamicin",
"id": "PA449753",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166229081"
],
"citations": [
{
"pmid": "34032273",
"title": "Clinical Pharmacogenetics Implementation Consortium Guideline for the Use of Aminoglycosides Based on MT-RNR1 Genotype.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2022,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8613315"
}
],
"guidelines": [
{
"id": "PA166229081",
"name": "Annotation of CPIC Guideline for amikacin, dibekacin, gentamicin, kanamycin, neomycin, netilmicin, paromomycin, plazomicin, ribostamycin, streptomycin, tobramycin and MT-RNR1",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166229081",
"annotations": []
}
]
},
"halothane": {
"name": "halothane",
"id": "PA449845",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166303941"
],
"citations": [
{
"pmid": "30499100",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for the Use of Potent Volatile Anesthetic Agents and Succinylcholine in the Context of RYR1 or CACNA1S Genotypes.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2019,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6513720"
}
],
"guidelines": [
{
"id": "PA166303941",
"name": "Annotation of CPIC Guideline for desflurane, enflurane, halothane, isoflurane, methoxyflurane, sevoflurane, succinylcholine and CACNA1S, RYR1",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166303941",
"annotations": [
{
"implications": [
"These results do not eliminate the chance that this patient is susceptible to malignant hyperthermia (MH). The genetic cause of about half of all MH survivors, with MH susceptibility confirmed by contracture test, remains unknown (PMID 28902675)."
],
"drugRecommendation": "Clinical findings, family history, further genetic testing and other laboratory data should guide use of halogenated volatile anesthetics or depolarizing muscle relaxants.",
"classification": "Strong",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CACNA1S",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CACNA1S",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CACNA1S",
"matchScore": 4,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
},
{
"allele1": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "RYR1",
"matchScore": 0,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": [
{
"allele1": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "RYR1",
"matchScore": 626,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
],
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": true,
"phenotypes": {
"CACNA1S": "Uncertain Susceptibility",
"RYR1": "Uncertain Susceptibility"
},
"lookupKey": [
{
"RYR1": "Uncertain Susceptibility",
"CACNA1S": "Uncertain Susceptibility"
}
]
}
]
}
]
},
"hydralazine": {
"name": "hydralazine",
"id": "PA449894",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166416341"
],
"citations": [
{
"pmid": "40974042",
"title": "Clinical Pharmacogenetics Implementation Consortium Guideline for NAT2 Genotype and Hydralazine Therapy.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2025,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/40974042"
}
],
"guidelines": [
{
"id": "PA166416341",
"name": "Annotation of CPIC Guideline for hydralazine and NAT2",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166416341",
"annotations": [
{
"implications": [
"Predicted to have reduced plasma concentrations and efficacy of hydralazine compared to NAT2 poor metabolizers."
],
"drugRecommendation": "Consider a starting total daily dose of at least 75 mg. Titrate up to 300 mg total daily hydralazine dose as tolerated. NAT2 rapid metabolizers typically require a 50-100% higher maintenance dose compared to poor metabolizers.",
"classification": "Moderate",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "NAT2",
"name": "*1",
"function": "Increased function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "NAT2",
"name": "*1",
"function": "Increased function",
"reference": true,
"activityValue": "n/a"
},
"gene": "NAT2",
"matchScore": 94,
"phenotypes": [
"Rapid Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Rapid Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"NAT2": "Rapid Metabolizer"
},
"lookupKey": [
{
"NAT2": "Rapid Metabolizer"
}
]
}
]
}
]
},
"hydrocodone": {
"name": "hydrocodone",
"id": "PA449900",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166228121"
],
"citations": [
{
"pmid": "33387367",
"title": "Clinical Pharmacogenetics Implementation Consortium Guideline for CYP2D6, OPRM1, and COMT Genotypes and Select Opioid Therapy.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2021,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8249478"
}
],
"guidelines": [
{
"id": "PA166228121",
"name": "Annotation of CPIC Guideline for hydrocodone and CYP2D6",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166228121",
"annotations": [
{
"implications": [
"CYP2D6: Minimal evidence for pharmacokinetic or clinical effect."
],
"drugRecommendation": "Use hydrocodone label recommended age- or weight-specific dosing. If no response and opioid use is warranted, consider non-codeine or non-tramadol opioid.",
"classification": "Optional",
"activityScore": {
"CYP2D6": "1.0"
},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2D6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2D6",
"name": "*3",
"function": "No function",
"reference": false,
"activityValue": "0.0"
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "1.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"1.0"
],
"label": "*1/*3",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": true,
"phenotypes": {
"CYP2D6": "Intermediate Metabolizer"
},
"lookupKey": [
{
"CYP2D6": "1.0"
}
]
}
]
}
]
},
"ibuprofen": {
"name": "ibuprofen",
"id": "PA449957",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166191841"
],
"citations": [
{
"pmid": "32189324",
"title": "Clinical Pharmacogenetics Implementation Consortium Guideline (CPIC) for CYP2C9 and Nonsteroidal Anti-Inflammatory Drugs.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2020,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8080882"
}
],
"guidelines": [
{
"id": "PA166191841",
"name": "Annotation of CPIC Guideline for celecoxib, flurbiprofen, ibuprofen, lornoxicam and CYP2C9",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166191841",
"annotations": [
{
"implications": [
"CYP2C9: Normal metabolism"
],
"drugRecommendation": "Initiate therapy with recommended starting dose. In accordance with the prescribing information, use the lowest effective dosage for shortest duration consistent with individual patient treatment goals.",
"classification": "Strong",
"activityScore": {
"CYP2C9": "2.0"
},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "CYP2C9",
"matchScore": 166,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C9": "Normal Metabolizer"
},
"lookupKey": [
{
"CYP2C9": "2.0"
}
]
}
]
}
]
},
"imipramine": {
"name": "imipramine",
"id": "PA449969",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104999"
],
"citations": [
{
"pmid": "23486447",
"title": "Clinical Pharmacogenetics Implementation Consortium guideline for CYP2D6 and CYP2C19 genotypes and dosing of tricyclic antidepressants.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2013,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3689226"
},
{
"pmid": "27997040",
"title": "Clinical pharmacogenetics implementation consortium guideline (CPIC) for CYP2D6 and CYP2C19 genotypes and dosing of tricyclic antidepressants: 2016 update.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2017,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5478479"
}
],
"guidelines": [
{
"id": "PA166104999",
"name": "Annotation of CPIC Guideline for imipramine and CYP2C19, CYP2D6",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104999",
"annotations": [
{
"implications": [
"CYP2C19: Normal metabolism of tertiary amines",
"CYP2D6: Reduced metabolism of TCAs to less active compounds compared to normal metabolizers; Higher plasma concentrations of active drug will increase the probability of side effects"
],
"drugRecommendation": "Consider a 25% reduction of recommended starting dose. Utilize therapeutic drug monitoring to guide dose adjustments.",
"classification": "Optional",
"activityScore": {
"CYP2C19": "n/a",
"CYP2D6": "1.0"
},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*38",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*38",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 70,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*38/*38",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*38": 2.0
}
},
{
"allele1": {
"gene": "CYP2D6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2D6",
"name": "*3",
"function": "No function",
"reference": false,
"activityValue": "0.0"
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "1.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"1.0"
],
"label": "*1/*3",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Normal Metabolizer",
"CYP2D6": "Intermediate Metabolizer"
},
"lookupKey": [
{
"CYP2D6": "1.0",
"CYP2C19": "Normal Metabolizer"
}
]
}
]
}
]
},
"isoflurane": {
"name": "isoflurane",
"id": "PA450106",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166303941"
],
"citations": [
{
"pmid": "30499100",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for the Use of Potent Volatile Anesthetic Agents and Succinylcholine in the Context of RYR1 or CACNA1S Genotypes.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2019,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6513720"
}
],
"guidelines": [
{
"id": "PA166303941",
"name": "Annotation of CPIC Guideline for desflurane, enflurane, halothane, isoflurane, methoxyflurane, sevoflurane, succinylcholine and CACNA1S, RYR1",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166303941",
"annotations": [
{
"implications": [
"These results do not eliminate the chance that this patient is susceptible to malignant hyperthermia (MH). The genetic cause of about half of all MH survivors, with MH susceptibility confirmed by contracture test, remains unknown (PMID 28902675)."
],
"drugRecommendation": "Clinical findings, family history, further genetic testing and other laboratory data should guide use of halogenated volatile anesthetics or depolarizing muscle relaxants.",
"classification": "Strong",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CACNA1S",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CACNA1S",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CACNA1S",
"matchScore": 4,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
},
{
"allele1": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "RYR1",
"matchScore": 0,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": [
{
"allele1": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "RYR1",
"matchScore": 626,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
],
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": true,
"phenotypes": {
"CACNA1S": "Uncertain Susceptibility",
"RYR1": "Uncertain Susceptibility"
},
"lookupKey": [
{
"RYR1": "Uncertain Susceptibility",
"CACNA1S": "Uncertain Susceptibility"
}
]
}
]
}
]
},
"ivacaftor": {
"name": "ivacaftor",
"id": "PA165950341",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166114461"
],
"citations": [
{
"pmid": "24598717",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) guidelines for ivacaftor therapy in the context of CFTR genotype.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2014,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4026598"
}
],
"guidelines": [
{
"id": "PA166114461",
"name": "Annotation of CPIC Guideline for ivacaftor and CFTR",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166114461",
"annotations": [
{
"implications": [
"CFTR: An individual diagnosed with cystic fibrosis (CF) and negative for a CFTR variant listed in the FDA-approved drug label as being responsive to ivacaftor."
],
"drugRecommendation": "Ivacaftor is not recommended",
"classification": "Moderate",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CFTR",
"name": "ivacaftor non-responsive CFTR sequence",
"function": "ivacaftor non-responsive",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CFTR",
"name": "ivacaftor non-responsive CFTR sequence",
"function": "ivacaftor non-responsive",
"reference": true,
"activityValue": "n/a"
},
"gene": "CFTR",
"matchScore": 186,
"phenotypes": [
"ivacaftor non-responsive in CF patients"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"ivacaftor non-responsive in CF patients"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"ivacaftor non-responsive CFTR sequence": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": true,
"otherPrescribingGuidance": false,
"phenotypes": {
"CFTR": "ivacaftor non-responsive in CF patients"
},
"lookupKey": [
{
"CFTR": "ivacaftor non-responsive in CF patients"
}
]
}
]
}
]
},
"kanamycin": {
"name": "kanamycin",
"id": "PA450137",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166229081"
],
"citations": [
{
"pmid": "34032273",
"title": "Clinical Pharmacogenetics Implementation Consortium Guideline for the Use of Aminoglycosides Based on MT-RNR1 Genotype.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2022,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8613315"
}
],
"guidelines": [
{
"id": "PA166229081",
"name": "Annotation of CPIC Guideline for amikacin, dibekacin, gentamicin, kanamycin, neomycin, netilmicin, paromomycin, plazomicin, ribostamycin, streptomycin, tobramycin and MT-RNR1",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166229081",
"annotations": []
}
]
},
"lansoprazole": {
"name": "lansoprazole",
"id": "PA450180",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166219103"
],
"citations": [
{
"pmid": "32770672",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for CYP2C19 and Proton Pump Inhibitor Dosing.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2021,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7868475"
}
],
"guidelines": [
{
"id": "PA166219103",
"name": "Annotation of CPIC Guideline for lansoprazole, omeprazole, pantoprazole and CYP2C19",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166219103",
"annotations": [
{
"implications": [
"CYP2C19: Normal PPI metabolism; may be at increased risk of therapeutic failure compared to CYP2C19 IMs and PMs"
],
"drugRecommendation": "Initiate standard starting daily dose. Consider increasing dose by 50-100% for the treatment of H. pylori infection and erosive esophagitis. Daily dose may be given in divided doses.\nMonitor for efficacy.",
"classification": "Moderate",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*38",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*38",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 70,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*38/*38",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*38": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Normal Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Normal Metabolizer"
}
]
}
]
}
]
},
"lornoxicam": {
"name": "lornoxicam",
"id": "PA165958395",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166191841"
],
"citations": [
{
"pmid": "32189324",
"title": "Clinical Pharmacogenetics Implementation Consortium Guideline (CPIC) for CYP2C9 and Nonsteroidal Anti-Inflammatory Drugs.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2020,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8080882"
}
],
"guidelines": [
{
"id": "PA166191841",
"name": "Annotation of CPIC Guideline for celecoxib, flurbiprofen, ibuprofen, lornoxicam and CYP2C9",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166191841",
"annotations": [
{
"implications": [
"CYP2C9: Normal metabolism"
],
"drugRecommendation": "Initiate therapy with recommended starting dose. In accordance with the prescribing information, use the lowest effective dosage for shortest duration consistent with individual patient treatment goals.",
"classification": "Strong",
"activityScore": {
"CYP2C9": "2.0"
},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "CYP2C9",
"matchScore": 166,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C9": "Normal Metabolizer"
},
"lookupKey": [
{
"CYP2C9": "2.0"
}
]
}
]
}
]
},
"lovastatin": {
"name": "lovastatin",
"id": "PA450272",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "SLCO1B1-drug text",
"version": "1",
"matches": {
"gene": "SLCO1B1",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"simvastatin",
"rosuvastatin",
"pravastatin",
"pitavastatin",
"lovastatin",
"fluvastatin",
"atorvastatin"
]
},
"exception_type": "note",
"message": "The SLCO1B1 genotype (star nomenclature) will be displayed if determinable with the provided VCF based on the SLCO1B1 star allele definition published by CPIC and recommendations are provided based on the genotype.
In case no genotype can be determined, recommendations are based on the rs4149056 genotype alone as per guideline. The minor C allele at rs4149056 defines SLCO1B1*5."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166262241"
],
"citations": [
{
"pmid": "35152405",
"title": "The Clinical Pharmacogenetics Implementation Consortium Guideline for SLCO1B1, ABCG2, and CYP2C9 genotypes and Statin-Associated Musculoskeletal Symptoms.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2022,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9035072"
}
],
"guidelines": [
{
"id": "PA166262241",
"name": "Annotation of CPIC Guideline for lovastatin and SLCO1B1",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166262241",
"annotations": [
{
"implications": [
"SLCO1B1: Typical myopathy risk and statin exposure"
],
"drugRecommendation": "Prescribe desired starting dose and adjust doses based on disease-specific guidelines.",
"classification": "Strong",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "SLCO1B1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "SLCO1B1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "SLCO1B1",
"matchScore": 70,
"phenotypes": [
"Normal Function"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Function"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"SLCO1B1": "Normal Function"
},
"lookupKey": [
{
"SLCO1B1": "Normal Function"
}
]
}
]
}
]
},
"meloxicam": {
"name": "meloxicam",
"id": "PA450353",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166192301"
],
"citations": [
{
"pmid": "32189324",
"title": "Clinical Pharmacogenetics Implementation Consortium Guideline (CPIC) for CYP2C9 and Nonsteroidal Anti-Inflammatory Drugs.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2020,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8080882"
}
],
"guidelines": [
{
"id": "PA166192301",
"name": "Annotation of CPIC Guideline for meloxicam and CYP2C9",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166192301",
"annotations": [
{
"implications": [
"CYP2C9: Normal metabolism"
],
"drugRecommendation": "Initiate therapy with recommended starting dose. In accordance with the prescribing information, use the lowest effective dosage for shortest duration consistent with individual patient treatment goals.",
"classification": "Strong",
"activityScore": {
"CYP2C9": "2.0"
},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "CYP2C9",
"matchScore": 166,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C9": "Normal Metabolizer"
},
"lookupKey": [
{
"CYP2C9": "2.0"
}
]
}
]
}
]
},
"mercaptopurine": {
"name": "mercaptopurine",
"id": "PA450379",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104945"
],
"citations": [
{
"pmid": "21270794",
"title": "Clinical Pharmacogenetics Implementation Consortium guidelines for thiopurine methyltransferase genotype and thiopurine dosing.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3098761"
},
{
"pmid": "23422873",
"title": "Clinical pharmacogenetics implementation consortium guidelines for thiopurine methyltransferase genotype and thiopurine dosing: 2013 update.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2013,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3604643"
},
{
"pmid": "30447069",
"title": "Clinical Pharmacogenetics Implementation Consortium Guideline for Thiopurine Dosing Based on TPMT and NUDT15 Genotypes: 2018 Update.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2019,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6576267"
},
{
"pmid": "41618934",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for Thiopurine Dosing Based on TPMT and NUDT15 Genotypes: 2025 Update.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2026,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/41618934"
}
],
"guidelines": [
{
"id": "PA166104945",
"name": "Annotation of CPIC Guideline for mercaptopurine and NUDT15, TPMT",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104945",
"annotations": [
{
"implications": [
"Normal risk of thiopurine-related leukopenia, neutropenia and myelosuppression.",
"TPMT NMs have lower erythrocyte concentrations of TGN metabolites and higher concentrations of MeMPNs compared to TPMT IMs and TPMT PMs. This is the 'normal' pattern."
],
"drugRecommendation": "Initiate therapy with standard starting dose of mecaptopurine (e.g., 75 mg/m2/day for malignancy or 1.5 mg/kg/day for nonmalignancy). During therapy, adjust the doses of myelosuppressive agents, as per standard clinical practice. It usually takes at least 2 weeks of stable dosing to reach steady state after each dose adjustment.",
"classification": "Strong",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "NUDT15",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "NUDT15",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "NUDT15",
"matchScore": 36,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
},
{
"allele1": {
"gene": "TPMT",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "TPMT",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "TPMT",
"matchScore": 90,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"NUDT15": "Normal Metabolizer",
"TPMT": "Normal Metabolizer"
},
"lookupKey": [
{
"TPMT": "Normal Metabolizer",
"NUDT15": "Normal Metabolizer"
}
]
}
]
}
]
},
"methoxyflurane": {
"name": "methoxyflurane",
"id": "PA450434",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166303941"
],
"citations": [
{
"pmid": "30499100",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for the Use of Potent Volatile Anesthetic Agents and Succinylcholine in the Context of RYR1 or CACNA1S Genotypes.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2019,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6513720"
}
],
"guidelines": [
{
"id": "PA166303941",
"name": "Annotation of CPIC Guideline for desflurane, enflurane, halothane, isoflurane, methoxyflurane, sevoflurane, succinylcholine and CACNA1S, RYR1",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166303941",
"annotations": [
{
"implications": [
"These results do not eliminate the chance that this patient is susceptible to malignant hyperthermia (MH). The genetic cause of about half of all MH survivors, with MH susceptibility confirmed by contracture test, remains unknown (PMID 28902675)."
],
"drugRecommendation": "Clinical findings, family history, further genetic testing and other laboratory data should guide use of halogenated volatile anesthetics or depolarizing muscle relaxants.",
"classification": "Strong",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CACNA1S",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CACNA1S",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CACNA1S",
"matchScore": 4,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
},
{
"allele1": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "RYR1",
"matchScore": 0,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": [
{
"allele1": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "RYR1",
"matchScore": 626,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
],
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": true,
"phenotypes": {
"CACNA1S": "Uncertain Susceptibility",
"RYR1": "Uncertain Susceptibility"
},
"lookupKey": [
{
"RYR1": "Uncertain Susceptibility",
"CACNA1S": "Uncertain Susceptibility"
}
]
}
]
}
]
},
"methylene blue": {
"name": "methylene blue",
"id": "PA450457",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "G6PD hemizygous samples",
"version": "2",
"matches": {
"gene": "G6PD",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"aminosalicylic acid",
"aspirin",
"chloramphenicol",
"chloroquine",
"ciprofloxacin",
"dapsone",
"dimercaprol",
"doxorubicin",
"furazolidone",
"glyburide",
"hydroxychloroquine",
"mafenide",
"methylene blue",
"nalidixic acid",
"nitrofurantoin",
"norfloxacin",
"ofloxacin",
"pegloticase",
"phenazopyridine",
"primaquine",
"quinine",
"rasburicase",
"sulfadiazine",
"sulfadimidine",
"sulfamethoxazole",
"trimethoprim",
"sulfanilamide",
"sulfasalazine",
"sulfisoxazole",
"tafenoquine",
"tolbutamide",
"toluidine blue",
"vitamin c",
"vitamin k"
]
},
"exception_type": "note",
"message": "PharmCAT reports based on VCF file input and some VCF files do not specify hemizygous (one X chromosome) and instead represent samples as homozygous. See PharmCAT FAQs (https://pharmcat.org/faqs/)."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166119846"
],
"citations": [
{
"pmid": "24787449",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) guidelines for rasburicase therapy in the context of G6PD deficiency genotype.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2014,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4111801"
},
{
"pmid": "36049896",
"title": "Expanded Clinical Pharmacogenetics Implementation Consortium Guideline for Medication Use in the Context of G6PD Genotype.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2023,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10281211"
}
],
"guidelines": [
{
"id": "PA166119846",
"name": "Annotation of CPIC Guideline for dapsone, methylene blue, pegloticase, rasburicase, tafenoquine, toluidine blue and G6PD",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166119846",
"annotations": [
{
"implications": [
"G6PD: Low risk of acute hemolytic anemia"
],
"drugRecommendation": "No reason to avoid based on G6PD status",
"classification": "Strong",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "G6PD",
"name": "B (reference)",
"function": "IV/Normal",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "G6PD",
"name": "B (reference)",
"function": "IV/Normal",
"reference": true,
"activityValue": "n/a"
},
"gene": "G6PD",
"matchScore": 342,
"phenotypes": [
"Normal"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal"
],
"label": "B (reference)/B (reference)",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"B (reference)": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"G6PD": "Normal"
},
"lookupKey": [
{
"G6PD": "Normal"
}
]
}
]
}
]
},
"metoprolol": {
"name": "metoprolol",
"id": "PA450480",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166341321"
],
"citations": [
{
"pmid": "38951961",
"title": "Clinical Pharmacogenetics Implementation Consortium Guideline (CPIC) for CYP2D6, ADRB1, ADRB2, ADRA2C, GRK4, and GRK5 Genotypes and Beta-Blocker Therapy.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2024,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC11502236"
}
],
"guidelines": [
{
"id": "PA166341321",
"name": "Annotation of CPIC Guideline for metoprolol and CYP2D6",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166341321",
"annotations": [
{
"implications": [
"Decreased metabolism of metoprolol leading to increased drug concentrations; however, this does not appear to translate into clinically significant changes in heart rate, blood pressure, or clinical outcomes"
],
"drugRecommendation": "Initiate standard dosing",
"classification": "Moderate",
"activityScore": {
"CYP2D6": "1.0"
},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2D6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2D6",
"name": "*3",
"function": "No function",
"reference": false,
"activityValue": "0.0"
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "1.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"1.0"
],
"label": "*1/*3",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2D6": "Intermediate Metabolizer"
},
"lookupKey": [
{
"CYP2D6": "1.0"
}
]
}
]
}
]
},
"neomycin": {
"name": "neomycin",
"id": "PA450608",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166229081"
],
"citations": [
{
"pmid": "34032273",
"title": "Clinical Pharmacogenetics Implementation Consortium Guideline for the Use of Aminoglycosides Based on MT-RNR1 Genotype.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2022,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8613315"
}
],
"guidelines": [
{
"id": "PA166229081",
"name": "Annotation of CPIC Guideline for amikacin, dibekacin, gentamicin, kanamycin, neomycin, netilmicin, paromomycin, plazomicin, ribostamycin, streptomycin, tobramycin and MT-RNR1",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166229081",
"annotations": []
}
]
},
"netilmicin": {
"name": "netilmicin",
"id": "PA164754913",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166229081"
],
"citations": [
{
"pmid": "34032273",
"title": "Clinical Pharmacogenetics Implementation Consortium Guideline for the Use of Aminoglycosides Based on MT-RNR1 Genotype.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2022,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8613315"
}
],
"guidelines": [
{
"id": "PA166229081",
"name": "Annotation of CPIC Guideline for amikacin, dibekacin, gentamicin, kanamycin, neomycin, netilmicin, paromomycin, plazomicin, ribostamycin, streptomycin, tobramycin and MT-RNR1",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166229081",
"annotations": []
}
]
},
"nitrofurantoin": {
"name": "nitrofurantoin",
"id": "PA450640",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "G6PD hemizygous samples",
"version": "2",
"matches": {
"gene": "G6PD",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"aminosalicylic acid",
"aspirin",
"chloramphenicol",
"chloroquine",
"ciprofloxacin",
"dapsone",
"dimercaprol",
"doxorubicin",
"furazolidone",
"glyburide",
"hydroxychloroquine",
"mafenide",
"methylene blue",
"nalidixic acid",
"nitrofurantoin",
"norfloxacin",
"ofloxacin",
"pegloticase",
"phenazopyridine",
"primaquine",
"quinine",
"rasburicase",
"sulfadiazine",
"sulfadimidine",
"sulfamethoxazole",
"trimethoprim",
"sulfanilamide",
"sulfasalazine",
"sulfisoxazole",
"tafenoquine",
"tolbutamide",
"toluidine blue",
"vitamin c",
"vitamin k"
]
},
"exception_type": "note",
"message": "PharmCAT reports based on VCF file input and some VCF files do not specify hemizygous (one X chromosome) and instead represent samples as homozygous. See PharmCAT FAQs (https://pharmcat.org/faqs/)."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166279721"
],
"citations": [],
"guidelines": [
{
"id": "PA166279721",
"name": "Annotation of CPIC Guideline for nitrofurantoin and G6PD",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166279721",
"annotations": [
{
"implications": [
"G6PD: Low risk of acute hemolytic anemia"
],
"drugRecommendation": "No reason to avoid based on G6PD status",
"classification": "Strong",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "G6PD",
"name": "B (reference)",
"function": "IV/Normal",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "G6PD",
"name": "B (reference)",
"function": "IV/Normal",
"reference": true,
"activityValue": "n/a"
},
"gene": "G6PD",
"matchScore": 342,
"phenotypes": [
"Normal"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal"
],
"label": "B (reference)/B (reference)",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"B (reference)": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"G6PD": "Normal"
},
"lookupKey": [
{
"G6PD": "Normal"
}
]
}
]
}
]
},
"nortriptyline": {
"name": "nortriptyline",
"id": "PA450657",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104998"
],
"citations": [
{
"pmid": "23486447",
"title": "Clinical Pharmacogenetics Implementation Consortium guideline for CYP2D6 and CYP2C19 genotypes and dosing of tricyclic antidepressants.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2013,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3689226"
},
{
"pmid": "27997040",
"title": "Clinical pharmacogenetics implementation consortium guideline (CPIC) for CYP2D6 and CYP2C19 genotypes and dosing of tricyclic antidepressants: 2016 update.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2017,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5478479"
}
],
"guidelines": [
{
"id": "PA166104998",
"name": "Annotation of CPIC Guideline for nortriptyline and CYP2D6",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104998",
"annotations": [
{
"implications": [
"CYP2D6: Reduced metabolism of tricyclic antidepressants to less active compounds compared to normal metabolizers. Higher plasma concentrations of active drug will increase the probability of side effects."
],
"drugRecommendation": "Consider a 25% reduction of recommended starting dose. Titrate dose to observed clinical response with symptom improvement and minimal (if any) side effects. Utilize therapeutic drug monitoring to guide dose adjustments.",
"classification": "Optional",
"activityScore": {
"CYP2D6": "1.0"
},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2D6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2D6",
"name": "*3",
"function": "No function",
"reference": false,
"activityValue": "0.0"
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "1.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"1.0"
],
"label": "*1/*3",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2D6": "Intermediate Metabolizer"
},
"lookupKey": [
{
"CYP2D6": "1.0"
}
]
}
]
}
]
},
"omeprazole": {
"name": "omeprazole",
"id": "PA450704",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166219103"
],
"citations": [
{
"pmid": "32770672",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for CYP2C19 and Proton Pump Inhibitor Dosing.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2021,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7868475"
}
],
"guidelines": [
{
"id": "PA166219103",
"name": "Annotation of CPIC Guideline for lansoprazole, omeprazole, pantoprazole and CYP2C19",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166219103",
"annotations": [
{
"implications": [
"CYP2C19: Normal PPI metabolism; may be at increased risk of therapeutic failure compared to CYP2C19 IMs and PMs"
],
"drugRecommendation": "Initiate standard starting daily dose. Consider increasing dose by 50-100% for the treatment of H. pylori infection and erosive esophagitis. Daily dose may be given in divided doses.\nMonitor for efficacy.",
"classification": "Moderate",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*38",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*38",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 70,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*38/*38",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*38": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Normal Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Normal Metabolizer"
}
]
}
]
}
]
},
"ondansetron": {
"name": "ondansetron",
"id": "PA450705",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166161954"
],
"citations": [
{
"pmid": "28002639",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) guideline for CYP2D6 genotype and use of ondansetron and tropisetron.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2017,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5479760"
}
],
"guidelines": [
{
"id": "PA166161954",
"name": "Annotation of CPIC Guideline for ondansetron and CYP2D6",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166161954",
"annotations": [
{
"implications": [
"CYP2D6: Very limited data available for CYP2D6 intermediate metabolizers"
],
"drugRecommendation": "Insufficient evidence demonstrating clinical impact based on CYP2D6 genotype. Initiate therapy with recommended starting dose.",
"classification": "No recommendation",
"activityScore": {
"CYP2D6": "1.0"
},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2D6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2D6",
"name": "*3",
"function": "No function",
"reference": false,
"activityValue": "0.0"
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "1.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"1.0"
],
"label": "*1/*3",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2D6": "Intermediate Metabolizer"
},
"lookupKey": [
{
"CYP2D6": "1.0"
}
]
}
]
}
]
},
"oxcarbazepine": {
"name": "oxcarbazepine",
"id": "PA450732",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166176623"
],
"citations": [
{
"pmid": "29392710",
"title": "Clinical Pharmacogenetics Implementation Consortium Guideline for HLA Genotype and Use of Carbamazepine and Oxcarbazepine: 2017 Update.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2018,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5847474"
}
],
"guidelines": [
{
"id": "PA166176623",
"name": "Annotation of CPIC Guideline for oxcarbazepine and HLA-B",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166176623",
"annotations": [
{
"implications": [
"HLA-B: Greater risk of oxcarbazepine-induced SJS/TEN"
],
"drugRecommendation": "If patient is oxcarbazepine-naïve, do not use oxcarbazepine.",
"classification": "Strong",
"activityScore": {},
"population": "OXC naive",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "HLA-B",
"name": "*15:02",
"function": null,
"reference": false,
"activityValue": null
},
"allele2": {
"gene": "HLA-B",
"name": "*57:01",
"function": null,
"reference": false,
"activityValue": null
},
"gene": "HLA-B",
"matchScore": 0,
"phenotypes": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"label": "*15:02/*57:01",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": true,
"otherPrescribingGuidance": false,
"phenotypes": {
"HLA-B": "*15:02 positive"
},
"lookupKey": [
{
"HLA-B": "*15:02 positive"
}
]
},
{
"implications": [
"HLA-B: Greater risk of oxcarbazepine-induced SJS/TEN"
],
"drugRecommendation": "The latency period for drug-induced SJS/TEN is short with continuous dosing and adherence to therapy (~4-28 days), and cases usually occur within three months of dosing; therefore, if the patient has previously used oxcarbazepine consistently for longer than three months without incidence of cutaneous adverse reactions, cautiously consider use of oxcarbazepine in the future.",
"classification": "Optional",
"activityScore": {},
"population": "OXC use >3 mos",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "HLA-B",
"name": "*15:02",
"function": null,
"reference": false,
"activityValue": null
},
"allele2": {
"gene": "HLA-B",
"name": "*57:01",
"function": null,
"reference": false,
"activityValue": null
},
"gene": "HLA-B",
"matchScore": 0,
"phenotypes": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"label": "*15:02/*57:01",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": true,
"phenotypes": {
"HLA-B": "*15:02 positive"
},
"lookupKey": [
{
"HLA-B": "*15:02 positive"
}
]
}
]
}
]
},
"pantoprazole": {
"name": "pantoprazole",
"id": "PA450774",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166219103"
],
"citations": [
{
"pmid": "32770672",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for CYP2C19 and Proton Pump Inhibitor Dosing.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2021,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7868475"
}
],
"guidelines": [
{
"id": "PA166219103",
"name": "Annotation of CPIC Guideline for lansoprazole, omeprazole, pantoprazole and CYP2C19",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166219103",
"annotations": [
{
"implications": [
"CYP2C19: Normal PPI metabolism; may be at increased risk of therapeutic failure compared to CYP2C19 IMs and PMs"
],
"drugRecommendation": "Initiate standard starting daily dose. Consider increasing dose by 50-100% for the treatment of H. pylori infection and erosive esophagitis. Daily dose may be given in divided doses.\nMonitor for efficacy.",
"classification": "Moderate",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*38",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*38",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 70,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*38/*38",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*38": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Normal Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Normal Metabolizer"
}
]
}
]
}
]
},
"paromomycin": {
"name": "paromomycin",
"id": "PA164784023",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166229081"
],
"citations": [
{
"pmid": "34032273",
"title": "Clinical Pharmacogenetics Implementation Consortium Guideline for the Use of Aminoglycosides Based on MT-RNR1 Genotype.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2022,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8613315"
}
],
"guidelines": [
{
"id": "PA166229081",
"name": "Annotation of CPIC Guideline for amikacin, dibekacin, gentamicin, kanamycin, neomycin, netilmicin, paromomycin, plazomicin, ribostamycin, streptomycin, tobramycin and MT-RNR1",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166229081",
"annotations": []
}
]
},
"paroxetine": {
"name": "paroxetine",
"id": "PA450801",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166127636"
],
"citations": [
{
"pmid": "25974703",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for CYP2D6 and CYP2C19 Genotypes and Dosing of Selective Serotonin Reuptake Inhibitors.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2015,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4512908"
},
{
"pmid": "37032427",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for CYP2D6, CYP2C19, CYP2B6, SLC6A4, and HTR2A Genotypes and Serotonin Reuptake Inhibitor Antidepressants.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2023,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10564324"
}
],
"guidelines": [
{
"id": "PA166127636",
"name": "Annotation of CPIC Guideline for paroxetine and CYP2D6",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166127636",
"annotations": [
{
"implications": [
"CYP2D6: Reduced metabolism of paroxetine to less active compounds when compared to CYP2D6 normal metabolizers when starting treatment or at lower doses. Higher plasma concentrations may increase the probability of side\neffects. Paroxetine-associated phenoconversion of intermediate metabolizers to poor metabolizers due to CYP2D6 autoinhibition may occur and is dose-dependent and greater at steady state concentrations."
],
"drugRecommendation": "Consider a lower starting dose and slower titration schedule as compared to normal metabolizers.",
"classification": "Optional",
"activityScore": {
"CYP2D6": "1.0"
},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2D6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2D6",
"name": "*3",
"function": "No function",
"reference": false,
"activityValue": "0.0"
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "1.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"1.0"
],
"label": "*1/*3",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2D6": "Intermediate Metabolizer"
},
"lookupKey": [
{
"CYP2D6": "1.0"
}
]
}
]
}
]
},
"peginterferon alfa-2a": {
"name": "peginterferon alfa-2a",
"id": "PA164749390",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166110235"
],
"citations": [
{
"pmid": "24096968",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) guidelines for IFNL3 (IL28B) genotype and PEG interferon-alpha-based regimens.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2014,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3904555"
}
],
"guidelines": [
{
"id": "PA166110235",
"name": "Annotation of CPIC Guideline for peginterferon alfa-2a, peginterferon alfa-2b, ribavirin and IFNL3",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166110235",
"annotations": []
}
]
},
"peginterferon alfa-2b": {
"name": "peginterferon alfa-2b",
"id": "PA164784024",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166110235"
],
"citations": [
{
"pmid": "24096968",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) guidelines for IFNL3 (IL28B) genotype and PEG interferon-alpha-based regimens.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2014,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3904555"
}
],
"guidelines": [
{
"id": "PA166110235",
"name": "Annotation of CPIC Guideline for peginterferon alfa-2a, peginterferon alfa-2b, ribavirin and IFNL3",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166110235",
"annotations": []
}
]
},
"pegloticase": {
"name": "pegloticase",
"id": "PA165963961",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "G6PD hemizygous samples",
"version": "2",
"matches": {
"gene": "G6PD",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"aminosalicylic acid",
"aspirin",
"chloramphenicol",
"chloroquine",
"ciprofloxacin",
"dapsone",
"dimercaprol",
"doxorubicin",
"furazolidone",
"glyburide",
"hydroxychloroquine",
"mafenide",
"methylene blue",
"nalidixic acid",
"nitrofurantoin",
"norfloxacin",
"ofloxacin",
"pegloticase",
"phenazopyridine",
"primaquine",
"quinine",
"rasburicase",
"sulfadiazine",
"sulfadimidine",
"sulfamethoxazole",
"trimethoprim",
"sulfanilamide",
"sulfasalazine",
"sulfisoxazole",
"tafenoquine",
"tolbutamide",
"toluidine blue",
"vitamin c",
"vitamin k"
]
},
"exception_type": "note",
"message": "PharmCAT reports based on VCF file input and some VCF files do not specify hemizygous (one X chromosome) and instead represent samples as homozygous. See PharmCAT FAQs (https://pharmcat.org/faqs/)."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166119846"
],
"citations": [
{
"pmid": "24787449",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) guidelines for rasburicase therapy in the context of G6PD deficiency genotype.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2014,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4111801"
},
{
"pmid": "36049896",
"title": "Expanded Clinical Pharmacogenetics Implementation Consortium Guideline for Medication Use in the Context of G6PD Genotype.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2023,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10281211"
}
],
"guidelines": [
{
"id": "PA166119846",
"name": "Annotation of CPIC Guideline for dapsone, methylene blue, pegloticase, rasburicase, tafenoquine, toluidine blue and G6PD",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166119846",
"annotations": [
{
"implications": [
"G6PD: Low risk of acute hemolytic anemia"
],
"drugRecommendation": "No reason to avoid based on G6PD status",
"classification": "Strong",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "G6PD",
"name": "B (reference)",
"function": "IV/Normal",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "G6PD",
"name": "B (reference)",
"function": "IV/Normal",
"reference": true,
"activityValue": "n/a"
},
"gene": "G6PD",
"matchScore": 342,
"phenotypes": [
"Normal"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal"
],
"label": "B (reference)/B (reference)",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"B (reference)": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"G6PD": "Normal"
},
"lookupKey": [
{
"G6PD": "Normal"
}
]
}
]
}
]
},
"phenytoin": {
"name": "phenytoin",
"id": "PA450947",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "Phenytoin_HLA-B warning",
"version": "1",
"matches": {
"gene": null,
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"phenytoin",
"fosphenytoin"
]
},
"exception_type": "note",
"message": "The displayed recommendation for CYP2C9 and phenytoin is ONLY valid for non-carriers of the HLA-B*15:02 high-risk allele. PharmCAT Named Allele Matcher does not determine HLA status. CPIC guidance: Fos-/Phenytoin is contraindicated in individuals with the HLA-B*15:02 variant allele (\"HLA-B*15:02-positive\") due to significantly increased risk of fos-/phenytoin-induced cutaneous adverse reactions of Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN). In HLA-B*15:02 carriers, carbamazepine should not be used as an alternative. Alternative medications such as oxcarbazepine, eslicarbazepine acetate, and lamotrigine have some evidence linking SJS/TEN with the HLA-B*15:02 allele, and thus caution should be used in choosing alternatives to phenytoin."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166122806"
],
"citations": [
{
"pmid": "25099164",
"title": "Clinical pharmacogenetics implementation consortium guidelines for CYP2C9 and HLA-B genotypes and phenytoin dosing.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2014,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4206662"
},
{
"pmid": "32779747",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for CYP2C9 and HLA-B Genotypes and Phenytoin Dosing: 2020 Update.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2021,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7831382"
}
],
"guidelines": [
{
"id": "PA166122806",
"name": "Annotation of CPIC Guideline for fosphenytoin, phenytoin and CYP2C9, HLA-B",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166122806",
"annotations": [
{
"implications": [
"CYP2C9: Normal phenytoin metabolism",
"HLA-B: Increased risk of phenytoin-induced SJS/TEN"
],
"drugRecommendation": "If patient is phenytoin-naive, do not use phenytoin/fosphenytoin. Avoid carbamazepine and oxcarbazepine.",
"classification": "Strong",
"activityScore": {
"CYP2C9": "2.0",
"HLA-B": "n/a"
},
"population": "PHT naive",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "CYP2C9",
"matchScore": 166,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
},
{
"allele1": {
"gene": "HLA-B",
"name": "*15:02",
"function": null,
"reference": false,
"activityValue": null
},
"allele2": {
"gene": "HLA-B",
"name": "*57:01",
"function": null,
"reference": false,
"activityValue": null
},
"gene": "HLA-B",
"matchScore": 0,
"phenotypes": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"label": "*15:02/*57:01",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": true,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C9": "Normal Metabolizer",
"HLA-B": "*15:02 positive"
},
"lookupKey": [
{
"HLA-B": "*15:02 positive",
"CYP2C9": "2.0"
}
]
},
{
"implications": [
"CYP2C9: Normal phenytoin metabolism",
"HLA-B: Increased risk of phenytoin-induced SJS/TEN"
],
"drugRecommendation": "If the patient has previously used phenytoin continuously for longer than three months without incidence of cutaneous adverse reactions, cautiously consider use of phenytoin in the future. The latency period for drug-induced SJS/TEN is short with continuous dosing and adherence to therapy (4-28 days), and cases usually occur within three months of dosing.",
"classification": "Optional",
"activityScore": {
"CYP2C9": "2.0",
"HLA-B": "n/a"
},
"population": "PHT use >3mos",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "CYP2C9",
"matchScore": 166,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
},
{
"allele1": {
"gene": "HLA-B",
"name": "*15:02",
"function": null,
"reference": false,
"activityValue": null
},
"allele2": {
"gene": "HLA-B",
"name": "*57:01",
"function": null,
"reference": false,
"activityValue": null
},
"gene": "HLA-B",
"matchScore": 0,
"phenotypes": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"label": "*15:02/*57:01",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": true,
"phenotypes": {
"CYP2C9": "Normal Metabolizer",
"HLA-B": "*15:02 positive"
},
"lookupKey": [
{
"HLA-B": "*15:02 positive",
"CYP2C9": "2.0"
}
]
}
]
}
]
},
"piroxicam": {
"name": "piroxicam",
"id": "PA450985",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166192321"
],
"citations": [
{
"pmid": "32189324",
"title": "Clinical Pharmacogenetics Implementation Consortium Guideline (CPIC) for CYP2C9 and Nonsteroidal Anti-Inflammatory Drugs.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2020,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8080882"
}
],
"guidelines": [
{
"id": "PA166192321",
"name": "Annotation of CPIC Guideline for piroxicam and CYP2C9",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166192321",
"annotations": [
{
"implications": [
"CYP2C9: Normal metabolism"
],
"drugRecommendation": "Initiate therapy with recommended starting dose. In accordance with the prescribing information, use the lowest effective dosage for shortest duration consistent with individual patient treatment goals.",
"classification": "Strong",
"activityScore": {
"CYP2C9": "2.0"
},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "CYP2C9",
"matchScore": 166,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C9": "Normal Metabolizer"
},
"lookupKey": [
{
"CYP2C9": "2.0"
}
]
}
]
}
]
},
"pitavastatin": {
"name": "pitavastatin",
"id": "PA142650384",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "SLCO1B1-drug text",
"version": "1",
"matches": {
"gene": "SLCO1B1",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"simvastatin",
"rosuvastatin",
"pravastatin",
"pitavastatin",
"lovastatin",
"fluvastatin",
"atorvastatin"
]
},
"exception_type": "note",
"message": "The SLCO1B1 genotype (star nomenclature) will be displayed if determinable with the provided VCF based on the SLCO1B1 star allele definition published by CPIC and recommendations are provided based on the genotype.
In case no genotype can be determined, recommendations are based on the rs4149056 genotype alone as per guideline. The minor C allele at rs4149056 defines SLCO1B1*5."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166262261"
],
"citations": [
{
"pmid": "35152405",
"title": "The Clinical Pharmacogenetics Implementation Consortium Guideline for SLCO1B1, ABCG2, and CYP2C9 genotypes and Statin-Associated Musculoskeletal Symptoms.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2022,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9035072"
}
],
"guidelines": [
{
"id": "PA166262261",
"name": "Annotation of CPIC Guideline for pitavastatin and SLCO1B1",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166262261",
"annotations": [
{
"implications": [
"SLCO1B1: Typical myopathy risk and statin exposure"
],
"drugRecommendation": "Prescribe desired starting dose and adjust doses based on disease-specific guidelines.",
"classification": "Strong",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "SLCO1B1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "SLCO1B1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "SLCO1B1",
"matchScore": 70,
"phenotypes": [
"Normal Function"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Function"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"SLCO1B1": "Normal Function"
},
"lookupKey": [
{
"SLCO1B1": "Normal Function"
}
]
}
]
}
]
},
"plazomicin": {
"name": "plazomicin",
"id": "PA166228921",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166229081"
],
"citations": [
{
"pmid": "34032273",
"title": "Clinical Pharmacogenetics Implementation Consortium Guideline for the Use of Aminoglycosides Based on MT-RNR1 Genotype.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2022,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8613315"
}
],
"guidelines": [
{
"id": "PA166229081",
"name": "Annotation of CPIC Guideline for amikacin, dibekacin, gentamicin, kanamycin, neomycin, netilmicin, paromomycin, plazomicin, ribostamycin, streptomycin, tobramycin and MT-RNR1",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166229081",
"annotations": []
}
]
},
"pravastatin": {
"name": "pravastatin",
"id": "PA451089",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "SLCO1B1-drug text",
"version": "1",
"matches": {
"gene": "SLCO1B1",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"simvastatin",
"rosuvastatin",
"pravastatin",
"pitavastatin",
"lovastatin",
"fluvastatin",
"atorvastatin"
]
},
"exception_type": "note",
"message": "The SLCO1B1 genotype (star nomenclature) will be displayed if determinable with the provided VCF based on the SLCO1B1 star allele definition published by CPIC and recommendations are provided based on the genotype.
In case no genotype can be determined, recommendations are based on the rs4149056 genotype alone as per guideline. The minor C allele at rs4149056 defines SLCO1B1*5."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166262281"
],
"citations": [
{
"pmid": "35152405",
"title": "The Clinical Pharmacogenetics Implementation Consortium Guideline for SLCO1B1, ABCG2, and CYP2C9 genotypes and Statin-Associated Musculoskeletal Symptoms.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2022,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9035072"
}
],
"guidelines": [
{
"id": "PA166262281",
"name": "Annotation of CPIC Guideline for pravastatin and SLCO1B1",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166262281",
"annotations": [
{
"implications": [
"SLCO1B1: Typical myopathy risk and statin exposure"
],
"drugRecommendation": "Prescribe desired starting dose and adjust doses based on disease-specific guidelines.",
"classification": "Strong",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "SLCO1B1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "SLCO1B1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "SLCO1B1",
"matchScore": 70,
"phenotypes": [
"Normal Function"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Function"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"SLCO1B1": "Normal Function"
},
"lookupKey": [
{
"SLCO1B1": "Normal Function"
}
]
}
]
}
]
},
"primaquine": {
"name": "primaquine",
"id": "PA451103",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "G6PD hemizygous samples",
"version": "2",
"matches": {
"gene": "G6PD",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"aminosalicylic acid",
"aspirin",
"chloramphenicol",
"chloroquine",
"ciprofloxacin",
"dapsone",
"dimercaprol",
"doxorubicin",
"furazolidone",
"glyburide",
"hydroxychloroquine",
"mafenide",
"methylene blue",
"nalidixic acid",
"nitrofurantoin",
"norfloxacin",
"ofloxacin",
"pegloticase",
"phenazopyridine",
"primaquine",
"quinine",
"rasburicase",
"sulfadiazine",
"sulfadimidine",
"sulfamethoxazole",
"trimethoprim",
"sulfanilamide",
"sulfasalazine",
"sulfisoxazole",
"tafenoquine",
"tolbutamide",
"toluidine blue",
"vitamin c",
"vitamin k"
]
},
"exception_type": "note",
"message": "PharmCAT reports based on VCF file input and some VCF files do not specify hemizygous (one X chromosome) and instead represent samples as homozygous. See PharmCAT FAQs (https://pharmcat.org/faqs/)."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166279621"
],
"citations": [
{
"pmid": "36049896",
"title": "Expanded Clinical Pharmacogenetics Implementation Consortium Guideline for Medication Use in the Context of G6PD Genotype.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2023,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10281211"
}
],
"guidelines": [
{
"id": "PA166279621",
"name": "Annotation of CPIC Guideline for primaquine and G6PD",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166279621",
"annotations": [
{
"implications": [
"G6PD: Low risk of acute hemolytic anemia"
],
"drugRecommendation": "No reason to avoid based on G6PD status",
"classification": "Strong",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "G6PD",
"name": "B (reference)",
"function": "IV/Normal",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "G6PD",
"name": "B (reference)",
"function": "IV/Normal",
"reference": true,
"activityValue": "n/a"
},
"gene": "G6PD",
"matchScore": 342,
"phenotypes": [
"Normal"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal"
],
"label": "B (reference)/B (reference)",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"B (reference)": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"G6PD": "Normal"
},
"lookupKey": [
{
"G6PD": "Normal"
}
]
}
]
}
]
},
"rasburicase": {
"name": "rasburicase",
"id": "PA10176",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "G6PD hemizygous samples",
"version": "2",
"matches": {
"gene": "G6PD",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"aminosalicylic acid",
"aspirin",
"chloramphenicol",
"chloroquine",
"ciprofloxacin",
"dapsone",
"dimercaprol",
"doxorubicin",
"furazolidone",
"glyburide",
"hydroxychloroquine",
"mafenide",
"methylene blue",
"nalidixic acid",
"nitrofurantoin",
"norfloxacin",
"ofloxacin",
"pegloticase",
"phenazopyridine",
"primaquine",
"quinine",
"rasburicase",
"sulfadiazine",
"sulfadimidine",
"sulfamethoxazole",
"trimethoprim",
"sulfanilamide",
"sulfasalazine",
"sulfisoxazole",
"tafenoquine",
"tolbutamide",
"toluidine blue",
"vitamin c",
"vitamin k"
]
},
"exception_type": "note",
"message": "PharmCAT reports based on VCF file input and some VCF files do not specify hemizygous (one X chromosome) and instead represent samples as homozygous. See PharmCAT FAQs (https://pharmcat.org/faqs/)."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166119846"
],
"citations": [
{
"pmid": "24787449",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) guidelines for rasburicase therapy in the context of G6PD deficiency genotype.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2014,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4111801"
},
{
"pmid": "36049896",
"title": "Expanded Clinical Pharmacogenetics Implementation Consortium Guideline for Medication Use in the Context of G6PD Genotype.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2023,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10281211"
}
],
"guidelines": [
{
"id": "PA166119846",
"name": "Annotation of CPIC Guideline for dapsone, methylene blue, pegloticase, rasburicase, tafenoquine, toluidine blue and G6PD",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166119846",
"annotations": [
{
"implications": [
"G6PD: Low risk of acute hemolytic anemia"
],
"drugRecommendation": "No reason to avoid based on G6PD status",
"classification": "Strong",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "G6PD",
"name": "B (reference)",
"function": "IV/Normal",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "G6PD",
"name": "B (reference)",
"function": "IV/Normal",
"reference": true,
"activityValue": "n/a"
},
"gene": "G6PD",
"matchScore": 342,
"phenotypes": [
"Normal"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal"
],
"label": "B (reference)/B (reference)",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"B (reference)": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"G6PD": "Normal"
},
"lookupKey": [
{
"G6PD": "Normal"
}
]
}
]
}
]
},
"ribavirin": {
"name": "ribavirin",
"id": "PA451241",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166110235"
],
"citations": [
{
"pmid": "24096968",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) guidelines for IFNL3 (IL28B) genotype and PEG interferon-alpha-based regimens.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2014,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3904555"
}
],
"guidelines": [
{
"id": "PA166110235",
"name": "Annotation of CPIC Guideline for peginterferon alfa-2a, peginterferon alfa-2b, ribavirin and IFNL3",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166110235",
"annotations": []
}
]
},
"ribostamycin": {
"name": "ribostamycin",
"id": "PA166292902",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166229081"
],
"citations": [
{
"pmid": "34032273",
"title": "Clinical Pharmacogenetics Implementation Consortium Guideline for the Use of Aminoglycosides Based on MT-RNR1 Genotype.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2022,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8613315"
}
],
"guidelines": [
{
"id": "PA166229081",
"name": "Annotation of CPIC Guideline for amikacin, dibekacin, gentamicin, kanamycin, neomycin, netilmicin, paromomycin, plazomicin, ribostamycin, streptomycin, tobramycin and MT-RNR1",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166229081",
"annotations": []
}
]
},
"rosuvastatin": {
"name": "rosuvastatin",
"id": "PA134308647",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "SLCO1B1-drug text",
"version": "1",
"matches": {
"gene": "SLCO1B1",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"simvastatin",
"rosuvastatin",
"pravastatin",
"pitavastatin",
"lovastatin",
"fluvastatin",
"atorvastatin"
]
},
"exception_type": "note",
"message": "The SLCO1B1 genotype (star nomenclature) will be displayed if determinable with the provided VCF based on the SLCO1B1 star allele definition published by CPIC and recommendations are provided based on the genotype.
In case no genotype can be determined, recommendations are based on the rs4149056 genotype alone as per guideline. The minor C allele at rs4149056 defines SLCO1B1*5."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166262321"
],
"citations": [
{
"pmid": "35152405",
"title": "The Clinical Pharmacogenetics Implementation Consortium Guideline for SLCO1B1, ABCG2, and CYP2C9 genotypes and Statin-Associated Musculoskeletal Symptoms.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2022,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9035072"
}
],
"guidelines": [
{
"id": "PA166262321",
"name": "Annotation of CPIC Guideline for rosuvastatin and ABCG2, SLCO1B1",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166262321",
"annotations": [
{
"implications": [
"ABCG2: Typical myopathy risk and rosuvastatin exposure",
"SLCO1B1: Typical myopathy risk and statin exposure"
],
"drugRecommendation": "Prescribe desired starting dose and adjust doses of rosuvastatin based on disease-specific and specific population guidelines.",
"classification": "Strong",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "ABCG2",
"name": "rs2231142 reference (G)",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "ABCG2",
"name": "rs2231142 reference (G)",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "ABCG2",
"matchScore": 2,
"phenotypes": [
"Normal Function"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Function"
],
"label": "rs2231142 reference (G)/rs2231142 reference (G)",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"rs2231142 reference (G)": 2.0
}
},
{
"allele1": {
"gene": "SLCO1B1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "SLCO1B1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "SLCO1B1",
"matchScore": 70,
"phenotypes": [
"Normal Function"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Function"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"ABCG2": "Normal Function",
"SLCO1B1": "Normal Function"
},
"lookupKey": [
{
"ABCG2": "Normal Function",
"SLCO1B1": "Normal Function"
}
]
}
]
}
]
},
"sertraline": {
"name": "sertraline",
"id": "PA451333",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166127639"
],
"citations": [
{
"pmid": "25974703",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for CYP2D6 and CYP2C19 Genotypes and Dosing of Selective Serotonin Reuptake Inhibitors.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2015,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4512908"
},
{
"pmid": "37032427",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for CYP2D6, CYP2C19, CYP2B6, SLC6A4, and HTR2A Genotypes and Serotonin Reuptake Inhibitor Antidepressants.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2023,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10564324"
}
],
"guidelines": [
{
"id": "PA166127639",
"name": "Annotation of CPIC Guideline for sertraline and CYP2B6, CYP2C19",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166127639",
"annotations": [
{
"implications": [
"CYP2B6: Normal metabolism of sertraline to less active compounds.",
"CYP2C19: Normal metabolism"
],
"drugRecommendation": "Initiate therapy with recommended starting dose.",
"classification": "Strong",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2B6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2B6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP2B6",
"matchScore": 96,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
},
{
"allele1": {
"gene": "CYP2C19",
"name": "*38",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*38",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 70,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*38/*38",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*38": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2B6": "Normal Metabolizer",
"CYP2C19": "Normal Metabolizer"
},
"lookupKey": [
{
"CYP2B6": "Normal Metabolizer",
"CYP2C19": "Normal Metabolizer"
}
]
}
]
}
]
},
"sevoflurane": {
"name": "sevoflurane",
"id": "PA451341",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166303941"
],
"citations": [
{
"pmid": "30499100",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for the Use of Potent Volatile Anesthetic Agents and Succinylcholine in the Context of RYR1 or CACNA1S Genotypes.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2019,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6513720"
}
],
"guidelines": [
{
"id": "PA166303941",
"name": "Annotation of CPIC Guideline for desflurane, enflurane, halothane, isoflurane, methoxyflurane, sevoflurane, succinylcholine and CACNA1S, RYR1",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166303941",
"annotations": [
{
"implications": [
"These results do not eliminate the chance that this patient is susceptible to malignant hyperthermia (MH). The genetic cause of about half of all MH survivors, with MH susceptibility confirmed by contracture test, remains unknown (PMID 28902675)."
],
"drugRecommendation": "Clinical findings, family history, further genetic testing and other laboratory data should guide use of halogenated volatile anesthetics or depolarizing muscle relaxants.",
"classification": "Strong",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CACNA1S",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CACNA1S",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CACNA1S",
"matchScore": 4,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
},
{
"allele1": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "RYR1",
"matchScore": 0,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": [
{
"allele1": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "RYR1",
"matchScore": 626,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
],
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": true,
"phenotypes": {
"CACNA1S": "Uncertain Susceptibility",
"RYR1": "Uncertain Susceptibility"
},
"lookupKey": [
{
"RYR1": "Uncertain Susceptibility",
"CACNA1S": "Uncertain Susceptibility"
}
]
}
]
}
]
},
"simvastatin": {
"name": "simvastatin",
"id": "PA451363",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "SLCO1B1-drug text",
"version": "1",
"matches": {
"gene": "SLCO1B1",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"simvastatin",
"rosuvastatin",
"pravastatin",
"pitavastatin",
"lovastatin",
"fluvastatin",
"atorvastatin"
]
},
"exception_type": "note",
"message": "The SLCO1B1 genotype (star nomenclature) will be displayed if determinable with the provided VCF based on the SLCO1B1 star allele definition published by CPIC and recommendations are provided based on the genotype.
In case no genotype can be determined, recommendations are based on the rs4149056 genotype alone as per guideline. The minor C allele at rs4149056 defines SLCO1B1*5."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166105005"
],
"citations": [
{
"pmid": "22617227",
"title": "The clinical pharmacogenomics implementation consortium: CPIC guideline for SLCO1B1 and simvastatin-induced myopathy.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2012,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3384438"
},
{
"pmid": "24918167",
"title": "The clinical pharmacogenetics implementation consortium guideline for SLCO1B1 and simvastatin-induced myopathy: 2014 update.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2014,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4169720"
},
{
"pmid": "35152405",
"title": "The Clinical Pharmacogenetics Implementation Consortium Guideline for SLCO1B1, ABCG2, and CYP2C9 genotypes and Statin-Associated Musculoskeletal Symptoms.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2022,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9035072"
}
],
"guidelines": [
{
"id": "PA166105005",
"name": "Annotation of CPIC Guideline for simvastatin and SLCO1B1",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166105005",
"annotations": [
{
"implications": [
"SLCO1B1: Typical myopathy risk and statin exposure"
],
"drugRecommendation": "Prescribe desired starting dose and adjust doses based on disease-specific guidelines.",
"classification": "Strong",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "SLCO1B1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "SLCO1B1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "SLCO1B1",
"matchScore": 70,
"phenotypes": [
"Normal Function"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Function"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"SLCO1B1": "Normal Function"
},
"lookupKey": [
{
"SLCO1B1": "Normal Function"
}
]
}
]
}
]
},
"streptomycin": {
"name": "streptomycin",
"id": "PA451512",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166229081"
],
"citations": [
{
"pmid": "34032273",
"title": "Clinical Pharmacogenetics Implementation Consortium Guideline for the Use of Aminoglycosides Based on MT-RNR1 Genotype.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2022,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8613315"
}
],
"guidelines": [
{
"id": "PA166229081",
"name": "Annotation of CPIC Guideline for amikacin, dibekacin, gentamicin, kanamycin, neomycin, netilmicin, paromomycin, plazomicin, ribostamycin, streptomycin, tobramycin and MT-RNR1",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166229081",
"annotations": []
}
]
},
"succinylcholine": {
"name": "succinylcholine",
"id": "PA451522",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166303941"
],
"citations": [
{
"pmid": "30499100",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for the Use of Potent Volatile Anesthetic Agents and Succinylcholine in the Context of RYR1 or CACNA1S Genotypes.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2019,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6513720"
}
],
"guidelines": [
{
"id": "PA166303941",
"name": "Annotation of CPIC Guideline for desflurane, enflurane, halothane, isoflurane, methoxyflurane, sevoflurane, succinylcholine and CACNA1S, RYR1",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166303941",
"annotations": [
{
"implications": [
"These results do not eliminate the chance that this patient is susceptible to malignant hyperthermia (MH). The genetic cause of about half of all MH survivors, with MH susceptibility confirmed by contracture test, remains unknown (PMID 28902675)."
],
"drugRecommendation": "Clinical findings, family history, further genetic testing and other laboratory data should guide use of halogenated volatile anesthetics or depolarizing muscle relaxants.",
"classification": "Strong",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CACNA1S",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CACNA1S",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CACNA1S",
"matchScore": 4,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
},
{
"allele1": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "RYR1",
"matchScore": 0,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": [
{
"allele1": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "RYR1",
"matchScore": 626,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
],
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": true,
"phenotypes": {
"CACNA1S": "Uncertain Susceptibility",
"RYR1": "Uncertain Susceptibility"
},
"lookupKey": [
{
"RYR1": "Uncertain Susceptibility",
"CACNA1S": "Uncertain Susceptibility"
}
]
}
]
}
]
},
"tacrolimus": {
"name": "tacrolimus",
"id": "PA451578",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166124619"
],
"citations": [
{
"pmid": "25801146",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guidelines for CYP3A5 Genotype and Tacrolimus Dosing.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2015,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4481158"
}
],
"guidelines": [
{
"id": "PA166124619",
"name": "Annotation of CPIC Guideline for tacrolimus and CYP3A5",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166124619",
"annotations": [
{
"implications": [
"CYP3A5: Lower dose-adjusted trough concentrations of tacrolimus and decreased chance of achieving target tacrolimus concentrations."
],
"drugRecommendation": "Increase starting dose 1.5 to 2 times recommended starting dose. Total starting dose should not exceed 0.3 mg/kg/day. Use therapeutic drug monitoring to guide dose adjustments.",
"classification": "Strong",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP3A5",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP3A5",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP3A5",
"matchScore": 10,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP3A5": "Normal Metabolizer"
},
"lookupKey": [
{
"CYP3A5": "Normal Metabolizer"
}
]
}
]
}
]
},
"tafenoquine": {
"name": "tafenoquine",
"id": "PA166115580",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "G6PD hemizygous samples",
"version": "2",
"matches": {
"gene": "G6PD",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"aminosalicylic acid",
"aspirin",
"chloramphenicol",
"chloroquine",
"ciprofloxacin",
"dapsone",
"dimercaprol",
"doxorubicin",
"furazolidone",
"glyburide",
"hydroxychloroquine",
"mafenide",
"methylene blue",
"nalidixic acid",
"nitrofurantoin",
"norfloxacin",
"ofloxacin",
"pegloticase",
"phenazopyridine",
"primaquine",
"quinine",
"rasburicase",
"sulfadiazine",
"sulfadimidine",
"sulfamethoxazole",
"trimethoprim",
"sulfanilamide",
"sulfasalazine",
"sulfisoxazole",
"tafenoquine",
"tolbutamide",
"toluidine blue",
"vitamin c",
"vitamin k"
]
},
"exception_type": "note",
"message": "PharmCAT reports based on VCF file input and some VCF files do not specify hemizygous (one X chromosome) and instead represent samples as homozygous. See PharmCAT FAQs (https://pharmcat.org/faqs/)."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166119846"
],
"citations": [
{
"pmid": "24787449",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) guidelines for rasburicase therapy in the context of G6PD deficiency genotype.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2014,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4111801"
},
{
"pmid": "36049896",
"title": "Expanded Clinical Pharmacogenetics Implementation Consortium Guideline for Medication Use in the Context of G6PD Genotype.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2023,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10281211"
}
],
"guidelines": [
{
"id": "PA166119846",
"name": "Annotation of CPIC Guideline for dapsone, methylene blue, pegloticase, rasburicase, tafenoquine, toluidine blue and G6PD",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166119846",
"annotations": [
{
"implications": [
"G6PD: Low risk of acute hemolytic anemia"
],
"drugRecommendation": "No reason to avoid based on G6PD status",
"classification": "Strong",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "G6PD",
"name": "B (reference)",
"function": "IV/Normal",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "G6PD",
"name": "B (reference)",
"function": "IV/Normal",
"reference": true,
"activityValue": "n/a"
},
"gene": "G6PD",
"matchScore": 342,
"phenotypes": [
"Normal"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal"
],
"label": "B (reference)/B (reference)",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"B (reference)": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"G6PD": "Normal"
},
"lookupKey": [
{
"G6PD": "Normal"
}
]
}
]
}
]
},
"tamoxifen": {
"name": "tamoxifen",
"id": "PA451581",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166176068"
],
"citations": [
{
"pmid": "29385237",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for CYP2D6 and Tamoxifen Therapy.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2018,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5931215"
}
],
"guidelines": [
{
"id": "PA166176068",
"name": "Annotation of CPIC Guideline for tamoxifen and CYP2D6",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166176068",
"annotations": [
{
"implications": [
"CYP2D6: Lower endoxifen concentrations compared to normal metabolizers; higher risk of breast cancer recurrence, event-free and recurrence-free survival compared to normal metabolizers."
],
"drugRecommendation": "Consider hormonal therapy such as an aromatase inhibitor for postmenopausal women or aromatase inhibitor along with ovarian function suppression in premenopausal women, given that these approaches are superior to tamoxifen regardless of CYP2D6 genotype (PMID 26211827). If aromatase inhibitor use is contraindicated, consideration should be given to use a higher but FDA approved tamoxifen dose (40 mg/day)(PMID 27226358). Avoid CYP2D6 strong to weak inhibitors.",
"classification": "Optional",
"activityScore": {
"CYP2D6": "1.0"
},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2D6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2D6",
"name": "*3",
"function": "No function",
"reference": false,
"activityValue": "0.0"
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "1.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"1.0"
],
"label": "*1/*3",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": true,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2D6": "Intermediate Metabolizer"
},
"lookupKey": [
{
"CYP2D6": "1.0"
}
]
}
]
}
]
},
"tenoxicam": {
"name": "tenoxicam",
"id": "PA131890625",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166192341"
],
"citations": [
{
"pmid": "32189324",
"title": "Clinical Pharmacogenetics Implementation Consortium Guideline (CPIC) for CYP2C9 and Nonsteroidal Anti-Inflammatory Drugs.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2020,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8080882"
}
],
"guidelines": [
{
"id": "PA166192341",
"name": "Annotation of CPIC Guideline for tenoxicam and CYP2C9",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166192341",
"annotations": [
{
"implications": [
"CYP2C9: Normal metabolism"
],
"drugRecommendation": "Initiate therapy with recommended starting dose. In accordance with the prescribing information, use the lowest effective dosage for shortest duration consistent with individual patient treatment goals.",
"classification": "Strong",
"activityScore": {
"CYP2C9": "2.0"
},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "CYP2C9",
"matchScore": 166,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C9": "Normal Metabolizer"
},
"lookupKey": [
{
"CYP2C9": "2.0"
}
]
}
]
}
]
},
"thioguanine": {
"name": "thioguanine",
"id": "PA451663",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104965"
],
"citations": [
{
"pmid": "21270794",
"title": "Clinical Pharmacogenetics Implementation Consortium guidelines for thiopurine methyltransferase genotype and thiopurine dosing.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3098761"
},
{
"pmid": "23422873",
"title": "Clinical pharmacogenetics implementation consortium guidelines for thiopurine methyltransferase genotype and thiopurine dosing: 2013 update.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2013,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3604643"
},
{
"pmid": "30447069",
"title": "Clinical Pharmacogenetics Implementation Consortium Guideline for Thiopurine Dosing Based on TPMT and NUDT15 Genotypes: 2018 Update.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2019,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6576267"
},
{
"pmid": "41618934",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for Thiopurine Dosing Based on TPMT and NUDT15 Genotypes: 2025 Update.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2026,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/41618934"
}
],
"guidelines": [
{
"id": "PA166104965",
"name": "Annotation of CPIC Guideline for thioguanine and NUDT15, TPMT",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104965",
"annotations": [
{
"implications": [
"Normal risk of thiopurine-related leukopenia, neutropenia and myelosuppression.",
"TPMT NMs have lower erythrocyte concentrations of TGN metabolites compared to TPMT IMs and TPMT PMs. This is the 'normal' pattern."
],
"drugRecommendation": "Initiate therapy with standard starting dose of thioguanine (e.g., 40 mg/m2/day for malignancy). During therapy, adjust the doses of myelosuppressive agents, as per standard clinical practice. It usually takes at least 2 weeks of stable dosing to reach steady state after each dose adjustment.",
"classification": "Strong",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "NUDT15",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "NUDT15",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "NUDT15",
"matchScore": 36,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
},
{
"allele1": {
"gene": "TPMT",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "TPMT",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "TPMT",
"matchScore": 90,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"NUDT15": "Normal Metabolizer",
"TPMT": "Normal Metabolizer"
},
"lookupKey": [
{
"TPMT": "Normal Metabolizer",
"NUDT15": "Normal Metabolizer"
}
]
}
]
}
]
},
"tobramycin": {
"name": "tobramycin",
"id": "PA451704",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166229081"
],
"citations": [
{
"pmid": "34032273",
"title": "Clinical Pharmacogenetics Implementation Consortium Guideline for the Use of Aminoglycosides Based on MT-RNR1 Genotype.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2022,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8613315"
}
],
"guidelines": [
{
"id": "PA166229081",
"name": "Annotation of CPIC Guideline for amikacin, dibekacin, gentamicin, kanamycin, neomycin, netilmicin, paromomycin, plazomicin, ribostamycin, streptomycin, tobramycin and MT-RNR1",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166229081",
"annotations": []
}
]
},
"toluidine blue": {
"name": "toluidine blue",
"id": "PA166268821",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "G6PD hemizygous samples",
"version": "2",
"matches": {
"gene": "G6PD",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"aminosalicylic acid",
"aspirin",
"chloramphenicol",
"chloroquine",
"ciprofloxacin",
"dapsone",
"dimercaprol",
"doxorubicin",
"furazolidone",
"glyburide",
"hydroxychloroquine",
"mafenide",
"methylene blue",
"nalidixic acid",
"nitrofurantoin",
"norfloxacin",
"ofloxacin",
"pegloticase",
"phenazopyridine",
"primaquine",
"quinine",
"rasburicase",
"sulfadiazine",
"sulfadimidine",
"sulfamethoxazole",
"trimethoprim",
"sulfanilamide",
"sulfasalazine",
"sulfisoxazole",
"tafenoquine",
"tolbutamide",
"toluidine blue",
"vitamin c",
"vitamin k"
]
},
"exception_type": "note",
"message": "PharmCAT reports based on VCF file input and some VCF files do not specify hemizygous (one X chromosome) and instead represent samples as homozygous. See PharmCAT FAQs (https://pharmcat.org/faqs/)."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166119846"
],
"citations": [
{
"pmid": "24787449",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) guidelines for rasburicase therapy in the context of G6PD deficiency genotype.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2014,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4111801"
},
{
"pmid": "36049896",
"title": "Expanded Clinical Pharmacogenetics Implementation Consortium Guideline for Medication Use in the Context of G6PD Genotype.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2023,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10281211"
}
],
"guidelines": [
{
"id": "PA166119846",
"name": "Annotation of CPIC Guideline for dapsone, methylene blue, pegloticase, rasburicase, tafenoquine, toluidine blue and G6PD",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166119846",
"annotations": [
{
"implications": [
"G6PD: Low risk of acute hemolytic anemia"
],
"drugRecommendation": "No reason to avoid based on G6PD status",
"classification": "Strong",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "G6PD",
"name": "B (reference)",
"function": "IV/Normal",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "G6PD",
"name": "B (reference)",
"function": "IV/Normal",
"reference": true,
"activityValue": "n/a"
},
"gene": "G6PD",
"matchScore": 342,
"phenotypes": [
"Normal"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal"
],
"label": "B (reference)/B (reference)",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"B (reference)": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"G6PD": "Normal"
},
"lookupKey": [
{
"G6PD": "Normal"
}
]
}
]
}
]
},
"tramadol": {
"name": "tramadol",
"id": "PA451735",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166228101"
],
"citations": [
{
"pmid": "33387367",
"title": "Clinical Pharmacogenetics Implementation Consortium Guideline for CYP2D6, OPRM1, and COMT Genotypes and Select Opioid Therapy.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2021,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8249478"
}
],
"guidelines": [
{
"id": "PA166228101",
"name": "Annotation of CPIC Guideline for tramadol and CYP2D6",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166228101",
"annotations": [
{
"implications": [
"CYP2D6: Reduced O-desmethyltramadol (active metabolite) formation"
],
"drugRecommendation": "Use tramadol label recommended age- or weight-specific dosing. If no response and opioid use is warranted, consider non-codeine opioid.",
"classification": "Optional",
"activityScore": {
"CYP2D6": "1.0"
},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2D6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2D6",
"name": "*3",
"function": "No function",
"reference": false,
"activityValue": "0.0"
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "1.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"1.0"
],
"label": "*1/*3",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": true,
"phenotypes": {
"CYP2D6": "Intermediate Metabolizer"
},
"lookupKey": [
{
"CYP2D6": "1.0"
}
]
}
]
}
]
},
"trimipramine": {
"name": "trimipramine",
"id": "PA451791",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166105001"
],
"citations": [
{
"pmid": "23486447",
"title": "Clinical Pharmacogenetics Implementation Consortium guideline for CYP2D6 and CYP2C19 genotypes and dosing of tricyclic antidepressants.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2013,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3689226"
},
{
"pmid": "27997040",
"title": "Clinical pharmacogenetics implementation consortium guideline (CPIC) for CYP2D6 and CYP2C19 genotypes and dosing of tricyclic antidepressants: 2016 update.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2017,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5478479"
}
],
"guidelines": [
{
"id": "PA166105001",
"name": "Annotation of CPIC Guideline for trimipramine and CYP2C19, CYP2D6",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166105001",
"annotations": [
{
"implications": [
"CYP2C19: Normal metabolism of tertiary amines",
"CYP2D6: Reduced metabolism of TCAs to less active compounds compared to normal metabolizers; Higher plasma concentrations of active drug will increase the probability of side effects"
],
"drugRecommendation": "Consider a 25% reduction of recommended starting dose. Utilize therapeutic drug monitoring to guide dose adjustments.",
"classification": "Optional",
"activityScore": {
"CYP2C19": "n/a",
"CYP2D6": "1.0"
},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*38",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*38",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 70,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*38/*38",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*38": 2.0
}
},
{
"allele1": {
"gene": "CYP2D6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2D6",
"name": "*3",
"function": "No function",
"reference": false,
"activityValue": "0.0"
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "1.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"1.0"
],
"label": "*1/*3",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Normal Metabolizer",
"CYP2D6": "Intermediate Metabolizer"
},
"lookupKey": [
{
"CYP2D6": "1.0",
"CYP2C19": "Normal Metabolizer"
}
]
}
]
}
]
},
"tropisetron": {
"name": "tropisetron",
"id": "PA161925594",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166161955"
],
"citations": [
{
"pmid": "28002639",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) guideline for CYP2D6 genotype and use of ondansetron and tropisetron.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2017,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5479760"
}
],
"guidelines": [
{
"id": "PA166161955",
"name": "Annotation of CPIC Guideline for tropisetron and CYP2D6",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166161955",
"annotations": [
{
"implications": [
"CYP2D6: Very limited data available for CYP2D6 intermediate metabolizers"
],
"drugRecommendation": "Insufficient evidence demonstrating clinical impact based on CYP2D6 genotype. Initiate therapy with recommended starting dose.",
"classification": "No recommendation",
"activityScore": {
"CYP2D6": "1.0"
},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2D6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2D6",
"name": "*3",
"function": "No function",
"reference": false,
"activityValue": "0.0"
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "1.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"1.0"
],
"label": "*1/*3",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2D6": "Intermediate Metabolizer"
},
"lookupKey": [
{
"CYP2D6": "1.0"
}
]
}
]
}
]
},
"venlafaxine": {
"name": "venlafaxine",
"id": "PA451866",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166288201"
],
"citations": [
{
"pmid": "37032427",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for CYP2D6, CYP2C19, CYP2B6, SLC6A4, and HTR2A Genotypes and Serotonin Reuptake Inhibitor Antidepressants.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2023,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10564324"
}
],
"guidelines": [
{
"id": "PA166288201",
"name": "Annotation of CPIC Guideline for venlafaxine and CYP2D6",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166288201",
"annotations": [
{
"implications": [
"CYP2D6: Decreased metabolism of venlafaxine to active metabolite O-desmethylvenlafaxine (desvenlafaxine) and decreased O-desmethylvenlafaxine:venlafaxine ratio as compared to normal metabolizers. There is insufficient evidence supporting the clinical impact of the decreased O-desmethylvenlafaxine:venlafaxine ratio in CYP2D6 intermediate metabolizers."
],
"drugRecommendation": "No action recommended based on genotype for venlafaxine because of minimal evidence regarding the impact on efficacy or side effects.",
"classification": "No recommendation",
"activityScore": {
"CYP2D6": "1.0"
},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2D6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2D6",
"name": "*3",
"function": "No function",
"reference": false,
"activityValue": "0.0"
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "1.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"1.0"
],
"label": "*1/*3",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2D6": "Intermediate Metabolizer"
},
"lookupKey": [
{
"CYP2D6": "1.0"
}
]
}
]
}
]
},
"voriconazole": {
"name": "voriconazole",
"id": "PA10233",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166161537"
],
"citations": [
{
"pmid": "27981572",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guidelines for CYP2C19 and Voriconazole Therapy.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2017,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5474211"
}
],
"guidelines": [
{
"id": "PA166161537",
"name": "Annotation of CPIC Guideline for voriconazole and CYP2C19",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166161537",
"annotations": [
{
"implications": [
"CYP2C19: Normal voriconazole metabolism"
],
"drugRecommendation": "Initiate therapy with recommended standard of care dosing",
"classification": "Strong",
"activityScore": {},
"population": "adults",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*38",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*38",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 70,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*38/*38",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*38": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Normal Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Normal Metabolizer"
}
]
},
{
"implications": [
"CYP2C19: Normal voriconazole metabolism"
],
"drugRecommendation": "Initiate therapy with recommended standard of care dosing",
"classification": "Strong",
"activityScore": {},
"population": "pediatrics",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*38",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*38",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 70,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*38/*38",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*38": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Normal Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Normal Metabolizer"
}
]
}
]
}
]
},
"vortioxetine": {
"name": "vortioxetine",
"id": "PA166122595",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166288221"
],
"citations": [
{
"pmid": "37032427",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for CYP2D6, CYP2C19, CYP2B6, SLC6A4, and HTR2A Genotypes and Serotonin Reuptake Inhibitor Antidepressants.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2023,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10564324"
}
],
"guidelines": [
{
"id": "PA166288221",
"name": "Annotation of CPIC Guideline for vortioxetine and CYP2D6",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166288221",
"annotations": [
{
"implications": [
"CYP2D6: Reduced metabolism of vortioxetine to less active compounds when compared to CYP2D6 normal metabolizers. Higher plasma concentrations may increase the probability of side effects."
],
"drugRecommendation": "Initiate therapy with recommended starting dose.",
"classification": "Moderate",
"activityScore": {
"CYP2D6": "1.0"
},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2D6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2D6",
"name": "*3",
"function": "No function",
"reference": false,
"activityValue": "0.0"
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "1.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"1.0"
],
"label": "*1/*3",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2D6": "Intermediate Metabolizer"
},
"lookupKey": [
{
"CYP2D6": "1.0"
}
]
}
]
}
]
},
"warfarin": {
"name": "warfarin",
"id": "PA451906",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "pcat-cpic-warfarin-1-flowchart",
"version": "1",
"matches": {
"gene": null,
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"warfarin"
]
},
"exception_type": "note",
"message": "Please follow the flow chart in figure 2 of the CPIC warfarin guideline to determine the appropriate dosing recommendation."
},
{
"rule_name": "pcat-cpic-warfarin-2-vkorc1",
"version": "1",
"matches": {
"gene": null,
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"warfarin"
]
},
"exception_type": "note",
"message": "The CPIC warfarin guideline only considers a single SNV in VKORC1 (rs9923231), which has varying frequency among different ancestral populations, and largely explains the differences in average dose requirements between people of European, African, and Asian descents. While other functional variants in VKORC1 have been associated with warfarin resistance (high dose requirements), there are currently no CPIC recommendations for how to use these other variants in warfarin dosing. An alternate name for rs9923231 is -1639G>A (note that VKORC1 is on the negative chromosomal strand, so displayed alleles are complemented). "
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104949"
],
"citations": [
{
"pmid": "21900891",
"title": "Clinical Pharmacogenetics Implementation Consortium Guidelines for CYP2C9 and VKORC1 genotypes and warfarin dosing.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3187550"
},
{
"pmid": "28198005",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for Pharmacogenetics-Guided Warfarin Dosing: 2017 Update.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2017,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5546947"
}
],
"guidelines": [
{
"id": "PA166104949",
"name": "Annotation of CPIC Guideline for warfarin and CYP2C9, CYP4F2, VKORC1",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104949",
"annotations": [
{
"implications": [],
"drugRecommendation": null,
"classification": null,
"activityScore": {},
"population": "n/a",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "CYP2C9",
"matchScore": 166,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
},
{
"allele1": {
"gene": "CYP4F2",
"name": "*1",
"function": null,
"reference": true,
"activityValue": null
},
"allele2": {
"gene": "CYP4F2",
"name": "*1",
"function": null,
"reference": true,
"activityValue": null
},
"gene": "CYP4F2",
"matchScore": 40,
"phenotypes": [],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
},
{
"allele1": {
"gene": "VKORC1",
"name": "rs9923231 reference (C)",
"function": "Normal coumarin sensitivity",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "VKORC1",
"name": "rs9923231 reference (C)",
"function": "Normal coumarin sensitivity",
"reference": true,
"activityValue": "n/a"
},
"gene": "VKORC1",
"matchScore": 2,
"phenotypes": [
"-1639 GG"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"-1639 GG"
],
"label": "rs9923231 reference (C)/rs9923231 reference (C)",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"rs9923231 reference (C)": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [
"rs12777823:G/G"
],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {},
"lookupKey": []
}
]
}
]
}
},
"DPWG Guideline Annotation": {
"abacavir": {
"name": "abacavir",
"id": "PA448004",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104991"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
}
],
"guidelines": [
{
"id": "PA166104991",
"name": "Annotation of DPWG Guideline for abacavir and HLA-B",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104991",
"annotations": [
{
"implications": [
"HLA-B*57:01-positive patients have a strongly increased risk of a hypersensitivity reaction to abacavir. 48% of the HLA-B*57:01-positive patients develop a severe and potentially life-threatening hypersensitivity reaction to abacavir"
],
"drugRecommendation": "Abacavir is contra-indicated for HLA-B*57:01-positive patients.\n\n- Avoid abacavir.
\n
",
"classification": "Unspecified",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "HLA-B",
"name": "*15:02",
"function": null,
"reference": false,
"activityValue": null
},
"allele2": {
"gene": "HLA-B",
"name": "*57:01",
"function": null,
"reference": false,
"activityValue": null
},
"gene": "HLA-B",
"matchScore": 0,
"phenotypes": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"label": "*15:02/*57:01",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": true,
"otherPrescribingGuidance": false,
"phenotypes": {
"HLA-B": "*57:01 positive"
},
"lookupKey": [
{
"HLA-B": "*57:01 positive"
}
]
}
]
}
]
},
"acenocoumarol": {
"name": "acenocoumarol",
"id": "PA452632",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104938"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
}
],
"guidelines": [
{
"id": "PA166104938",
"name": "Annotation of DPWG Guideline for acenocoumarol and VKORC1",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104938",
"annotations": [
{
"implications": [
"The guideline does not provide a description of the impact of the -1639 GG genotype on acenocoumarol."
],
"drugRecommendation": "The guideline does not provide a recommendation for acenocoumarol in patients with the VKORC1 rs9923231 CC genotype (-1639 GG genotype).",
"classification": "No recommendation",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "VKORC1",
"name": "rs9923231 reference (C)",
"function": "Normal coumarin sensitivity",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "VKORC1",
"name": "rs9923231 reference (C)",
"function": "Normal coumarin sensitivity",
"reference": true,
"activityValue": "n/a"
},
"gene": "VKORC1",
"matchScore": 2,
"phenotypes": [
"-1639 GG"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"-1639 GG"
],
"label": "rs9923231 reference (C)/rs9923231 reference (C)",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"rs9923231 reference (C)": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"VKORC1": "-1639 GG"
},
"lookupKey": [
{
"VKORC1": {
"rs9923231 reference (C)": 2.0
}
}
]
}
]
}
]
},
"allopurinol": {
"name": "allopurinol",
"id": "PA448320",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166264961",
"https://www.clinpgx.org/guidelineAnnotation/PA166265141"
],
"citations": [
{
"pmid": "36056234",
"title": "Dutch pharmacogenetics working group guideline for the gene-drug interaction of ABCG2, HLA-B and Allopurinol, and MTHFR, folic acid and methotrexate.",
"journal": "European journal of human genetics : EJHG",
"year": 2024,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10853275"
}
],
"guidelines": [
{
"id": "PA166264961",
"name": "Annotation of DPWG Guideline for allopurinol and ABCG2",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166264961",
"annotations": [
{
"implications": [
"The guideline does not provide a description of the impact of the ABCG2 rs2231142 GG genotype (c.421CC; p.141QQ) on allopurinol."
],
"drugRecommendation": "The guideline does not provide a recommendation for allopurinol in patients with the the ABCG2 rs2231142 GG genotype (c.421CC; p.141QQ)",
"classification": "No recommendation",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "ABCG2",
"name": "rs2231142 reference (G)",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "ABCG2",
"name": "rs2231142 reference (G)",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "ABCG2",
"matchScore": 2,
"phenotypes": [
"Normal Function"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Function"
],
"label": "rs2231142 reference (G)/rs2231142 reference (G)",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"rs2231142 reference (G)": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"ABCG2": "Normal Function"
},
"lookupKey": [
{
"ABCG2": "Normal Function"
}
]
}
]
},
{
"id": "PA166265141",
"name": "Annotation of DPWG Guideline for allopurinol and HLA-B",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166265141",
"annotations": []
}
]
},
"amitriptyline": {
"name": "amitriptyline",
"id": "PA448385",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104982"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
},
{
"pmid": "41526670",
"title": "Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction between CYP2D6 and CYP2C19 and tricyclic antidepressants.",
"journal": "European journal of human genetics : EJHG",
"year": 2026,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/41526670"
}
],
"guidelines": [
{
"id": "PA166104982",
"name": "Annotation of DPWG Guideline for amitriptyline and CYP2D6",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104982",
"annotations": [
{
"implications": [
"The risk of side effects is increased, because the gene variation leads to higher plasma concentrations of the active metabolite nortriptyline and to a lesser extent of amitriptyline."
],
"drugRecommendation": "Use 75% of the standard dose and monitor the efficacy and side effects or the plasma concentrations of\namitriptyline and nortriptyline in order to set the maintenance dose",
"classification": "Unspecified",
"activityScore": {
"CYP2D6": "1.0"
},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2D6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2D6",
"name": "*3",
"function": "No function",
"reference": false,
"activityValue": "0.0"
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "1.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"1.0"
],
"label": "*1/*3",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": true,
"phenotypes": {
"CYP2D6": "Intermediate Metabolizer"
},
"lookupKey": [
{
"CYP2D6": "1.0"
}
]
}
]
}
]
},
"aripiprazole": {
"name": "aripiprazole",
"id": "PA10026",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104937"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
},
{
"pmid": "37002327",
"title": "Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction between CYP2D6, CYP3A4 and CYP1A2 and antipsychotics.",
"journal": "European journal of human genetics : EJHG",
"year": 2024,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10923774"
}
],
"guidelines": [
{
"id": "PA166104937",
"name": "Annotation of DPWG Guideline for aripiprazole and CYP2D6",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104937",
"annotations": [
{
"implications": [
"The genetic variation increases the plasma concentration of the sum of aripiprazole and the active metabolite dehydroaripiprazole to a limited degree. There is insufficient evidence that this increases the risk of side effects."
],
"drugRecommendation": "NO action is needed for this gene-drug interaction.",
"classification": "Unspecified",
"activityScore": {
"CYP2D6": "1.0"
},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2D6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2D6",
"name": "*3",
"function": "No function",
"reference": false,
"activityValue": "0.0"
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "1.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"1.0"
],
"label": "*1/*3",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2D6": "Intermediate Metabolizer"
},
"lookupKey": [
{
"CYP2D6": "1.0"
}
]
}
]
}
]
},
"atazanavir": {
"name": "atazanavir",
"id": "PA10251",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166411701"
],
"citations": [],
"guidelines": [
{
"id": "PA166411701",
"name": "Annotation of DPWG Guideline for atazanavir and UGT1A1",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166411701",
"annotations": [
{
"implications": [
"The guideline does not provide a description of the impact of a normal metabolizer phenotype on atazanavir."
],
"drugRecommendation": "The guideline does not provide a recommendation for atazanavir in normal metabolizers",
"classification": "No recommendation",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "UGT1A1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "UGT1A1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "UGT1A1",
"matchScore": 8,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"UGT1A1": "Normal Metabolizer"
},
"lookupKey": [
{
"UGT1A1": "Normal Metabolizer"
}
]
}
]
}
]
},
"atomoxetine": {
"name": "atomoxetine",
"id": "PA134688071",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104989"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
},
{
"pmid": "36509836",
"title": "Dutch pharmacogenetics working group (DPWG) guideline for the gene-drug interaction of CYP2D6 and COMT with atomoxetine and methylphenidate.",
"journal": "European journal of human genetics : EJHG",
"year": 2023,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10689464"
}
],
"guidelines": [
{
"id": "PA166104989",
"name": "Annotation of DPWG Guideline for atomoxetine and CYP2D6",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104989",
"annotations": [
{
"implications": [
"The dose requirement can be reduced, because the genetic variation results in a higher atomoxetine plasma concentration."
],
"drugRecommendation": "In the event of side effects occurring and/or a response later than 9 weeks: reduce the dose and check whether the effect is conserved The plasma concentration of atomoxetine is a factor of 2-3 times higher for IM than for NM at the same dose.",
"classification": "Unspecified",
"activityScore": {
"CYP2D6": "1.0"
},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2D6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2D6",
"name": "*3",
"function": "No function",
"reference": false,
"activityValue": "0.0"
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "1.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"1.0"
],
"label": "*1/*3",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2D6": "Intermediate Metabolizer"
},
"lookupKey": [
{
"CYP2D6": "1.0"
}
]
}
]
}
]
},
"atorvastatin": {
"name": "atorvastatin",
"id": "PA448500",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "SLCO1B1-drug text",
"version": "1",
"matches": {
"gene": "SLCO1B1",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"simvastatin",
"rosuvastatin",
"pravastatin",
"pitavastatin",
"lovastatin",
"fluvastatin",
"atorvastatin"
]
},
"exception_type": "note",
"message": "The SLCO1B1 genotype (star nomenclature) will be displayed if determinable with the provided VCF based on the SLCO1B1 star allele definition published by CPIC and recommendations are provided based on the genotype.
In case no genotype can be determined, recommendations are based on the rs4149056 genotype alone as per guideline. The minor C allele at rs4149056 defines SLCO1B1*5."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166182843"
],
"citations": [
{
"pmid": "39676086",
"title": "Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction between SLCO1B1 and statins and CYP2C9 and sulfonylureas.",
"journal": "European journal of human genetics : EJHG",
"year": 2024,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/39676086"
}
],
"guidelines": [
{
"id": "PA166182843",
"name": "Annotation of DPWG Guideline for atorvastatin and SLCO1B1",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166182843",
"annotations": [
{
"implications": [
"The guideline does not provide a description of the impact of the normal function phenotype on atorvastatin."
],
"drugRecommendation": "The guideline does not provide a recommendation for atorvastatin in patients with normal function.",
"classification": "No recommendation",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "SLCO1B1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "SLCO1B1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "SLCO1B1",
"matchScore": 70,
"phenotypes": [
"Normal Function"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Function"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"SLCO1B1": "Normal Function"
},
"lookupKey": [
{
"SLCO1B1": "Normal Function"
}
]
}
]
}
]
},
"azathioprine": {
"name": "azathioprine",
"id": "PA448515",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166184614",
"https://www.clinpgx.org/guidelineAnnotation/PA166104934"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
},
{
"pmid": "41318725",
"title": "Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction between TPMT/NUDT15 and thiopurines.",
"journal": "European journal of human genetics : EJHG",
"year": 2025,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/41318725"
}
],
"guidelines": [
{
"id": "PA166184614",
"name": "Annotation of DPWG Guideline for azathioprine and NUDT15",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166184614",
"annotations": [
{
"implications": [
"The guideline does not provide a description of the impact of a normal metabolizer phenotype on azathioprine."
],
"drugRecommendation": "The guideline does not provide a recommendation for azathioprine in normal metabolizers",
"classification": "No recommendation",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "NUDT15",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "NUDT15",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "NUDT15",
"matchScore": 36,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"NUDT15": "Normal Metabolizer"
},
"lookupKey": [
{
"NUDT15": "Normal Metabolizer"
}
]
}
]
},
{
"id": "PA166104934",
"name": "Annotation of DPWG Guideline for azathioprine and TPMT",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104934",
"annotations": [
{
"implications": [
"The guideline does not provide a description of the impact of a normal metabolizer phenotype on azathioprine."
],
"drugRecommendation": "The guideline does not provide a recommendation for azathioprine in normal metabolizers.",
"classification": "No recommendation",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "TPMT",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "TPMT",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "TPMT",
"matchScore": 90,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"TPMT": "Normal Metabolizer"
},
"lookupKey": [
{
"TPMT": "Normal Metabolizer"
}
]
}
]
}
]
},
"brexpiprazole": {
"name": "brexpiprazole",
"id": "PA166160053",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166184527"
],
"citations": [
{
"pmid": "37002327",
"title": "Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction between CYP2D6, CYP3A4 and CYP1A2 and antipsychotics.",
"journal": "European journal of human genetics : EJHG",
"year": 2024,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10923774"
}
],
"guidelines": [
{
"id": "PA166184527",
"name": "Annotation of DPWG Guideline for brexpiprazole and CYP2D6",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166184527",
"annotations": [
{
"implications": [
"There are indications supporting an increase in the exposure to brexpiprazole, but no indications supporting an increase in side effects in patients with this gene variation."
],
"drugRecommendation": "NO action is required for this gene-drug interaction.",
"classification": "Unspecified",
"activityScore": {
"CYP2D6": "1.0"
},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2D6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2D6",
"name": "*3",
"function": "No function",
"reference": false,
"activityValue": "0.0"
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "1.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"1.0"
],
"label": "*1/*3",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2D6": "Intermediate Metabolizer"
},
"lookupKey": [
{
"CYP2D6": "1.0"
}
]
}
]
}
]
},
"capecitabine": {
"name": "capecitabine",
"id": "PA448771",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104963"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
},
{
"pmid": "31745289",
"title": "Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction of DPYD and fluoropyrimidines.",
"journal": "European journal of human genetics : EJHG",
"year": 2020,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7080718"
}
],
"guidelines": [
{
"id": "PA166104963",
"name": "Annotation of DPWG Guideline for capecitabine and DPYD",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104963",
"annotations": [
{
"implications": [
"The guideline does not provide a description of the impact of a DPYD activity score of 2 on capecitabine."
],
"drugRecommendation": "The guideline does not provide a recommendation for capecitabine in patients with a DPYD activity score of 2.",
"classification": "No recommendation",
"activityScore": {
"DPYD": "2.0"
},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "DPYD",
"matchScore": 0,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": [
{
"allele1": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "DPYD",
"matchScore": 166,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
],
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"DPYD": "Normal Metabolizer"
},
"lookupKey": [
{
"DPYD": "2.0"
}
]
}
]
}
]
},
"carbamazepine": {
"name": "carbamazepine",
"id": "PA448785",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166265161",
"https://www.clinpgx.org/guidelineAnnotation/PA166265162"
],
"citations": [
{
"pmid": "38570725",
"title": "Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction of CYP2C9, HLA-A and HLA-B with anti-epileptic drugs.",
"journal": "European journal of human genetics : EJHG",
"year": 2024,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC11291682"
}
],
"guidelines": [
{
"id": "PA166265161",
"name": "Annotation of DPWG Guideline for carbamazepine and HLA-A",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166265161",
"annotations": []
},
{
"id": "PA166265162",
"name": "Annotation of DPWG Guideline for carbamazepine and HLA-B",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166265162",
"annotations": [
{
"implications": [
"The risk of carbamazepine-induced SJS/TEN is strongly increased the first three months in patients with the HLA-B*15:02 allele. The risk of carbamazepine-induced SJS/TEN in these patients is 1.8-7.7%."
],
"drugRecommendation": "\n- Avoid carbamazepine.\nPhenytoin, lamotrigine and oxcarbazepine also pose an increased risk of SJS/TEN in these patients, but the final risk is 5-10-fold lower for these medicines than for carbamazepine. Furthermore, in the case of oxcarbazepine, the most severe forms (SJS/TEN overlap and TEN) have not been observed.
\n
",
"classification": "Unspecified",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "HLA-B",
"name": "*15:02",
"function": null,
"reference": false,
"activityValue": null
},
"allele2": {
"gene": "HLA-B",
"name": "*57:01",
"function": null,
"reference": false,
"activityValue": null
},
"gene": "HLA-B",
"matchScore": 0,
"phenotypes": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"label": "*15:02/*57:01",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": true,
"otherPrescribingGuidance": false,
"phenotypes": {
"HLA-B": "*15:02 positive"
},
"lookupKey": [
{
"HLA-B": "*15:02 positive"
}
]
}
]
}
]
},
"citalopram": {
"name": "citalopram",
"id": "PA449015",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104977"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
},
{
"pmid": "34782755",
"title": "Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction between CYP2C19 and CYP2D6 and SSRIs.",
"journal": "European journal of human genetics : EJHG",
"year": 2022,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9553948"
}
],
"guidelines": [
{
"id": "PA166104977",
"name": "Annotation of DPWG Guideline for citalopram and CYP2C19",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104977",
"annotations": [
{
"implications": [
"The guideline does not provide a description of the impact of a normal metabolizer phenotype on citalopram."
],
"drugRecommendation": "The guideline does not provide a recommendation for citalopram in normal metabolizers.",
"classification": "No recommendation",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*38",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*38",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 70,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*38/*38",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*38": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Normal Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Normal Metabolizer"
}
]
}
]
}
]
},
"clomipramine": {
"name": "clomipramine",
"id": "PA449048",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166184528",
"https://www.clinpgx.org/guidelineAnnotation/PA166104964"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
},
{
"pmid": "41526670",
"title": "Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction between CYP2D6 and CYP2C19 and tricyclic antidepressants.",
"journal": "European journal of human genetics : EJHG",
"year": 2026,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/41526670"
}
],
"guidelines": [
{
"id": "PA166184528",
"name": "Annotation of DPWG Guideline for clomipramine and CYP2C19",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166184528",
"annotations": [
{
"implications": [
"The guideline does not provide a description of the impact of a normal metabolizer phenotype on clomipramine."
],
"drugRecommendation": "The guideline does not provide a recommendation for clomipramine in normal metabolizers.",
"classification": "No recommendation",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*38",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*38",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 70,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*38/*38",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*38": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Normal Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Normal Metabolizer"
}
]
}
]
},
{
"id": "PA166104964",
"name": "Annotation of DPWG Guideline for clomipramine and CYP2D6",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104964",
"annotations": [
{
"implications": [
"The risk of side effects may be increased, because the gene variation leads to increased plasma concentrations of clomipramine and the active metabolite desmethylclomipramine."
],
"drugRecommendation": "Use 70% of the standard dose and monitor the effect and side effects or the plasma concentrations of clomipramine and desmethylclomipramine.",
"classification": "Unspecified",
"activityScore": {
"CYP2D6": "1.0"
},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2D6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2D6",
"name": "*3",
"function": "No function",
"reference": false,
"activityValue": "0.0"
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "1.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"1.0"
],
"label": "*1/*3",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": true,
"phenotypes": {
"CYP2D6": "Intermediate Metabolizer"
},
"lookupKey": [
{
"CYP2D6": "1.0"
}
]
}
]
}
]
},
"clopidogrel": {
"name": "clopidogrel",
"id": "PA449053",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104956"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
}
],
"guidelines": [
{
"id": "PA166104956",
"name": "Annotation of DPWG Guideline for clopidogrel and CYP2C19",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104956",
"annotations": [
{
"implications": [
"The guideline does not provide a description of the impact of a normal metabolizer phenotype on clopidogrel."
],
"drugRecommendation": "The guideline does not provide a recommendation for clopidogrel in normal metabolizers.",
"classification": "No recommendation",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*38",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*38",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 70,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*38/*38",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*38": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Normal Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Normal Metabolizer"
}
]
}
]
}
]
},
"codeine": {
"name": "codeine",
"id": "PA449088",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104970"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
},
{
"pmid": "34267337",
"title": "Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction between CYP2D6 and opioids (codeine, tramadol and oxycodone).",
"journal": "European journal of human genetics : EJHG",
"year": 2022,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9553935"
}
],
"guidelines": [
{
"id": "PA166104970",
"name": "Annotation of DPWG Guideline for codeine and CYP2D6",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104970",
"annotations": [
{
"implications": [
"The genetic variation reduces the conversion of codeine to morphine. This can result in reduced analgesia."
],
"drugRecommendation": "For PAIN:\nIt is not possible to offer adequately substantiated advice for dose adjustment based on the limited available literature for this phenotype.\n\n- Be alert to a reduced effectiveness.
\n- In the case of inadequate effectiveness: 1. Try a dose increase. 2. If this does not work: choose an alternative.\nDo not select tramadol, as this is also metabolised by CYP2D6. Morphine is not metabolised by CYP2D6. Oxycodone is metabolised by CYP2D6 to a limited extent, but this does not result in differences in analgesia in patients.
\n- If no alternative is selected: advise the patient to report inadequate analgesia.
\n
\nFor COUGH:\nNo action required.",
"classification": "Unspecified",
"activityScore": {
"CYP2D6": "1.0"
},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2D6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2D6",
"name": "*3",
"function": "No function",
"reference": false,
"activityValue": "0.0"
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "1.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"1.0"
],
"label": "*1/*3",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": true,
"otherPrescribingGuidance": true,
"phenotypes": {
"CYP2D6": "Intermediate Metabolizer"
},
"lookupKey": [
{
"CYP2D6": "1.0"
}
]
}
]
}
]
},
"doxepin": {
"name": "doxepin",
"id": "PA449409",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104994"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
},
{
"pmid": "41526670",
"title": "Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction between CYP2D6 and CYP2C19 and tricyclic antidepressants.",
"journal": "European journal of human genetics : EJHG",
"year": 2026,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/41526670"
}
],
"guidelines": [
{
"id": "PA166104994",
"name": "Annotation of DPWG Guideline for doxepin and CYP2D6",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104994",
"annotations": [
{
"implications": [
"The risk of side effects may be increased, because the gene variation leads to increased plasma concentrations of doxepin and the active metabolite nordoxepin."
],
"drugRecommendation": "Use 80% of the standard dose and monitor the effect and side effects or the plasma concentrations of doxepin and nordoxepin in order to set the maintenance dose.",
"classification": "Unspecified",
"activityScore": {
"CYP2D6": "1.0"
},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2D6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2D6",
"name": "*3",
"function": "No function",
"reference": false,
"activityValue": "0.0"
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "1.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"1.0"
],
"label": "*1/*3",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": true,
"phenotypes": {
"CYP2D6": "Intermediate Metabolizer"
},
"lookupKey": [
{
"CYP2D6": "1.0"
}
]
}
]
}
]
},
"efavirenz": {
"name": "efavirenz",
"id": "PA449441",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166182846"
],
"citations": [],
"guidelines": [
{
"id": "PA166182846",
"name": "Annotation of DPWG Guideline for efavirenz and CYP2B6",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166182846",
"annotations": [
{
"implications": [
"The guideline does not provide a description of the impact of a normal metabolizer phenotype on efavirenz."
],
"drugRecommendation": "The guideline does not provide a recommendation for efavirenz in normal metabolizers.",
"classification": "No recommendation",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2B6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2B6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP2B6",
"matchScore": 96,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2B6": "Normal Metabolizer"
},
"lookupKey": [
{
"CYP2B6": "Normal Metabolizer"
}
]
}
]
}
]
},
"eliglustat": {
"name": "eliglustat",
"id": "PA166123486",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166182823"
],
"citations": [],
"guidelines": [
{
"id": "PA166182823",
"name": "Annotation of DPWG Guideline for eliglustat and CYP2D6",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166182823",
"annotations": [
{
"implications": [
"The gene variation reduces the conversion of eliglustat into inactive metabolites. However, in the absence of renal and hepatic impairment, this does not lead to a clinically significant increased risk of adverse reactions."
],
"drugRecommendation": "\n- MILD, MODERATE OR SEVERE RENAL IMPAIRMENT and/or MILD HEPATIC IMPAIRMENT:\nEliglustat is not recommended. avoid eliglustat if possible.
\n- OTHER:\nno action required (i.e. same treatment as for normal metabolisers)
\n
",
"classification": "Unspecified",
"activityScore": {
"CYP2D6": "1.0"
},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2D6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2D6",
"name": "*3",
"function": "No function",
"reference": false,
"activityValue": "0.0"
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "1.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"1.0"
],
"label": "*1/*3",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": true,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2D6": "Intermediate Metabolizer"
},
"lookupKey": [
{
"CYP2D6": "1.0"
}
]
}
]
}
]
},
"escitalopram": {
"name": "escitalopram",
"id": "PA10074",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104975"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
},
{
"pmid": "34782755",
"title": "Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction between CYP2C19 and CYP2D6 and SSRIs.",
"journal": "European journal of human genetics : EJHG",
"year": 2022,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9553948"
}
],
"guidelines": [
{
"id": "PA166104975",
"name": "Annotation of DPWG Guideline for escitalopram and CYP2C19",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104975",
"annotations": [
{
"implications": [
"The guideline does not provide a description of the impact of a normal metabolizer phenotype on escitalopram."
],
"drugRecommendation": "The guideline does not provide a recommendation for escitalopram in normal metabolizers.",
"classification": "No recommendation",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*38",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*38",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 70,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*38/*38",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*38": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Normal Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Normal Metabolizer"
}
]
}
]
}
]
},
"flecainide": {
"name": "flecainide",
"id": "PA449646",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104969"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
}
],
"guidelines": [
{
"id": "PA166104969",
"name": "Annotation of DPWG Guideline for flecainide and CYP2D6",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104969",
"annotations": [
{
"implications": [
"The genetic variation reduces conversion of flecainide to inactive metabolites. This may increase the risk of side effects."
],
"drugRecommendation": "Indications other than diagnosis of Brugada syndrome:\n\n- Reduce the dose to 75% of the standard dose and record an ECG and monitor the plasma concentration.
\n
\nProvocation test for diagnosis of Brugada syndrome:\n\n- No action required. At a dose of 2.0 mg/kg body weight to a maximum of 150 mg, the response is better for patients with alleles that result in reduced activity. All 5 patients with these alleles and 20% of the patients with two fully active alleles exhibited a response within 30 minutes.
\n
",
"classification": "Unspecified",
"activityScore": {
"CYP2D6": "1.0"
},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2D6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2D6",
"name": "*3",
"function": "No function",
"reference": false,
"activityValue": "0.0"
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "1.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"1.0"
],
"label": "*1/*3",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2D6": "Intermediate Metabolizer"
},
"lookupKey": [
{
"CYP2D6": "1.0"
}
]
}
]
}
]
},
"flucloxacillin": {
"name": "flucloxacillin",
"id": "PA164781042",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166182810"
],
"citations": [],
"guidelines": [
{
"id": "PA166182810",
"name": "Annotation of DPWG Guideline for flucloxacillin and HLA-B",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166182810",
"annotations": [
{
"implications": [
"HLA-B*57:01-positive patients have an 80-fold elevated risk of flucloxacillin-induced liver injury. However, the incidence is low (1-2 per 1000 individuals)."
],
"drugRecommendation": "\n- Regularly monitor the patient’s liver function
\n- Choose an alternative if liver enzymes and/or bilirubin levels are elevated
\n
",
"classification": "Unspecified",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "HLA-B",
"name": "*15:02",
"function": null,
"reference": false,
"activityValue": null
},
"allele2": {
"gene": "HLA-B",
"name": "*57:01",
"function": null,
"reference": false,
"activityValue": null
},
"gene": "HLA-B",
"matchScore": 0,
"phenotypes": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"label": "*15:02/*57:01",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": true,
"otherPrescribingGuidance": true,
"phenotypes": {
"HLA-B": "*57:01 positive"
},
"lookupKey": [
{
"HLA-B": "*57:01 positive"
}
]
}
]
}
]
},
"flucytosine": {
"name": "flucytosine",
"id": "PA449654",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166222801"
],
"citations": [],
"guidelines": [
{
"id": "PA166222801",
"name": "Annotation of DPWG Guideline for flucytosine and DPYD",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166222801",
"annotations": [
{
"implications": [
"The guideline does not provide a description of the impact of a DPYD activity score of 2 on flucytosine."
],
"drugRecommendation": "The guideline does not provide a recommendation for flucytosine in patients with a DPYD activity score of 2.",
"classification": "No recommendation",
"activityScore": {
"DPYD": "2.0"
},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "DPYD",
"matchScore": 0,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": [
{
"allele1": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "DPYD",
"matchScore": 166,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
],
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"DPYD": "Normal Metabolizer"
},
"lookupKey": [
{
"DPYD": "2.0"
}
]
}
]
}
]
},
"fluorouracil": {
"name": "fluorouracil",
"id": "PA128406956",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104939"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
},
{
"pmid": "31745289",
"title": "Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction of DPYD and fluoropyrimidines.",
"journal": "European journal of human genetics : EJHG",
"year": 2020,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7080718"
}
],
"guidelines": [
{
"id": "PA166104939",
"name": "Annotation of DPWG Guideline for fluorouracil and DPYD",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104939",
"annotations": [
{
"implications": [
"The guideline does not provide a description of the impact of a DPYD activity score of 2 on fluorouracil."
],
"drugRecommendation": "The guideline does not provide a recommendation for fluorouracil in patients with a DPYD activity score of 2.",
"classification": "No recommendation",
"activityScore": {
"DPYD": "2.0"
},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "DPYD",
"matchScore": 0,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": [
{
"allele1": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "DPYD",
"matchScore": 166,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
],
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"DPYD": "Normal Metabolizer"
},
"lookupKey": [
{
"DPYD": "2.0"
}
]
}
]
}
]
},
"haloperidol": {
"name": "haloperidol",
"id": "PA449841",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104988"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
},
{
"pmid": "37002327",
"title": "Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction between CYP2D6, CYP3A4 and CYP1A2 and antipsychotics.",
"journal": "European journal of human genetics : EJHG",
"year": 2024,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10923774"
}
],
"guidelines": [
{
"id": "PA166104988",
"name": "Annotation of DPWG Guideline for haloperidol and CYP2D6",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104988",
"annotations": [
{
"implications": [
"The genetic variation results in a higher plasma concentration, but the effect is small and no clinically significant effects were found."
],
"drugRecommendation": "NO action is required for this gene-drug interaction.",
"classification": "Unspecified",
"activityScore": {
"CYP2D6": "1.0"
},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2D6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2D6",
"name": "*3",
"function": "No function",
"reference": false,
"activityValue": "0.0"
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "1.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"1.0"
],
"label": "*1/*3",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2D6": "Intermediate Metabolizer"
},
"lookupKey": [
{
"CYP2D6": "1.0"
}
]
}
]
}
]
},
"imipramine": {
"name": "imipramine",
"id": "PA449969",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104954",
"https://www.clinpgx.org/guidelineAnnotation/PA166104972"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
},
{
"pmid": "41526670",
"title": "Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction between CYP2D6 and CYP2C19 and tricyclic antidepressants.",
"journal": "European journal of human genetics : EJHG",
"year": 2026,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/41526670"
}
],
"guidelines": [
{
"id": "PA166104954",
"name": "Annotation of DPWG Guideline for imipramine and CYP2C19",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104954",
"annotations": [
{
"implications": [
"The guideline does not provide a description of the impact of a normal metabolizer phenotype on imipramine."
],
"drugRecommendation": "The guideline does not provide a recommendation for imipramine in normal metabolizers.",
"classification": "No recommendation",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*38",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*38",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 70,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*38/*38",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*38": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Normal Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Normal Metabolizer"
}
]
}
]
},
{
"id": "PA166104972",
"name": "Annotation of DPWG Guideline for imipramine and CYP2D6",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104972",
"annotations": [
{
"implications": [
"The risk of side effects may be increased, because the gene variation leads to increased plasma concentrations of imipramine and desipramine."
],
"drugRecommendation": "Use 70% of the standard dose and monitor the effect and side effects or the plasma concentrations of imipramine and desipramine in order to set the maintenance dose.",
"classification": "Unspecified",
"activityScore": {
"CYP2D6": "1.0"
},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2D6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2D6",
"name": "*3",
"function": "No function",
"reference": false,
"activityValue": "0.0"
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "1.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"1.0"
],
"label": "*1/*3",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": true,
"phenotypes": {
"CYP2D6": "Intermediate Metabolizer"
},
"lookupKey": [
{
"CYP2D6": "1.0"
}
]
}
]
}
]
},
"irinotecan": {
"name": "irinotecan",
"id": "PA450085",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104951"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
},
{
"pmid": "36443464",
"title": "Dutch pharmacogenetics working group (DPWG) guideline for the gene-drug interaction between UGT1A1 and irinotecan.",
"journal": "European journal of human genetics : EJHG",
"year": 2023,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10474017"
}
],
"guidelines": [
{
"id": "PA166104951",
"name": "Annotation of DPWG Guideline for irinotecan and UGT1A1",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104951",
"annotations": [
{
"implications": [
"The guideline does not provide a description of the impact of a normal metabolizer phenotype on irinotecan."
],
"drugRecommendation": "The guideline does not provide a recommendation for irinotecan in normal metabolizers",
"classification": "No recommendation",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "UGT1A1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "UGT1A1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "UGT1A1",
"matchScore": 8,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"UGT1A1": "Normal Metabolizer"
},
"lookupKey": [
{
"UGT1A1": "Normal Metabolizer"
}
]
}
]
}
]
},
"lamotrigine": {
"name": "lamotrigine",
"id": "PA450164",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166265341"
],
"citations": [
{
"pmid": "38570725",
"title": "Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction of CYP2C9, HLA-A and HLA-B with anti-epileptic drugs.",
"journal": "European journal of human genetics : EJHG",
"year": 2024,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC11291682"
}
],
"guidelines": [
{
"id": "PA166265341",
"name": "Annotation of DPWG Guideline for lamotrigine and HLA-B",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166265341",
"annotations": [
{
"implications": [
"The life-threatening cutaneous side effect Stevens-Johnson Syndrome/Toxic Epidermal Necrolysis (SJS/TEN) in the first three months occurs more often in patients with this genetic variation. Based on the estimated risk for all patients and the increase by a factor 2.4-7.9 for patients with this genetic variation, the risk of lamotrigine-induced SJS/TEN in patients with HLA-B*1502 is estimated at 0.24-0.79%."
],
"drugRecommendation": "\n- Carefully weigh the risk of SJS/TEN against the benefits.
\n- Avoid lamotrigine if an alternative is possible.\nCarbamazepine carries a much higher risk of SJS/TEN in these patients and is therefore not an alternative.\nA similar risk has been reported for phenytoin as for lamotrigine. The same applies to oxcarbazepine, but the most severe forms (SJS/TEN overlap and TEN) have not been observed with oxcarbazepine.
\n- If it is not possible to avoid lamotrigine, advise the patient to report any skin rash immediately.
\n
",
"classification": "Unspecified",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "HLA-B",
"name": "*15:02",
"function": null,
"reference": false,
"activityValue": null
},
"allele2": {
"gene": "HLA-B",
"name": "*57:01",
"function": null,
"reference": false,
"activityValue": null
},
"gene": "HLA-B",
"matchScore": 0,
"phenotypes": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"label": "*15:02/*57:01",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": true,
"otherPrescribingGuidance": true,
"phenotypes": {
"HLA-B": "*15:02 positive"
},
"lookupKey": [
{
"HLA-B": "*15:02 positive"
}
]
}
]
}
]
},
"lansoprazole": {
"name": "lansoprazole",
"id": "PA450180",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104987"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
}
],
"guidelines": [
{
"id": "PA166104987",
"name": "Annotation of DPWG Guideline for lansoprazole and CYP2C19",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104987",
"annotations": [
{
"implications": [
"The guideline does not provide a description of the impact of a normal metabolizer phenotype on lansoprazole."
],
"drugRecommendation": "The guideline does not provide a recommendation for lansoprazole in normal metabolizers.",
"classification": "No recommendation",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*38",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*38",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 70,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*38/*38",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*38": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Normal Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Normal Metabolizer"
}
]
}
]
}
]
},
"mavacamten": {
"name": "mavacamten",
"id": "PA166272922",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166418081"
],
"citations": [],
"guidelines": [
{
"id": "PA166418081",
"name": "Annotation of DPWG Guideline for mavacamten and CYP2C19",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166418081",
"annotations": [
{
"implications": [
"The guideline does not provide a description of the impact of a normal metabolizer phenotype on mavacamten."
],
"drugRecommendation": "The guideline does not provide a recommendation for mavacamten in normal metabolizers.",
"classification": "No recommendation",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*38",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*38",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 70,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*38/*38",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*38": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Normal Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Normal Metabolizer"
}
]
}
]
}
]
},
"mercaptopurine": {
"name": "mercaptopurine",
"id": "PA450379",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166184613",
"https://www.clinpgx.org/guidelineAnnotation/PA166104952"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
},
{
"pmid": "41318725",
"title": "Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction between TPMT/NUDT15 and thiopurines.",
"journal": "European journal of human genetics : EJHG",
"year": 2025,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/41318725"
}
],
"guidelines": [
{
"id": "PA166184613",
"name": "Annotation of DPWG Guideline for mercaptopurine and NUDT15",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166184613",
"annotations": [
{
"implications": [
"The guideline does not provide a description of the impact of a normal metabolizer phenotype on mercaptopurine."
],
"drugRecommendation": "The guideline does not provide a recommendation for mercaptopurine in normal metabolizers",
"classification": "No recommendation",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "NUDT15",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "NUDT15",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "NUDT15",
"matchScore": 36,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"NUDT15": "Normal Metabolizer"
},
"lookupKey": [
{
"NUDT15": "Normal Metabolizer"
}
]
}
]
},
{
"id": "PA166104952",
"name": "Annotation of DPWG Guideline for mercaptopurine and TPMT",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104952",
"annotations": [
{
"implications": [
"The guideline does not provide a description of the impact of a normal metabolizer phenotype on mercaptopurine."
],
"drugRecommendation": "The guideline does not provide a recommendation for mercaptopurine in normal metabolizers.",
"classification": "No recommendation",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "TPMT",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "TPMT",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "TPMT",
"matchScore": 90,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"TPMT": "Normal Metabolizer"
},
"lookupKey": [
{
"TPMT": "Normal Metabolizer"
}
]
}
]
}
]
},
"metoprolol": {
"name": "metoprolol",
"id": "PA450480",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104995"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
}
],
"guidelines": [
{
"id": "PA166104995",
"name": "Annotation of DPWG Guideline for metoprolol and CYP2D6",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104995",
"annotations": [
{
"implications": [
"The gene variation reduces the conversion of metoprolol to inactive metabolites. However, the clinical consequences are limited mainly to the occurrence of asymptomatic bradycardia."
],
"drugRecommendation": "If a GRADUAL REDUCTION in HEART RATE is desired, or in the event of SYMPTOMATIC BRADYCARDIA:\n\n- Use smaller steps in dose titration and/or prescribe no more than 50% of the standard dose.
\n
\nOTHER CASES:\n",
"classification": "Unspecified",
"activityScore": {
"CYP2D6": "1.0"
},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2D6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2D6",
"name": "*3",
"function": "No function",
"reference": false,
"activityValue": "0.0"
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "1.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"1.0"
],
"label": "*1/*3",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2D6": "Intermediate Metabolizer"
},
"lookupKey": [
{
"CYP2D6": "1.0"
}
]
}
]
}
]
},
"nortriptyline": {
"name": "nortriptyline",
"id": "PA450657",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104961"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
}
],
"guidelines": [
{
"id": "PA166104961",
"name": "Annotation of DPWG Guideline for nortriptyline and CYP2D6",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104961",
"annotations": [
{
"implications": [
"The risk of side effects may be increased, because the gene variation leads to an increased plasma concentration of nortriptyline."
],
"drugRecommendation": "Use 60% of the standard dose and monitor the effect and side effects or the plasma concentration of nortriptyline in order to set the maintenance dose.",
"classification": "Unspecified",
"activityScore": {
"CYP2D6": "1.0"
},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2D6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2D6",
"name": "*3",
"function": "No function",
"reference": false,
"activityValue": "0.0"
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "1.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"1.0"
],
"label": "*1/*3",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": true,
"phenotypes": {
"CYP2D6": "Intermediate Metabolizer"
},
"lookupKey": [
{
"CYP2D6": "1.0"
}
]
}
]
}
]
},
"omeprazole": {
"name": "omeprazole",
"id": "PA450704",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104957"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
}
],
"guidelines": [
{
"id": "PA166104957",
"name": "Annotation of DPWG Guideline for omeprazole and CYP2C19",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104957",
"annotations": [
{
"implications": [
"The guideline does not provide a description of the impact of a normal metabolizer phenotype on omeprazole."
],
"drugRecommendation": "The guideline does not provide a recommendation for omeprazole in normal metabolizers.",
"classification": "No recommendation",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*38",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*38",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 70,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*38/*38",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*38": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Normal Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Normal Metabolizer"
}
]
}
]
}
]
},
"oxcarbazepine": {
"name": "oxcarbazepine",
"id": "PA450732",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166265201"
],
"citations": [
{
"pmid": "38570725",
"title": "Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction of CYP2C9, HLA-A and HLA-B with anti-epileptic drugs.",
"journal": "European journal of human genetics : EJHG",
"year": 2024,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC11291682"
}
],
"guidelines": [
{
"id": "PA166265201",
"name": "Annotation of DPWG Guideline for oxcarbazepine and HLA-B",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166265201",
"annotations": [
{
"implications": [
"Stevens-Johnson syndrome, the severe cutaneous side effect in the first three months that can potentially result in permanent damage, occurs more often in patients with this genetic variation. The calculated risk of oxcarbazepine-induced SJS in patients with HLA-B*1502 is 0.73%."
],
"drugRecommendation": "\n- Carefully weigh the risk of SJS against the benefits.
\n- Avoid oxcarbazepine if an alternative is possible.\n
\n- Carbamazepine carries a 10-fold higher risk of SJS/TEN in these patients and is therefore not an alternative.
\n- In these patients, phenytoin and lamotrigine carry a similar risk of SJS/TEN as oxcarbazepine, but more severe forms of SJS/TEN (SJS/TEN overlap and TEN) are also\nobserved with these medicines. Therefore, they are also not suitable as alternatives.
\n
\n \n- If it is not possible to avoid oxcarbazepine, advise the patient to report any rash immediately
\n
",
"classification": "Unspecified",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "HLA-B",
"name": "*15:02",
"function": null,
"reference": false,
"activityValue": null
},
"allele2": {
"gene": "HLA-B",
"name": "*57:01",
"function": null,
"reference": false,
"activityValue": null
},
"gene": "HLA-B",
"matchScore": 0,
"phenotypes": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"label": "*15:02/*57:01",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": true,
"otherPrescribingGuidance": true,
"phenotypes": {
"HLA-B": "*15:02 positive"
},
"lookupKey": [
{
"HLA-B": "*15:02 positive"
}
]
}
]
}
]
},
"pantoprazole": {
"name": "pantoprazole",
"id": "PA450774",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104958"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
}
],
"guidelines": [
{
"id": "PA166104958",
"name": "Annotation of DPWG Guideline for pantoprazole and CYP2C19",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104958",
"annotations": [
{
"implications": [
"The guideline does not provide a description of the impact of a normal metabolizer phenotype on pantoprazole."
],
"drugRecommendation": "The guideline does not provide a recommendation for pantoprazole in normal metabolizers.",
"classification": "No recommendation",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*38",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*38",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 70,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*38/*38",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*38": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Normal Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Normal Metabolizer"
}
]
}
]
}
]
},
"paroxetine": {
"name": "paroxetine",
"id": "PA450801",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104976"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
},
{
"pmid": "34782755",
"title": "Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction between CYP2C19 and CYP2D6 and SSRIs.",
"journal": "European journal of human genetics : EJHG",
"year": 2022,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9553948"
}
],
"guidelines": [
{
"id": "PA166104976",
"name": "Annotation of DPWG Guideline for paroxetine and CYP2D6",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104976",
"annotations": [
{
"implications": [
"The plasma concentration of paroxetine can increase as a result of the reduced activity of CYP2D6. However, studies did not find any clinical effects."
],
"drugRecommendation": "NO action is needed for this gene-drug interaction.",
"classification": "Unspecified",
"activityScore": {
"CYP2D6": "1.0"
},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2D6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2D6",
"name": "*3",
"function": "No function",
"reference": false,
"activityValue": "0.0"
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "1.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"1.0"
],
"label": "*1/*3",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2D6": "Intermediate Metabolizer"
},
"lookupKey": [
{
"CYP2D6": "1.0"
}
]
}
]
}
]
},
"phenprocoumon": {
"name": "phenprocoumon",
"id": "PA450921",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104940"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
}
],
"guidelines": [
{
"id": "PA166104940",
"name": "Annotation of DPWG Guideline for phenprocoumon and VKORC1",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104940",
"annotations": [
{
"implications": [
"The guideline does not provide a description of the impact of the VKORC1 rs9923231 CC genotype (-1639 GG genotype) on phenprocoumon."
],
"drugRecommendation": "The guideline does not provide a recommendation for phenprocoumon in patients with the VKORC1 rs9923231 CC genotype (-1639 GG genotype).",
"classification": "No recommendation",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "VKORC1",
"name": "rs9923231 reference (C)",
"function": "Normal coumarin sensitivity",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "VKORC1",
"name": "rs9923231 reference (C)",
"function": "Normal coumarin sensitivity",
"reference": true,
"activityValue": "n/a"
},
"gene": "VKORC1",
"matchScore": 2,
"phenotypes": [
"-1639 GG"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"-1639 GG"
],
"label": "rs9923231 reference (C)/rs9923231 reference (C)",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"rs9923231 reference (C)": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"VKORC1": "-1639 GG"
},
"lookupKey": [
{
"VKORC1": {
"rs9923231 reference (C)": 2.0
}
}
]
}
]
}
]
},
"phenytoin": {
"name": "phenytoin",
"id": "PA450947",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "Phenytoin_HLA-B warning",
"version": "1",
"matches": {
"gene": null,
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"phenytoin",
"fosphenytoin"
]
},
"exception_type": "note",
"message": "The displayed recommendation for CYP2C9 and phenytoin is ONLY valid for non-carriers of the HLA-B*15:02 high-risk allele. PharmCAT Named Allele Matcher does not determine HLA status. CPIC guidance: Fos-/Phenytoin is contraindicated in individuals with the HLA-B*15:02 variant allele (\"HLA-B*15:02-positive\") due to significantly increased risk of fos-/phenytoin-induced cutaneous adverse reactions of Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN). In HLA-B*15:02 carriers, carbamazepine should not be used as an alternative. Alternative medications such as oxcarbazepine, eslicarbazepine acetate, and lamotrigine have some evidence linking SJS/TEN with the HLA-B*15:02 allele, and thus caution should be used in choosing alternatives to phenytoin."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104984",
"https://www.clinpgx.org/guidelineAnnotation/PA166264881"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
},
{
"pmid": "38570725",
"title": "Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction of CYP2C9, HLA-A and HLA-B with anti-epileptic drugs.",
"journal": "European journal of human genetics : EJHG",
"year": 2024,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC11291682"
}
],
"guidelines": [
{
"id": "PA166104984",
"name": "Annotation of DPWG Guideline for phenytoin and CYP2C9",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104984",
"annotations": [
{
"implications": [
"The guideline does not provide a description of the impact of a normal metabolizer phenotype on phenytoin."
],
"drugRecommendation": "The guideline does not provide a recommendation for phenytoin in normal metabolizers.",
"classification": "No recommendation",
"activityScore": {
"CYP2C9": "2.0"
},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "CYP2C9",
"matchScore": 166,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C9": "Normal Metabolizer"
},
"lookupKey": [
{
"CYP2C9": "2.0"
}
]
}
]
},
{
"id": "PA166264881",
"name": "Annotation of DPWG Guideline for phenytoin and HLA-B",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166264881",
"annotations": [
{
"implications": [
"The life-threatening cutaneous side effect Stevens-Johnson syndrome/toxic epidermal necrolysis (SJS/TEN) in the first three months occurs more frequently in patients with this genetic variation. The calculated risk of phenytoin-induced SJS/TEN in patients with HLA-B*1502 is 0.65%."
],
"drugRecommendation": "\n- Carefully weigh the risk of SJS/TEN against the benefits.
\n- Avoid phenytoin if an alternative is possible.\n
\n- Carbamazepine carries a 10-fold higher risk of SJS/TEN for these patients and is therefore not an alternative.
\n- A comparable risk has been reported for lamotrigine as for phenytoin. The same applies for oxcarbazepine, but the most severe forms (SJS/TEN overlap and TEN) are not observed with oxcarbazepine.
\n
\n \n- If it is not possible to avoid phenytoin, advise the patient to report any skin rash\nimmediately.
\n
",
"classification": "Unspecified",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "HLA-B",
"name": "*15:02",
"function": null,
"reference": false,
"activityValue": null
},
"allele2": {
"gene": "HLA-B",
"name": "*57:01",
"function": null,
"reference": false,
"activityValue": null
},
"gene": "HLA-B",
"matchScore": 0,
"phenotypes": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"label": "*15:02/*57:01",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": true,
"otherPrescribingGuidance": true,
"phenotypes": {
"HLA-B": "*15:02 positive"
},
"lookupKey": [
{
"HLA-B": "*15:02 positive"
}
]
}
]
}
]
},
"pimozide": {
"name": "pimozide",
"id": "PA450965",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166182819"
],
"citations": [
{
"pmid": "37002327",
"title": "Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction between CYP2D6, CYP3A4 and CYP1A2 and antipsychotics.",
"journal": "European journal of human genetics : EJHG",
"year": 2024,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10923774"
}
],
"guidelines": [
{
"id": "PA166182819",
"name": "Annotation of DPWG Guideline for pimozide and CYP2D6",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166182819",
"annotations": [
{
"implications": [
"The risk of QT-prolongation – and thereby also the risk of torsade de points – is theoretically increased, because the genetic variation results in an increase in the plasma concentration of pimozide. The elevated plasma concentration and associated theoretical increased risk of QT elongation can be negated by following the dose recommendations provided below."
],
"drugRecommendation": "Use no more than the following doses (80% of the normal maximum dose):\n\n- 12 years and older: 16 mg/day
\n- younger than 12 years: 0.08 mg/kg per day to a maximum of 3 mg/day
\n
",
"classification": "Unspecified",
"activityScore": {
"CYP2D6": "1.0"
},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2D6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2D6",
"name": "*3",
"function": "No function",
"reference": false,
"activityValue": "0.0"
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "1.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"1.0"
],
"label": "*1/*3",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2D6": "Intermediate Metabolizer"
},
"lookupKey": [
{
"CYP2D6": "1.0"
}
]
}
]
}
]
},
"propafenone": {
"name": "propafenone",
"id": "PA451131",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104962"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
}
],
"guidelines": [
{
"id": "PA166104962",
"name": "Annotation of DPWG Guideline for propafenone and CYP2D6",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104962",
"annotations": [
{
"implications": [
"Genetic variation increases the sum of the plasma concentrations of propafenone and the active metabolite 5-hydroxypropafenone. This may increase the risk of side effects."
],
"drugRecommendation": "It is not possible to offer adequately substantiated recommendations for dose adjustment based on the literature.\n\n- Either guide the dose by therapeutic drug monitoring, perform an ECG and be alert to side effects.
\n- Or choose an alternative. Antiarrhythmic drugs that are hardly if at all metabolised by CYP2D6 include, for example, sotalol, disopyramide, quinidine and amiodarone.
\n
",
"classification": "Unspecified",
"activityScore": {
"CYP2D6": "1.0"
},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2D6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2D6",
"name": "*3",
"function": "No function",
"reference": false,
"activityValue": "0.0"
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "1.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"1.0"
],
"label": "*1/*3",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": true,
"otherPrescribingGuidance": true,
"phenotypes": {
"CYP2D6": "Intermediate Metabolizer"
},
"lookupKey": [
{
"CYP2D6": "1.0"
}
]
}
]
}
]
},
"quetiapine": {
"name": "quetiapine",
"id": "PA451201",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "CYP3A4",
"version": "2",
"matches": {
"gene": "CYP3A4",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"quetiapine"
]
},
"exception_type": "note",
"message": "The CYP3A4 alleles are determined based on PharmVar CYP3A4 allele definitions. See PharmCAT disclaimer for further information."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166265421"
],
"citations": [
{
"pmid": "37002327",
"title": "Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction between CYP2D6, CYP3A4 and CYP1A2 and antipsychotics.",
"journal": "European journal of human genetics : EJHG",
"year": 2024,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10923774"
}
],
"guidelines": [
{
"id": "PA166265421",
"name": "Annotation of DPWG Guideline for quetiapine and CYP3A4",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166265421",
"annotations": [
{
"implications": [
"The guideline does not provide a description of the impact of a normal metabolizer phenotype on quetiapine."
],
"drugRecommendation": "The guideline does not provide a recommendation for quetiapine in normal metabolizers.",
"classification": "No recommendation",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP3A4",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP3A4",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP3A4",
"matchScore": 86,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP3A4": "Normal Metabolizer"
},
"lookupKey": [
{
"CYP3A4": "Normal Metabolizer"
}
]
}
]
}
]
},
"risperidone": {
"name": "risperidone",
"id": "PA451257",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104943"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
},
{
"pmid": "37002327",
"title": "Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction between CYP2D6, CYP3A4 and CYP1A2 and antipsychotics.",
"journal": "European journal of human genetics : EJHG",
"year": 2024,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10923774"
}
],
"guidelines": [
{
"id": "PA166104943",
"name": "Annotation of DPWG Guideline for risperidone and CYP2D6",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104943",
"annotations": [
{
"implications": [
"There is little evidence to support an increase in side effects caused by the gene variation. The gene variation may lead to a decrease in the required maintenance dose. However, as the effect on the dose is smaller than that of the normal biological variation, action is not useful."
],
"drugRecommendation": "NO action is needed for this gene-drug interaction.",
"classification": "Unspecified",
"activityScore": {
"CYP2D6": "1.0"
},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2D6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2D6",
"name": "*3",
"function": "No function",
"reference": false,
"activityValue": "0.0"
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "1.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"1.0"
],
"label": "*1/*3",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2D6": "Intermediate Metabolizer"
},
"lookupKey": [
{
"CYP2D6": "1.0"
}
]
}
]
}
]
},
"rosuvastatin": {
"name": "rosuvastatin",
"id": "PA134308647",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "SLCO1B1-drug text",
"version": "1",
"matches": {
"gene": "SLCO1B1",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"simvastatin",
"rosuvastatin",
"pravastatin",
"pitavastatin",
"lovastatin",
"fluvastatin",
"atorvastatin"
]
},
"exception_type": "note",
"message": "The SLCO1B1 genotype (star nomenclature) will be displayed if determinable with the provided VCF based on the SLCO1B1 star allele definition published by CPIC and recommendations are provided based on the genotype.
In case no genotype can be determined, recommendations are based on the rs4149056 genotype alone as per guideline. The minor C allele at rs4149056 defines SLCO1B1*5."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166363221"
],
"citations": [
{
"pmid": "39676086",
"title": "Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction between SLCO1B1 and statins and CYP2C9 and sulfonylureas.",
"journal": "European journal of human genetics : EJHG",
"year": 2024,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/39676086"
}
],
"guidelines": [
{
"id": "PA166363221",
"name": "Annotation of DPWG Guideline for rosuvastatin and SLCO1B1",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166363221",
"annotations": [
{
"implications": [
"The guideline does not provide a description of the impact of the normal function phenotype on rosuvastatin."
],
"drugRecommendation": "The guideline does not provide a recommendation for rosuvastatin in patients with normal function.",
"classification": "No recommendation",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "SLCO1B1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "SLCO1B1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "SLCO1B1",
"matchScore": 70,
"phenotypes": [
"Normal Function"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Function"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"SLCO1B1": "Normal Function"
},
"lookupKey": [
{
"SLCO1B1": "Normal Function"
}
]
}
]
}
]
},
"sertraline": {
"name": "sertraline",
"id": "PA451333",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104980"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
},
{
"pmid": "34782755",
"title": "Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction between CYP2C19 and CYP2D6 and SSRIs.",
"journal": "European journal of human genetics : EJHG",
"year": 2022,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9553948"
}
],
"guidelines": [
{
"id": "PA166104980",
"name": "Annotation of DPWG Guideline for sertraline and CYP2C19",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104980",
"annotations": [
{
"implications": [
"The guideline does not provide a description of the impact of a normal metabolizer phenotype on sertraline."
],
"drugRecommendation": "The guideline does not provide a recommendation for sertraline in normal metabolizers.",
"classification": "No recommendation",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*38",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*38",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 70,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*38/*38",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*38": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Normal Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Normal Metabolizer"
}
]
}
]
}
]
},
"simvastatin": {
"name": "simvastatin",
"id": "PA451363",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "SLCO1B1-drug text",
"version": "1",
"matches": {
"gene": "SLCO1B1",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"simvastatin",
"rosuvastatin",
"pravastatin",
"pitavastatin",
"lovastatin",
"fluvastatin",
"atorvastatin"
]
},
"exception_type": "note",
"message": "The SLCO1B1 genotype (star nomenclature) will be displayed if determinable with the provided VCF based on the SLCO1B1 star allele definition published by CPIC and recommendations are provided based on the genotype.
In case no genotype can be determined, recommendations are based on the rs4149056 genotype alone as per guideline. The minor C allele at rs4149056 defines SLCO1B1*5."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166182844"
],
"citations": [
{
"pmid": "39676086",
"title": "Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction between SLCO1B1 and statins and CYP2C9 and sulfonylureas.",
"journal": "European journal of human genetics : EJHG",
"year": 2024,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/39676086"
}
],
"guidelines": [
{
"id": "PA166182844",
"name": "Annotation of DPWG Guideline for simvastatin and SLCO1B1",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166182844",
"annotations": [
{
"implications": [
"The guideline does not provide a description of the impact of the normal function phenotype on simvastatin."
],
"drugRecommendation": "The guideline does not provide a recommendation for atorvastatin in patients with normal function.",
"classification": "No recommendation",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "SLCO1B1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "SLCO1B1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "SLCO1B1",
"matchScore": 70,
"phenotypes": [
"Normal Function"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Function"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"SLCO1B1": "Normal Function"
},
"lookupKey": [
{
"SLCO1B1": "Normal Function"
}
]
}
]
}
]
},
"siponimod": {
"name": "siponimod",
"id": "PA166182736",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166211021"
],
"citations": [],
"guidelines": [
{
"id": "PA166211021",
"name": "Annotation of DPWG Guideline for siponimod and CYP2C9",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166211021",
"annotations": [
{
"implications": [
"The guideline does not provide a description of the impact of a normal metabolizer phenotype on siponimod."
],
"drugRecommendation": "The guideline does not provide a recommendation for siponimod in normal metabolizers.",
"classification": "No recommendation",
"activityScore": {
"CYP2C9": "2.0"
},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "CYP2C9",
"matchScore": 166,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C9": "Normal Metabolizer"
},
"lookupKey": [
{
"CYP2C9": "2.0"
}
]
}
]
}
]
},
"tacrolimus": {
"name": "tacrolimus",
"id": "PA451578",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104983"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
}
],
"guidelines": [
{
"id": "PA166104983",
"name": "Annotation of DPWG Guideline for tacrolimus and CYP3A5",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104983",
"annotations": [
{
"implications": [
"An increase of the initial dose can result in an increased chance of reaching a tacrolimus concentration within the target range before the start of therapeutic drug monitoring. However, there is no direct evidence that this results in improved clinical results. The genetic variation results in an increased conversion of tacrolimus to inactive metabolites and therefore a higher required dose."
],
"drugRecommendation": "LIVER TRANSPLANTATION\nIn addition to the patient’s genotype, the metabolism of tacrolimus is also determined by the genotype of the transplanted liver.\nLIVER is also of the genotype HOMOZYGOUS EXPRESSOR: Use 2.5 times the normal initial dose. Adjustment of the dose should then be based on therapeutic drug monitoring.\nLIVER has a DIFFERENT genotype: There is insufficient evidence in the literature to support a dose recommendation.\nOTHER TRANSPLANTATION\nUse 2.5 times the initial dose that would yield the desired result in non-expressers. Adjustment of the dose should then be based on therapeutic drug monitoring. For example: One Dutch study found a median trough concentration for tacrolimus after three days of 9.4 ng/mL at an initial dose of 0.15 mg/kg twice daily for 5 homozygous kidney transplant patients. Their target value was 10 - 15 ng/mL.",
"classification": "Unspecified",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP3A5",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP3A5",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP3A5",
"matchScore": 10,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP3A5": "Normal Metabolizer"
},
"lookupKey": [
{
"CYP3A5": "Normal Metabolizer"
}
]
}
]
}
]
},
"tamoxifen": {
"name": "tamoxifen",
"id": "PA451581",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104966"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
}
],
"guidelines": [
{
"id": "PA166104966",
"name": "Annotation of DPWG Guideline for tamoxifen and CYP2D6",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104966",
"annotations": [
{
"implications": [
"This gene variation reduces the conversion of tamoxifen to the active metabolite endoxifen. This can result in reduced effectiveness."
],
"drugRecommendation": "\n- Select an alternative or measure the endoxifen concentration and increase the dose if necessary, by a factor of 1.5-2. Aromatase inhibitors are a possible alternative for post-menopausal women.
\n- If TAMOXIFEN is selected: avoid co-medication with CYP2D6 inhibitors such as paroxetine and fluoxetine.
\n
",
"classification": "Unspecified",
"activityScore": {
"CYP2D6": "1.0"
},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2D6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2D6",
"name": "*3",
"function": "No function",
"reference": false,
"activityValue": "0.0"
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "1.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"1.0"
],
"label": "*1/*3",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": true,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2D6": "Intermediate Metabolizer"
},
"lookupKey": [
{
"CYP2D6": "1.0"
}
]
}
]
}
]
},
"tegafur": {
"name": "tegafur",
"id": "PA452620",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104944"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
},
{
"pmid": "31745289",
"title": "Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction of DPYD and fluoropyrimidines.",
"journal": "European journal of human genetics : EJHG",
"year": 2020,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7080718"
}
],
"guidelines": [
{
"id": "PA166104944",
"name": "Annotation of DPWG Guideline for tegafur and DPYD",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104944",
"annotations": [
{
"implications": [
"The guideline does not provide a description of the impact of a DPYD activity score of 2 on tegafur."
],
"drugRecommendation": "The guideline does not provide a recommendation for tegafur in patients with a DPYD activity score of 2.",
"classification": "No recommendation",
"activityScore": {
"DPYD": "2.0"
},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "DPYD",
"matchScore": 0,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": [
{
"allele1": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "DPYD",
"matchScore": 166,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
],
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"DPYD": "Normal Metabolizer"
},
"lookupKey": [
{
"DPYD": "2.0"
}
]
}
]
}
]
},
"thioguanine": {
"name": "thioguanine",
"id": "PA451663",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166184612",
"https://www.clinpgx.org/guidelineAnnotation/PA166104960"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
},
{
"pmid": "41318725",
"title": "Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction between TPMT/NUDT15 and thiopurines.",
"journal": "European journal of human genetics : EJHG",
"year": 2025,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/41318725"
}
],
"guidelines": [
{
"id": "PA166184612",
"name": "Annotation of DPWG Guideline for thioguanine and NUDT15",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166184612",
"annotations": [
{
"implications": [
"The guideline does not provide a description of the impact of a normal metabolizer phenotype on thioguanine."
],
"drugRecommendation": "The guideline does not provide a recommendation for thioguanine in normal metabolizers",
"classification": "No recommendation",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "NUDT15",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "NUDT15",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "NUDT15",
"matchScore": 36,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"NUDT15": "Normal Metabolizer"
},
"lookupKey": [
{
"NUDT15": "Normal Metabolizer"
}
]
}
]
},
{
"id": "PA166104960",
"name": "Annotation of DPWG Guideline for thioguanine and TPMT",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104960",
"annotations": [
{
"implications": [
"The guideline does not provide a description of the impact of a normal metabolizer phenotype on thioguanine."
],
"drugRecommendation": "The guideline does not provide a recommendation for thioguanine in normal metabolizers.",
"classification": "No recommendation",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "TPMT",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "TPMT",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "TPMT",
"matchScore": 90,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"TPMT": "Normal Metabolizer"
},
"lookupKey": [
{
"TPMT": "Normal Metabolizer"
}
]
}
]
}
]
},
"tramadol": {
"name": "tramadol",
"id": "PA451735",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104959"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
},
{
"pmid": "34267337",
"title": "Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction between CYP2D6 and opioids (codeine, tramadol and oxycodone).",
"journal": "European journal of human genetics : EJHG",
"year": 2022,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9553935"
}
],
"guidelines": [
{
"id": "PA166104959",
"name": "Annotation of DPWG Guideline for tramadol and CYP2D6",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104959",
"annotations": [
{
"implications": [
"The genetic variation reduces the conversion of tramadol to a metabolite with a higher activity. This can result in reduced analgesia."
],
"drugRecommendation": "It is not possible to provide a recommendation for dose adjustment, because the total analgesic effect changes when the ratio between the mother compound and the active metabolite changes.\n\n- Be alert to a reduced effectiveness.
\n- In the case of inadequate effectiveness:
\n
\n\n- a. Try a dose increase.
\n- b. If this does not work: choose an alternative. Do not select codeine, as this is also metabolised by CYP2D6. Morphine is not metabolised by CYP2D6. Oxycodone is metabolised by CYP2D6 to a limited extent, but this does not result in differences in analgesia in patients.
\n
\n\n- If no alternative is selected: advise the patient to report inadequate analgesia.
\n
",
"classification": "Unspecified",
"activityScore": {
"CYP2D6": "1.0"
},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2D6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2D6",
"name": "*3",
"function": "No function",
"reference": false,
"activityValue": "0.0"
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "1.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"1.0"
],
"label": "*1/*3",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": true,
"otherPrescribingGuidance": true,
"phenotypes": {
"CYP2D6": "Intermediate Metabolizer"
},
"lookupKey": [
{
"CYP2D6": "1.0"
}
]
}
]
}
]
},
"venlafaxine": {
"name": "venlafaxine",
"id": "PA451866",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104968"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
},
{
"pmid": "38956296",
"title": "Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction between CYP2D6, CYP2C19 and non-SSRI/non-TCA antidepressants.",
"journal": "European journal of human genetics : EJHG",
"year": 2024,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/38956296"
}
],
"guidelines": [
{
"id": "PA166104968",
"name": "Annotation of DPWG Guideline for venlafaxine and CYP2D6",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104968",
"annotations": [
{
"implications": [
"There are indications of an increased risk of side effects and a reduced chance of efficacy. The gene variation reduces the conversion of venlafaxine to the active metabolite O-desmethylvenlafaxine, whilst an association between high O-desmethylvenlafaxine/venlafaxine ratios and response without side effects was found."
],
"drugRecommendation": "It is not possible to offer adequately substantiated advice for dose reduction based on the literature.\n\n- Avoid venlafaxine. Antidepressants that are not metabolised by CYP2D6 - or to a lesser extent - include, for example, duloxetine, mirtazapine, citalopram and sertraline.
\n- If it is not possible to avoid venlafaxine and side effects occur:
\n
\n\n- Reduce the dose
\n- Monitor the effect and side effects or check the plasma concentrations of venlafaxine and O-desmethylvenlafaxine.\nIt is not known whether it is possible to reduce the dose to such an extent that the side effects disappear, while the effectiveness is maintained. In general, it is assumed that the effectiveness is determined by the sum of the plasma concentrations of venlafaxine and O-desmethylvenlafaxine. However, the side effects do not appear to be related to this sum.
\n
",
"classification": "Unspecified",
"activityScore": {
"CYP2D6": "1.0"
},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2D6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2D6",
"name": "*3",
"function": "No function",
"reference": false,
"activityValue": "0.0"
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "1.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"1.0"
],
"label": "*1/*3",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": true,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2D6": "Intermediate Metabolizer"
},
"lookupKey": [
{
"CYP2D6": "1.0"
}
]
}
]
}
]
},
"voriconazole": {
"name": "voriconazole",
"id": "PA10233",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104990"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
}
],
"guidelines": [
{
"id": "PA166104990",
"name": "Annotation of DPWG Guideline for voriconazole and CYP2C19",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104990",
"annotations": [
{
"implications": [
"The guideline does not provide a description of the impact of a normal metabolizer phenotype on voriconazole."
],
"drugRecommendation": "The guideline does not provide a recommendation for voriconazole in normal metabolizers.",
"classification": "No recommendation",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*38",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*38",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 70,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*38/*38",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*38": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Normal Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Normal Metabolizer"
}
]
}
]
}
]
},
"warfarin": {
"name": "warfarin",
"id": "PA451906",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166182842",
"https://www.clinpgx.org/guidelineAnnotation/PA166182841"
],
"citations": [],
"guidelines": [
{
"id": "PA166182842",
"name": "Annotation of DPWG Guideline for warfarin and CYP2C9",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166182842",
"annotations": [
{
"implications": [
"The guideline does not provide a description of the impact of a normal metabolizer phenotype on warfarin."
],
"drugRecommendation": "The guideline does not provide a recommendation for warfarin in normal metabolizers.",
"classification": "No recommendation",
"activityScore": {
"CYP2C9": "2.0"
},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "CYP2C9",
"matchScore": 166,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C9": "Normal Metabolizer"
},
"lookupKey": [
{
"CYP2C9": "2.0"
}
]
}
]
},
{
"id": "PA166182841",
"name": "Annotation of DPWG Guideline for warfarin and VKORC1",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166182841",
"annotations": [
{
"implications": [
"The guideline does not provide a description of the impact of the VKORC1 rs9923231 CC genotype (-1639 GG genotype) on warfarin."
],
"drugRecommendation": "The guideline does not provide a recommendation for warfarin in patients with the VKORC1 rs9923231 CC genotype (-1639 GG genotype).",
"classification": "No recommendation",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "VKORC1",
"name": "rs9923231 reference (C)",
"function": "Normal coumarin sensitivity",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "VKORC1",
"name": "rs9923231 reference (C)",
"function": "Normal coumarin sensitivity",
"reference": true,
"activityValue": "n/a"
},
"gene": "VKORC1",
"matchScore": 2,
"phenotypes": [
"-1639 GG"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"-1639 GG"
],
"label": "rs9923231 reference (C)/rs9923231 reference (C)",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"rs9923231 reference (C)": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"VKORC1": "-1639 GG"
},
"lookupKey": [
{
"VKORC1": {
"rs9923231 reference (C)": 2.0
}
}
]
}
]
}
]
},
"zuclopenthixol": {
"name": "zuclopenthixol",
"id": "PA452629",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104992"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
},
{
"pmid": "37002327",
"title": "Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction between CYP2D6, CYP3A4 and CYP1A2 and antipsychotics.",
"journal": "European journal of human genetics : EJHG",
"year": 2024,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10923774"
}
],
"guidelines": [
{
"id": "PA166104992",
"name": "Annotation of DPWG Guideline for zuclopenthixol and CYP2D6",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104992",
"annotations": [
{
"implications": [
"The risk of side effects may be elevated. The genetic variation leads to decreased conversion of zuclopentixol, which causes the plasma concentration to be approximately 1.35-fold higher."
],
"drugRecommendation": "Use 75% of the normal dose.",
"classification": "Unspecified",
"activityScore": {
"CYP2D6": "1.0"
},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2D6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2D6",
"name": "*3",
"function": "No function",
"reference": false,
"activityValue": "0.0"
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "1.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"1.0"
],
"label": "*1/*3",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2D6": "Intermediate Metabolizer"
},
"lookupKey": [
{
"CYP2D6": "1.0"
}
]
}
]
}
]
}
},
"FDA Label Annotation": {
"abacavir": {
"name": "abacavir",
"id": "PA448004",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104833"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product ZIAGEN (abacavir sulfate), NDA020977, ViiV Healthcare Company",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=020977"
}
],
"guidelines": [
{
"id": "PA166104833",
"name": "Annotation of FDA Label for abacavir and HLA-B",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104833",
"annotations": [
{
"implications": [],
"drugRecommendation": ""All patients should be screened for the HLA-B*5701 allele prior to initiating therapy with ZIAGEN [abacavir] or reinitiation of therapy with ZIAGEN, unless patients have a previously documented HLA-B*5701 allele assessment...ZIAGEN [abacavir] is contraindicated in patients: who have the HLA-B*5701 allele." See label for more information.",
"classification": "Unspecified",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "HLA-B",
"name": "*15:02",
"function": null,
"reference": false,
"activityValue": null
},
"allele2": {
"gene": "HLA-B",
"name": "*57:01",
"function": null,
"reference": false,
"activityValue": null
},
"gene": "HLA-B",
"matchScore": 0,
"phenotypes": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"label": "*15:02/*57:01",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": true,
"otherPrescribingGuidance": false,
"phenotypes": {
"HLA-B": "*57:01 positive"
},
"lookupKey": [
{
"HLA-B": "*57:01 positive"
}
]
}
]
}
]
},
"abrocitinib": {
"name": "abrocitinib",
"id": "PA166272921",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166272961"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Cibinqo (abrocitinib), NDA213871, Pfizer Laboratories Div Pfizer Inc",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=213871"
}
],
"guidelines": [
{
"id": "PA166272961",
"name": "Annotation of FDA Label for abrocitinib and CYP2C19",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166272961",
"annotations": []
}
]
},
"acetaminophen / caffeine / dihydrocodeine": {
"name": "acetaminophen / caffeine / dihydrocodeine",
"id": "PA166246281",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166246301"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Acetaminophen, Caffeine, Dihydrocodeine Bitartrate (Acetaminophen, Caffeine, Dihydrocodeine Bitartrate), ANDA204785, Xspire Pharma, Llc",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=204785"
}
],
"guidelines": [
{
"id": "PA166246301",
"name": "Annotation of FDA Label for acetaminophen / caffeine / dihydrocodeine and CYP2D6",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166246301",
"annotations": []
}
]
},
"allopurinol": {
"name": "allopurinol",
"id": "PA448320",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166234701"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Aloprim (Allopurinol), Mylan Institutional LLC - NDA020298/SUPPL-12, 02/17/2022",
"journal": null,
"year": 2022,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=020298"
}
],
"guidelines": [
{
"id": "PA166234701",
"name": "Annotation of FDA Label for allopurinol and HLA-B",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166234701",
"annotations": []
}
]
},
"amifampridine": {
"name": "amifampridine",
"id": "PA166185150",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166185151"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product RUZURGI (amifampridine) NDA 209321",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=209321"
}
],
"guidelines": [
{
"id": "PA166185151",
"name": "Annotation of FDA Label for amifampridine and NAT2",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166185151",
"annotations": []
}
]
},
"amifampridine phosphate": {
"name": "amifampridine phosphate",
"id": "PA166182002",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166182021"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Firdapse (amifampridine phosphate), NDA208078, Catalyst Pharmaceuticals, Inc.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=208078"
}
],
"guidelines": [
{
"id": "PA166182021",
"name": "Annotation of FDA Label for amifampridine phosphate and NAT2",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166182021",
"annotations": []
}
]
},
"amikacin": {
"name": "amikacin",
"id": "PA164744372",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166316321"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product ARIKAYCE (Amikacin), NDA207356, Insmed Incorporated",
"journal": null,
"year": 2023,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=207356"
}
],
"guidelines": [
{
"id": "PA166316321",
"name": "Annotation of FDA Label for amikacin and MT-RNR1",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166316321",
"annotations": []
}
]
},
"aripiprazole": {
"name": "aripiprazole",
"id": "PA10026",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104839"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product ABILIFY (ARIPIPRAZOLE), NDA021436, Rebel Distributors Corp.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=021436"
},
{
"pmid": null,
"title": "Drugs@FDA: Drug Product ABILIFY MAINTENA (aripiprazole), NDA202971, Otsuka America Pharmaceutical, Inc.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=202971"
},
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Abilify Asimtufii (Aripiprazole), Otsuka America Pharmaceutical, Inc - NDA217006/SUPPL-2, 01/22/2025",
"journal": null,
"year": 2025,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=217006"
}
],
"guidelines": [
{
"id": "PA166104839",
"name": "Annotation of FDA Label for aripiprazole and CYP2D6",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104839",
"annotations": []
}
]
},
"aripiprazole lauroxil": {
"name": "aripiprazole lauroxil",
"id": "PA166161216",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166161219"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product ARISTADA (aripiprazole lauroxil), NDA207533, Alkermes, Inc.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=207533"
},
{
"pmid": null,
"title": "Drugs@FDA: Drug Product ARISTADA INITIO (aripiprazole lauroxil), NDA209830, Alkermes, Inc.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=209830"
}
],
"guidelines": [
{
"id": "PA166161219",
"name": "Annotation of FDA Label for aripiprazole lauroxil and CYP2D6",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166161219",
"annotations": []
}
]
},
"articaine / epinephrine": {
"name": "articaine / epinephrine",
"id": "PA166182783",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166182741"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Articaine HCl and Epinephrine (articaine hydrochloride and epinephrine bitartrate), NDA022466, Safco Dental Supply Co.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=022466"
}
],
"guidelines": [
{
"id": "PA166182741",
"name": "Annotation of FDA Label for articaine / epinephrine and CYB5R3, G6PD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166182741",
"annotations": []
}
]
},
"ascorbic acid (vitamin c), combinations": {
"name": "Ascorbic acid (vitamin C), combinations",
"id": "PA164712515",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166293282"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Ascor (Ascorbic Acid), NDA209112, McGuff Pharmaceuticals, Inc.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=209112"
}
],
"guidelines": [
{
"id": "PA166293282",
"name": "Annotation of FDA Label for Ascorbic acid (vitamin C), combinations, Ascorbic acid (vitamin C), plain, sodium ascorbate and G6PD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166293282",
"annotations": []
}
]
},
"ascorbic acid (vitamin c), plain": {
"name": "Ascorbic acid (vitamin C), plain",
"id": "PA164712516",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166293282"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Ascor (Ascorbic Acid), NDA209112, McGuff Pharmaceuticals, Inc.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=209112"
}
],
"guidelines": [
{
"id": "PA166293282",
"name": "Annotation of FDA Label for Ascorbic acid (vitamin C), combinations, Ascorbic acid (vitamin C), plain, sodium ascorbate and G6PD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166293282",
"annotations": []
}
]
},
"atomoxetine": {
"name": "atomoxetine",
"id": "PA134688071",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104827"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Strattera (Atomoxetine hydrochloride), NDA021411, Eli Lilly and Company",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=021411"
}
],
"guidelines": [
{
"id": "PA166104827",
"name": "Annotation of FDA Label for atomoxetine and CYP2D6",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104827",
"annotations": []
}
]
},
"avatrombopag": {
"name": "avatrombopag",
"id": "PA166179849",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166179855"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product DOPTELET (avatrombopag maleate), AkaRx, Inc. - NDA210238/SUPPL-6, 10/14/2021",
"journal": null,
"year": 2021,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=210238"
}
],
"guidelines": [
{
"id": "PA166179855",
"name": "Annotation of FDA Label for avatrombopag and F2, F5, PROC, PROS1, SERPINC1",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166179855",
"annotations": []
}
]
},
"azathioprine": {
"name": "azathioprine",
"id": "PA448515",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104782"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product IMURAN (azathioprine), NDA016324, Sebela Pharmaceuticals Inc.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=016324"
}
],
"guidelines": [
{
"id": "PA166104782",
"name": "Annotation of FDA Label for azathioprine and NUDT15, TPMT",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104782",
"annotations": []
}
]
},
"belinostat": {
"name": "belinostat",
"id": "PA165971474",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166129553"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Beleodaq (Belinostat), NDA206256, Spectrum Pharmaceuticals, Inc.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=206256"
}
],
"guidelines": [
{
"id": "PA166129553",
"name": "Annotation of FDA Label for belinostat and UGT1A1",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166129553",
"annotations": []
}
]
},
"belzutifan": {
"name": "belzutifan",
"id": "PA166268761",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166268882"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product WELIREG (belzutifan), NDA215383, Merck Sharp & Dohme Corp.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=215383"
},
{
"pmid": null,
"title": "Drugs@FDA: Drug Product WELIREG (belzutifan), Merck Sharp & Dohme LLC - NDA215383/SUPPL-12, 05/14/2025",
"journal": null,
"year": 2025,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=215383"
}
],
"guidelines": [
{
"id": "PA166268882",
"name": "Annotation of FDA Label for belzutifan and CYP2C19, UGT2B17",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166268882",
"annotations": []
}
]
},
"brexpiprazole": {
"name": "brexpiprazole",
"id": "PA166160053",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166160054"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product REXULTI (brexpiprazole), NDA205422, Otsuka America Pharmaceutical, Inc.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=205422"
}
],
"guidelines": [
{
"id": "PA166160054",
"name": "Annotation of FDA Label for brexpiprazole and CYP2D6",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166160054",
"annotations": []
}
]
},
"brivaracetam": {
"name": "brivaracetam",
"id": "PA166153491",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166153492"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Briviact (brivaracetam), NDA205836, UCB, Inc.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=205836"
},
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Briviact (brivaracetam), UCB, Inc. - NDA205836/SUPPL-14, 05/17/2023",
"journal": null,
"year": 2023,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=205836"
}
],
"guidelines": [
{
"id": "PA166153492",
"name": "Annotation of FDA Label for brivaracetam and CYP2C19",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166153492",
"annotations": []
}
]
},
"bupivacaine": {
"name": "bupivacaine",
"id": "PA135057240",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166235441"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Marcaine Spinal (Bupivacaine Hydrochloride in Dextrose), Hospira, Inc. - NDA018692/SUPPL-24, 09/28/2022",
"journal": null,
"year": 2022,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=018692"
}
],
"guidelines": [
{
"id": "PA166235441",
"name": "Annotation of FDA Label for bupivacaine and CYB5R3, G6PD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166235441",
"annotations": []
}
]
},
"capecitabine": {
"name": "capecitabine",
"id": "PA448771",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104802"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Xeloda (capecitabine), NDA020896, Genentech, Inc.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=020896"
},
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Xeloda (capecitabine), H2-Pharma, LLC - NDA020896/SUPPL-52, 10/03/2025",
"journal": null,
"year": 2025,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=020896"
}
],
"guidelines": [
{
"id": "PA166104802",
"name": "Annotation of FDA Label for capecitabine and DPYD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104802",
"annotations": []
}
]
},
"carbamazepine": {
"name": "carbamazepine",
"id": "PA448785",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166151882",
"https://www.clinpgx.org/labelAnnotation/PA166104780"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Tegretol (carbamazepine), NDA016608, REMEDYREPACK INC.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=016608"
}
],
"guidelines": [
{
"id": "PA166151882",
"name": "Annotation of FDA Label for carbamazepine and HLA-A",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166151882",
"annotations": []
},
{
"id": "PA166104780",
"name": "Annotation of FDA Label for carbamazepine and HLA-B",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104780",
"annotations": [
{
"implications": [],
"drugRecommendation": ""Tegretol [carbamazepine] should not be used in patients positive for HLAB*1502 unless the benefits clearly outweigh the risks." See label for more information.",
"classification": "Unspecified",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "HLA-B",
"name": "*15:02",
"function": null,
"reference": false,
"activityValue": null
},
"allele2": {
"gene": "HLA-B",
"name": "*57:01",
"function": null,
"reference": false,
"activityValue": null
},
"gene": "HLA-B",
"matchScore": 0,
"phenotypes": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"label": "*15:02/*57:01",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": true,
"otherPrescribingGuidance": false,
"phenotypes": {
"HLA-B": "*15:02 positive"
},
"lookupKey": [
{
"HLA-B": "*15:02 positive"
}
]
}
]
}
]
},
"carisoprodol": {
"name": "carisoprodol",
"id": "PA448809",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104832"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Soma (Carisoprodol), NDA011792, Rebel Distributors Corp",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=011792"
}
],
"guidelines": [
{
"id": "PA166104832",
"name": "Annotation of FDA Label for carisoprodol and CYP2C19",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104832",
"annotations": []
}
]
},
"celecoxib": {
"name": "celecoxib",
"id": "PA448871",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104843"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product CELEBREX (Celecoxib), NDA020998, Aphena Pharma Solutions - Tennessee, LLC",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=020998"
},
{
"pmid": null,
"title": "Drugs@FDA: Drug Product ELYXYB - celecoxib (celecoxib), SCILEX PHARMACEUTICALS INC. - NDA212157/SUPPL-3, 11/21/2024",
"journal": null,
"year": 2024,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=212157"
}
],
"guidelines": [
{
"id": "PA166104843",
"name": "Annotation of FDA Label for celecoxib and CYP2C9",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104843",
"annotations": []
}
]
},
"cevimeline": {
"name": "cevimeline",
"id": "PA164754754",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104787"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Cevimeline (Cevimeline), NDA020989, Sun Pharmaceutical Industries, Inc.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=020989"
}
],
"guidelines": [
{
"id": "PA166104787",
"name": "Annotation of FDA Label for cevimeline and CYP2D6",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104787",
"annotations": []
}
]
},
"chloroquine": {
"name": "chloroquine",
"id": "PA448948",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "G6PD hemizygous samples",
"version": "2",
"matches": {
"gene": "G6PD",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"aminosalicylic acid",
"aspirin",
"chloramphenicol",
"chloroquine",
"ciprofloxacin",
"dapsone",
"dimercaprol",
"doxorubicin",
"furazolidone",
"glyburide",
"hydroxychloroquine",
"mafenide",
"methylene blue",
"nalidixic acid",
"nitrofurantoin",
"norfloxacin",
"ofloxacin",
"pegloticase",
"phenazopyridine",
"primaquine",
"quinine",
"rasburicase",
"sulfadiazine",
"sulfadimidine",
"sulfamethoxazole",
"trimethoprim",
"sulfanilamide",
"sulfasalazine",
"sulfisoxazole",
"tafenoquine",
"tolbutamide",
"toluidine blue",
"vitamin c",
"vitamin k"
]
},
"exception_type": "note",
"message": "PharmCAT reports based on VCF file input and some VCF files do not specify hemizygous (one X chromosome) and instead represent samples as homozygous. See PharmCAT FAQs (https://pharmcat.org/faqs/)."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104786"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product chloroquine (NDA006002)",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=006002"
}
],
"guidelines": [
{
"id": "PA166104786",
"name": "Annotation of FDA Label for chloroquine and G6PD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104786",
"annotations": []
}
]
},
"chlorpropamide": {
"name": "chlorpropamide",
"id": "PA448966",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166114910"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product chlorpropamide (NDA011641)",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=011641"
}
],
"guidelines": [
{
"id": "PA166114910",
"name": "Annotation of FDA Label for chlorpropamide and G6PD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166114910",
"annotations": []
}
]
},
"citalopram": {
"name": "citalopram",
"id": "PA449015",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104852"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Celexa (citalopram), NDA020822, Allergan, Inc.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=020822"
}
],
"guidelines": [
{
"id": "PA166104852",
"name": "Annotation of FDA Label for citalopram and CYP2C19",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104852",
"annotations": []
}
]
},
"clobazam": {
"name": "clobazam",
"id": "PA10888",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104884"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Onfi (clobazam), NDA202067, Lundbeck Pharmaceuticals LLC",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=202067"
}
],
"guidelines": [
{
"id": "PA166104884",
"name": "Annotation of FDA Label for clobazam and CYP2C19",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104884",
"annotations": []
}
]
},
"clopidogrel": {
"name": "clopidogrel",
"id": "PA449053",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104777"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Plavix (clopidogrel bisulfate), NDA020839, Rebel Distributors Corp",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=020839"
},
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Plavix (clopidogrel), sanofi-aventis U.S. LLC - NDA020839/SUPPL-78, 09/16/2022",
"journal": null,
"year": 2022,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=020839"
}
],
"guidelines": [
{
"id": "PA166104777",
"name": "Annotation of FDA Label for clopidogrel and CYP2C19",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104777",
"annotations": []
}
]
},
"clozapine": {
"name": "clozapine",
"id": "PA449061",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104815"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Clozaril (clozapine), NDA019758, HLS Therapeutics (USA), Inc.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=019758"
}
],
"guidelines": [
{
"id": "PA166104815",
"name": "Annotation of FDA Label for clozapine and CYP2D6",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104815",
"annotations": []
}
]
},
"codeine": {
"name": "codeine",
"id": "PA449088",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104916"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Codeine sulfate (codeine sulfate), NDA022402, West-Ward Pharmaceuticals Corp.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=022402"
}
],
"guidelines": [
{
"id": "PA166104916",
"name": "Annotation of FDA Label for codeine and CYP2D6",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104916",
"annotations": []
}
]
},
"dabrafenib": {
"name": "dabrafenib",
"id": "PA166114911",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166114913"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Tafinlar (dabrafenib), Novartis Pharmaceuticals Corporation - NDA202806/SUPPL-31, 07/11/2024",
"journal": null,
"year": 2024,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=202806"
}
],
"guidelines": [
{
"id": "PA166114913",
"name": "Annotation of FDA Label for dabrafenib and G6PD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166114913",
"annotations": []
}
]
},
"dapsone": {
"name": "dapsone",
"id": "PA449211",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "G6PD hemizygous samples",
"version": "2",
"matches": {
"gene": "G6PD",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"aminosalicylic acid",
"aspirin",
"chloramphenicol",
"chloroquine",
"ciprofloxacin",
"dapsone",
"dimercaprol",
"doxorubicin",
"furazolidone",
"glyburide",
"hydroxychloroquine",
"mafenide",
"methylene blue",
"nalidixic acid",
"nitrofurantoin",
"norfloxacin",
"ofloxacin",
"pegloticase",
"phenazopyridine",
"primaquine",
"quinine",
"rasburicase",
"sulfadiazine",
"sulfadimidine",
"sulfamethoxazole",
"trimethoprim",
"sulfanilamide",
"sulfasalazine",
"sulfisoxazole",
"tafenoquine",
"tolbutamide",
"toluidine blue",
"vitamin c",
"vitamin k"
]
},
"exception_type": "note",
"message": "PharmCAT reports based on VCF file input and some VCF files do not specify hemizygous (one X chromosome) and instead represent samples as homozygous. See PharmCAT FAQs (https://pharmcat.org/faqs/)."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166344801"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product DAPSONE (dapsone), Pacific Pharma, Inc. - NDA021794/SUPPL-16, 05/18/2018",
"journal": null,
"year": 2018,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=021794"
}
],
"guidelines": [
{
"id": "PA166344801",
"name": "Annotation of FDA Label for dapsone and G6PD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166344801",
"annotations": []
}
]
},
"desflurane": {
"name": "desflurane",
"id": "PA164749136",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166129515"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product SUPRANE (desflurane), NDA020118, Baxter Healthcare Corporation",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=020118"
}
],
"guidelines": [
{
"id": "PA166129515",
"name": "Annotation of FDA Label for desflurane and CACNA1S, RYR1",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166129515",
"annotations": [
{
"implications": [],
"drugRecommendation": ""The use of SUPRANE [desflurane] is contraindicated in...[cases of k]nown or suspected genetic susceptibility to malignant hyperthermia...SUPRANE [desflurane] can induce malignant hyperthermia in patients with known or suspected susceptibility based on genetic factors or family history, including those with certain inherited ryanodine receptor (RYR1) or dihydropyridine receptor (CACNA1S) variants. " See label for more information.",
"classification": "Unspecified",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CACNA1S",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CACNA1S",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CACNA1S",
"matchScore": 4,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
},
{
"allele1": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "RYR1",
"matchScore": 0,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": [
{
"allele1": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "RYR1",
"matchScore": 626,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
],
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": true,
"otherPrescribingGuidance": false,
"phenotypes": {
"CACNA1S": "Uncertain Susceptibility",
"RYR1": "Uncertain Susceptibility"
},
"lookupKey": [
{
"RYR1": "Uncertain Susceptibility",
"CACNA1S": "Uncertain Susceptibility"
}
]
}
]
}
]
},
"deuruxolitinib": {
"name": "deuruxolitinib",
"id": "PA166400021",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166400362"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product LEQSELVI (deuruxolitinib), NDA217900/ORIG-1, 07/25/2024",
"journal": null,
"year": 2024,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=217900"
}
],
"guidelines": [
{
"id": "PA166400362",
"name": "Annotation of FDA Label for deuruxolitinib and CYP2C9",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166400362",
"annotations": []
}
]
},
"deutetrabenazine": {
"name": "deutetrabenazine",
"id": "PA166169881",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166169882"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Austedo (Deutetrabenazine), NDA208082, Teva Neuroscience, Inc.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=208082"
}
],
"guidelines": [
{
"id": "PA166169882",
"name": "Annotation of FDA Label for deutetrabenazine and CYP2D6",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166169882",
"annotations": []
}
]
},
"dextromethorphan / quinidine": {
"name": "dextromethorphan / quinidine",
"id": "PA166175998",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104886"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Nuedexta (dextromethorphan hydrobromide and quinidine sulfate), Otsuka America Pharmaceutical, Inc - NDA021879/SUPPL-14, 06/11/2019",
"journal": null,
"year": 2019,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=021879"
}
],
"guidelines": [
{
"id": "PA166104886",
"name": "Annotation of FDA Label for dextromethorphan / quinidine and CYP2D6",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104886",
"annotations": []
}
]
},
"dextromethorphan hydrobromide / bupropion hydrochloride": {
"name": "dextromethorphan hydrobromide / bupropion hydrochloride",
"id": "PA166278341",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166278361"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA Drug Product: AUVELITY (dextromethorphan hydrobromide / bupropion hydrochloride)",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=215430"
},
{
"pmid": null,
"title": "Drugs@FDA: Drug Product AUVELITY (dextromethorphan hydrobromide, bupropion hydrochloride), Axsome Therapeutics, Inc. - NDA215430/SUPPL-8, 05/07/2024",
"journal": null,
"year": 2024,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=215430"
}
],
"guidelines": [
{
"id": "PA166278361",
"name": "Annotation of FDA Label for dextromethorphan hydrobromide / bupropion hydrochloride and CYP2D6",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166278361",
"annotations": []
}
]
},
"dronabinol": {
"name": "dronabinol",
"id": "PA449421",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166163422"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product SYNDROS (Dronabinol), NDA205525, Insys Therapeutics, Inc.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=205525"
},
{
"pmid": null,
"title": "Drugs@FDA: Drug Product SYNDROS (Dronabinol), Benuvia Operations, LLC - NDA205525/SUPPL-13, 05/17/2024",
"journal": null,
"year": 2024,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=205525"
}
],
"guidelines": [
{
"id": "PA166163422",
"name": "Annotation of FDA Label for dronabinol and CYP2C9",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166163422",
"annotations": []
}
]
},
"eliglustat": {
"name": "eliglustat",
"id": "PA166123486",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166123487"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Cerdelga (eliglustat), Genzyme Corporation - NDA205494/SUPPL-3, 08/29/2018",
"journal": null,
"year": 2018,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=205494"
}
],
"guidelines": [
{
"id": "PA166123487",
"name": "Annotation of FDA Label for eliglustat and CYP2D6",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166123487",
"annotations": [
{
"implications": [],
"drugRecommendation": "CYP2D6 IMs have a recommended dose of 84 mg orally twice daily.",
"classification": "Unspecified",
"activityScore": {
"CYP2D6": "1.0"
},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2D6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2D6",
"name": "*3",
"function": "No function",
"reference": false,
"activityValue": "0.0"
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "1.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"1.0"
],
"label": "*1/*3",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2D6": "Intermediate Metabolizer"
},
"lookupKey": [
{
"CYP2D6": "1.0"
}
]
}
]
}
]
},
"eltrombopag": {
"name": "eltrombopag",
"id": "PA165981594",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104912"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product PROMACTA (eltrombopag olamine), NDA022291, Novartis Pharmaceuticals Corporation",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=022291"
}
],
"guidelines": [
{
"id": "PA166104912",
"name": "Annotation of FDA Label for eltrombopag and F5, SERPINC1",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104912",
"annotations": []
}
]
},
"erdafitinib": {
"name": "erdafitinib",
"id": "PA166182720",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166182722"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product BALVERSA (Erdafitinib), Janssen Products LP - NDA212018/SUPPL-9, 01/19/2024",
"journal": null,
"year": 2024,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=212018"
}
],
"guidelines": [
{
"id": "PA166182722",
"name": "Annotation of FDA Label for erdafitinib and CYP2C9",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166182722",
"annotations": []
}
]
},
"ethinyl estradiol / norelgestromin": {
"name": "ethinyl estradiol / norelgestromin",
"id": "PA165290929",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166414701"
],
"citations": [],
"guidelines": [
{
"id": "PA166414701",
"name": "Annotation of FDA Label for ethinyl estradiol / norelgestromin and F5, PROC, PROS1, SERPINC1",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166414701",
"annotations": []
}
]
},
"flibanserin": {
"name": "flibanserin",
"id": "PA166153431",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166345022"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product ADDYI (flibanserin), Sprout Pharmaceuticals, Inc. - NDA022526/SUPPL-10, 09/29/2021",
"journal": null,
"year": 2021,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=022526"
}
],
"guidelines": [
{
"id": "PA166345022",
"name": "Annotation of FDA Label for flibanserin and CYP2C19",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166345022",
"annotations": []
}
]
},
"fluorouracil": {
"name": "fluorouracil",
"id": "PA128406956",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104807"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Carac (fluorouracil), Bausch Health US, LLC - NDA020985/SUPPL-19, 05/26/2022",
"journal": null,
"year": 2022,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=020985"
},
{
"pmid": null,
"title": "Drugs@FDA: Drug Product FLUOROURACIL (FLUOROURACIL), Eugia US LLC - ANDA202669/SUPPL-9, 03/21/2024",
"journal": null,
"year": 2024,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=202669"
},
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Fluorouracil (Fluorouracil), BluePoint Laboratories - ANDA210124/SUPPL-9, 03/21/2024",
"journal": null,
"year": 2024,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=210124"
}
],
"guidelines": [
{
"id": "PA166104807",
"name": "Annotation of FDA Label for fluorouracil and DPYD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104807",
"annotations": []
}
]
},
"fluoxetine": {
"name": "fluoxetine",
"id": "PA449673",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104835"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Prozac Weekly (Fluoxetine hydrochloride), NDA021235, Eli Lilly and Company",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=021235"
}
],
"guidelines": [
{
"id": "PA166104835",
"name": "Annotation of FDA Label for fluoxetine and CYP2D6",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104835",
"annotations": []
}
]
},
"fluoxetine / olanzapine": {
"name": "fluoxetine / olanzapine",
"id": "PA166176027",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104788"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Symbyax (Olanzapine and Fluoxetine hydrochloride), NDA021520, Eli Lilly and Company",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=021520"
}
],
"guidelines": [
{
"id": "PA166104788",
"name": "Annotation of FDA Label for fluoxetine / olanzapine and CYP2D6",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104788",
"annotations": []
}
]
},
"flurbiprofen": {
"name": "flurbiprofen",
"id": "PA449683",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104922"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product FLURBIPROFEN SODIUM (flurbiprofen sodium), NDA019404, Rebel Distributors Corp",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=019404"
},
{
"pmid": null,
"title": "Drugs@FDA: Drug Product flurbiprofen (NDA018766)",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=018766"
}
],
"guidelines": [
{
"id": "PA166104922",
"name": "Annotation of FDA Label for flurbiprofen and CYP2C9",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104922",
"annotations": []
}
]
},
"flutamide": {
"name": "flutamide",
"id": "PA449685",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166182765"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product flutamide (NDA018554)",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=018554"
}
],
"guidelines": [
{
"id": "PA166182765",
"name": "Annotation of FDA Label for flutamide and G6PD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166182765",
"annotations": []
}
]
},
"fluvoxamine": {
"name": "fluvoxamine",
"id": "PA449690",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104854"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product fluvoxamine maleate (Fluvoxamine maleate), NDA021519, Bryant Ranch Prepack",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=021519"
}
],
"guidelines": [
{
"id": "PA166104854",
"name": "Annotation of FDA Label for fluvoxamine and CYP2D6",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104854",
"annotations": [
{
"implications": [],
"drugRecommendation": "The fluvoxamine label states: "Caution is indicated in patients known to have reduced levels of cytochrome P450 2D6 activity[...]" See label for more information.",
"classification": "Unspecified",
"activityScore": {
"CYP2D6": "1.0"
},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2D6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2D6",
"name": "*3",
"function": "No function",
"reference": false,
"activityValue": "0.0"
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "1.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"1.0"
],
"label": "*1/*3",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": true,
"phenotypes": {
"CYP2D6": "Intermediate Metabolizer"
},
"lookupKey": [
{
"CYP2D6": "1.0"
}
]
}
]
}
]
},
"fosphenytoin": {
"name": "fosphenytoin",
"id": "PA164746820",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "Phenytoin_HLA-B warning",
"version": "1",
"matches": {
"gene": null,
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"phenytoin",
"fosphenytoin"
]
},
"exception_type": "note",
"message": "The displayed recommendation for CYP2C9 and phenytoin is ONLY valid for non-carriers of the HLA-B*15:02 high-risk allele. PharmCAT Named Allele Matcher does not determine HLA status. CPIC guidance: Fos-/Phenytoin is contraindicated in individuals with the HLA-B*15:02 variant allele (\"HLA-B*15:02-positive\") due to significantly increased risk of fos-/phenytoin-induced cutaneous adverse reactions of Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN). In HLA-B*15:02 carriers, carbamazepine should not be used as an alternative. Alternative medications such as oxcarbazepine, eslicarbazepine acetate, and lamotrigine have some evidence linking SJS/TEN with the HLA-B*15:02 allele, and thus caution should be used in choosing alternatives to phenytoin."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166182766"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product CEREBYX (Fosphenytoin Sodium), NDA020450, Pfizer Laboratories Div Pfizer Inc",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=020450"
}
],
"guidelines": [
{
"id": "PA166182766",
"name": "Annotation of FDA Label for fosphenytoin and CYP2C9, HLA-B",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166182766",
"annotations": [
{
"implications": [],
"drugRecommendation": ""Consider avoiding CEREBYX [fosphenytoin] as an alternative to carbamazepine in patients who are positive for HLA-B*1502 or in CYP2C9*3 carriers." See label for more information.",
"classification": "Unspecified",
"activityScore": {
"CYP2C9": "2.0",
"HLA-B": "n/a"
},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "CYP2C9",
"matchScore": 166,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
},
{
"allele1": {
"gene": "HLA-B",
"name": "*15:02",
"function": null,
"reference": false,
"activityValue": null
},
"allele2": {
"gene": "HLA-B",
"name": "*57:01",
"function": null,
"reference": false,
"activityValue": null
},
"gene": "HLA-B",
"matchScore": 0,
"phenotypes": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"label": "*15:02/*57:01",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": true,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C9": "Normal Metabolizer",
"HLA-B": "*15:02 positive"
},
"lookupKey": [
{
"HLA-B": "*15:02 positive",
"CYP2C9": "2.0"
}
]
}
]
}
]
},
"gefitinib": {
"name": "gefitinib",
"id": "PA131301952",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166170929"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product IRESSA (Gefitinib), NDA206995, AstraZeneca Pharmaceuticals LP",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=206995"
}
],
"guidelines": [
{
"id": "PA166170929",
"name": "Annotation of FDA Label for gefitinib and CYP2D6",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166170929",
"annotations": []
}
]
},
"gentamicin": {
"name": "gentamicin",
"id": "PA449753",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166316381"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Gentamicin Sulfate in Sodium Chloride (Gentamicin Sulfate), ANDA062373, Baxter Healthcare Corporation",
"journal": null,
"year": 2023,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=062373"
}
],
"guidelines": [
{
"id": "PA166316381",
"name": "Annotation of FDA Label for gentamicin and MT-RNR1",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166316381",
"annotations": []
}
]
},
"glimepiride": {
"name": "glimepiride",
"id": "PA449761",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166105147"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product AMARYL (glimepiride), NDA020496, Sanofi-Aventis U.S. LLC",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=020496"
}
],
"guidelines": [
{
"id": "PA166105147",
"name": "Annotation of FDA Label for glimepiride and G6PD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166105147",
"annotations": []
}
]
},
"glipizide": {
"name": "glipizide",
"id": "PA449762",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166105148"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Glucotrol (glipizide), NDA017783, Roerig",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=017783"
}
],
"guidelines": [
{
"id": "PA166105148",
"name": "Annotation of FDA Label for glipizide and G6PD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166105148",
"annotations": []
}
]
},
"glyburide": {
"name": "glyburide",
"id": "PA449782",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "G6PD hemizygous samples",
"version": "2",
"matches": {
"gene": "G6PD",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"aminosalicylic acid",
"aspirin",
"chloramphenicol",
"chloroquine",
"ciprofloxacin",
"dapsone",
"dimercaprol",
"doxorubicin",
"furazolidone",
"glyburide",
"hydroxychloroquine",
"mafenide",
"methylene blue",
"nalidixic acid",
"nitrofurantoin",
"norfloxacin",
"ofloxacin",
"pegloticase",
"phenazopyridine",
"primaquine",
"quinine",
"rasburicase",
"sulfadiazine",
"sulfadimidine",
"sulfamethoxazole",
"trimethoprim",
"sulfanilamide",
"sulfasalazine",
"sulfisoxazole",
"tafenoquine",
"tolbutamide",
"toluidine blue",
"vitamin c",
"vitamin k"
]
},
"exception_type": "note",
"message": "PharmCAT reports based on VCF file input and some VCF files do not specify hemizygous (one X chromosome) and instead represent samples as homozygous. See PharmCAT FAQs (https://pharmcat.org/faqs/)."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104881"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Glynase (glyburide), NDA020051, Pharmacia and Upjohn Company LLC",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=020051"
}
],
"guidelines": [
{
"id": "PA166104881",
"name": "Annotation of FDA Label for glyburide and G6PD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104881",
"annotations": []
}
]
},
"hydralazine": {
"name": "hydralazine",
"id": "PA449894",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166356321"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Hydralazine Hydrochloride (Hydralazine Hydrochloride), American Regent, Inc. - ANDA040136/SUPPL-5, 04/26/2013",
"journal": null,
"year": 2013,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=040136"
}
],
"guidelines": [
{
"id": "PA166356321",
"name": "Annotation of FDA Label for hydralazine and NAT2",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166356321",
"annotations": []
}
]
},
"hydroxychloroquine": {
"name": "hydroxychloroquine",
"id": "PA164777036",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "G6PD hemizygous samples",
"version": "2",
"matches": {
"gene": "G6PD",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"aminosalicylic acid",
"aspirin",
"chloramphenicol",
"chloroquine",
"ciprofloxacin",
"dapsone",
"dimercaprol",
"doxorubicin",
"furazolidone",
"glyburide",
"hydroxychloroquine",
"mafenide",
"methylene blue",
"nalidixic acid",
"nitrofurantoin",
"norfloxacin",
"ofloxacin",
"pegloticase",
"phenazopyridine",
"primaquine",
"quinine",
"rasburicase",
"sulfadiazine",
"sulfadimidine",
"sulfamethoxazole",
"trimethoprim",
"sulfanilamide",
"sulfasalazine",
"sulfisoxazole",
"tafenoquine",
"tolbutamide",
"toluidine blue",
"vitamin c",
"vitamin k"
]
},
"exception_type": "note",
"message": "PharmCAT reports based on VCF file input and some VCF files do not specify hemizygous (one X chromosome) and instead represent samples as homozygous. See PharmCAT FAQs (https://pharmcat.org/faqs/)."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166182769"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Plaquenil (Hydroxychloroquine Sulfate), NDA009768, Carilion Materials Management",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=009768"
}
],
"guidelines": [
{
"id": "PA166182769",
"name": "Annotation of FDA Label for hydroxychloroquine and G6PD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166182769",
"annotations": []
}
]
},
"iloperidone": {
"name": "iloperidone",
"id": "PA161199368",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104887"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product FANAPT (Iloperidone), NDA022192, Avera McKennan Hospital",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=022192"
},
{
"pmid": null,
"title": "Drugs@FDA: Drug Product FANAPT (ILOPERIDONE), Vanda Pharmaceuticals Inc. - NDA022192/SUPPL-24, 01/22/2025",
"journal": null,
"year": 2025,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=022192"
}
],
"guidelines": [
{
"id": "PA166104887",
"name": "Annotation of FDA Label for iloperidone and CYP2D6",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104887",
"annotations": []
}
]
},
"irinotecan": {
"name": "irinotecan",
"id": "PA450085",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104831"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Camptosar (irinotecan hydrochloride), Pharmacia & Upjohn Company LLC - NDA020571/SUPPL-53, 01/27/2022",
"journal": null,
"year": 2022,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=020571"
},
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Onivyde (IRINOTECAN HYDROCHLORIDE), Ipsen Biopharmaceuticals, Inc. - NDA207793/SUPPL-16, 02/13/2024",
"journal": null,
"year": 2024,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=207793"
}
],
"guidelines": [
{
"id": "PA166104831",
"name": "Annotation of FDA Label for irinotecan and UGT1A1",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104831",
"annotations": []
}
]
},
"isoflurane": {
"name": "isoflurane",
"id": "PA450106",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166129517"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product FORANE (isoflurane), NDA017624, Baxter Healthcare Corporation",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=017624"
}
],
"guidelines": [
{
"id": "PA166129517",
"name": "Annotation of FDA Label for isoflurane and CACNA1S, RYR1",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166129517",
"annotations": [
{
"implications": [],
"drugRecommendation": ""CONTRAINDICATIONS...with known or suspected genetic susceptibility to malignant hyperthermia...FORANE [isoflurane] can induce malignant hyperthermia in patients with known or suspected susceptibility based on genetic factors or family history, including those with certain inherited ryanodine receptor (RYR1) or dihydropyridine receptor (CACNA1S) variants." See label for more information.",
"classification": "Unspecified",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CACNA1S",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CACNA1S",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CACNA1S",
"matchScore": 4,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
},
{
"allele1": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "RYR1",
"matchScore": 0,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": [
{
"allele1": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "RYR1",
"matchScore": 626,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
],
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": true,
"otherPrescribingGuidance": false,
"phenotypes": {
"CACNA1S": "Uncertain Susceptibility",
"RYR1": "Uncertain Susceptibility"
},
"lookupKey": [
{
"RYR1": "Uncertain Susceptibility",
"CACNA1S": "Uncertain Susceptibility"
}
]
}
]
}
]
},
"ivacaftor": {
"name": "ivacaftor",
"id": "PA165950341",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104890"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Kalydeco (ivacaftor), NDA203188, Vertex Pharmaceuticals Incorporated",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=203188"
}
],
"guidelines": [
{
"id": "PA166104890",
"name": "Annotation of FDA Label for ivacaftor and CFTR",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104890",
"annotations": []
}
]
},
"lesinurad": {
"name": "lesinurad",
"id": "PA166160006",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166160007"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Zurampic (lesinurad), NDA207988, Ironwood Pharmaceuticals, Inc.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=207988"
}
],
"guidelines": [
{
"id": "PA166160007",
"name": "Annotation of FDA Label for lesinurad and CYP2C9",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166160007",
"annotations": []
}
]
},
"lidocaine / prilocaine": {
"name": "lidocaine / prilocaine",
"id": "PA166176018",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166105178"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Oraqix (lidocaine and prilocaine), Dentsply Pharmaceutical - NDA021451/SUPPL-14, 11/02/2018",
"journal": null,
"year": 2018,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=021451"
}
],
"guidelines": [
{
"id": "PA166105178",
"name": "Annotation of FDA Label for lidocaine / prilocaine and CYB5R3, G6PD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166105178",
"annotations": []
}
]
},
"lidocaine and tetracaine": {
"name": "lidocaine and tetracaine",
"id": "PA166182735",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166182737"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Synera (lidocaine and tetracaine), NDA021623, Galen US Incorporated",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=021623"
}
],
"guidelines": [
{
"id": "PA166182737",
"name": "Annotation of FDA Label for lidocaine and tetracaine and G6PD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166182737",
"annotations": []
}
]
},
"lofexidine": {
"name": "lofexidine",
"id": "PA164744510",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166179848"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Lucemyra (lofexidine hydrochloride), NDA209229, US WorldMeds, LLC",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=209229"
}
],
"guidelines": [
{
"id": "PA166179848",
"name": "Annotation of FDA Label for lofexidine and CYP2D6",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166179848",
"annotations": []
}
]
},
"lusutrombopag": {
"name": "lusutrombopag",
"id": "PA166182748",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166182749"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Mulpleta (Lusutrombopag), SHIONOGI INC. - NDA210923/ORIG-1, 07/31/2018",
"journal": null,
"year": 2018,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=210923"
}
],
"guidelines": [
{
"id": "PA166182749",
"name": "Annotation of FDA Label for lusutrombopag and F2, F5, PROC, PROS1, SERPINC1",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166182749",
"annotations": []
}
]
},
"meclizine": {
"name": "meclizine",
"id": "PA450338",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166180000"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product meclizine (NDA010721)",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=010721"
}
],
"guidelines": [
{
"id": "PA166180000",
"name": "Annotation of FDA Label for meclizine and CYP2D6",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166180000",
"annotations": [
{
"implications": [],
"drugRecommendation": "The meclizine (ANTIVERT) label states: "... when ANTIVERT® is administered to patients with CYP2D6 polymorphism, monitor for adverse reactions and clinical effect accordingly." "The genetic polymorphism of CYP2D6 that results in poor-, intermediate-, extensive-, and ultrarapid metabolizer phenotypes could contribute to large inter-individual variability in meclizine exposure." See label for more information.",
"classification": "Unspecified",
"activityScore": {
"CYP2D6": "1.0"
},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2D6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2D6",
"name": "*3",
"function": "No function",
"reference": false,
"activityValue": "0.0"
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "1.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"1.0"
],
"label": "*1/*3",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": true,
"phenotypes": {
"CYP2D6": "Intermediate Metabolizer"
},
"lookupKey": [
{
"CYP2D6": "1.0"
}
]
}
]
}
]
},
"mepivacaine": {
"name": "mepivacaine",
"id": "PA164748741",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166182751"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Carbocaine (Mepivacaine Hydrochloride), NDA012250, Hospira, Inc.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=012250"
}
],
"guidelines": [
{
"id": "PA166182751",
"name": "Annotation of FDA Label for mepivacaine and G6PD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166182751",
"annotations": []
}
]
},
"mercaptopurine": {
"name": "mercaptopurine",
"id": "PA450379",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104810"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product PURINETHOL (Mercaptopurine), Quinn Pharmaceuticals - NDA009053/SUPPL-40, 12/29/2020",
"journal": null,
"year": 2020,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=009053"
},
{
"pmid": null,
"title": "Drugs@FDA: Drug Product PURIXAN (mercaptopurine), Nova Laboratories, Ltd - NDA205919/SUPPL-4, 04/07/2020",
"journal": null,
"year": 2020,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=205919"
}
],
"guidelines": [
{
"id": "PA166104810",
"name": "Annotation of FDA Label for mercaptopurine and NUDT15, TPMT",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104810",
"annotations": []
}
]
},
"methylene blue": {
"name": "methylene blue",
"id": "PA450457",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "G6PD hemizygous samples",
"version": "2",
"matches": {
"gene": "G6PD",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"aminosalicylic acid",
"aspirin",
"chloramphenicol",
"chloroquine",
"ciprofloxacin",
"dapsone",
"dimercaprol",
"doxorubicin",
"furazolidone",
"glyburide",
"hydroxychloroquine",
"mafenide",
"methylene blue",
"nalidixic acid",
"nitrofurantoin",
"norfloxacin",
"ofloxacin",
"pegloticase",
"phenazopyridine",
"primaquine",
"quinine",
"rasburicase",
"sulfadiazine",
"sulfadimidine",
"sulfamethoxazole",
"trimethoprim",
"sulfanilamide",
"sulfasalazine",
"sulfisoxazole",
"tafenoquine",
"tolbutamide",
"toluidine blue",
"vitamin c",
"vitamin k"
]
},
"exception_type": "note",
"message": "PharmCAT reports based on VCF file input and some VCF files do not specify hemizygous (one X chromosome) and instead represent samples as homozygous. See PharmCAT FAQs (https://pharmcat.org/faqs/)."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104878"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product PROVAYBLUE (methylene blue), NDA204630, American Regent, Inc.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=204630"
}
],
"guidelines": [
{
"id": "PA166104878",
"name": "Annotation of FDA Label for methylene blue and G6PD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104878",
"annotations": []
}
]
},
"metoclopramide": {
"name": "metoclopramide",
"id": "PA450475",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166178750"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Reglan (Metoclopramide Hydrochloride), ANI Pharmaceuticals, Inc. - NDA017854/SUPPL-62, 08/29/2017",
"journal": null,
"year": 2017,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=017854"
}
],
"guidelines": [
{
"id": "PA166178750",
"name": "Annotation of FDA Label for metoclopramide and CYP2D6",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166178750",
"annotations": []
}
]
},
"moviprep": {
"name": "moviprep",
"id": "PA166163260",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104897"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product MoviPrep (POLYETHYLENE GLYCOL 3350, SODIUM SULFATE, SODIUM CHLORIDE, POTASSIUM CHLORIDE, ASCORBIC ACID, SODIUM ASCORBATE), NDA021881, Salix Pharmaceuticals, Inc.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=021881"
}
],
"guidelines": [
{
"id": "PA166104897",
"name": "Annotation of FDA Label for moviprep and G6PD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104897",
"annotations": []
}
]
},
"nalidixic acid": {
"name": "nalidixic acid",
"id": "PA164746384",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "G6PD hemizygous samples",
"version": "2",
"matches": {
"gene": "G6PD",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"aminosalicylic acid",
"aspirin",
"chloramphenicol",
"chloroquine",
"ciprofloxacin",
"dapsone",
"dimercaprol",
"doxorubicin",
"furazolidone",
"glyburide",
"hydroxychloroquine",
"mafenide",
"methylene blue",
"nalidixic acid",
"nitrofurantoin",
"norfloxacin",
"ofloxacin",
"pegloticase",
"phenazopyridine",
"primaquine",
"quinine",
"rasburicase",
"sulfadiazine",
"sulfadimidine",
"sulfamethoxazole",
"trimethoprim",
"sulfanilamide",
"sulfasalazine",
"sulfisoxazole",
"tafenoquine",
"tolbutamide",
"toluidine blue",
"vitamin c",
"vitamin k"
]
},
"exception_type": "note",
"message": "PharmCAT reports based on VCF file input and some VCF files do not specify hemizygous (one X chromosome) and instead represent samples as homozygous. See PharmCAT FAQs (https://pharmcat.org/faqs/)."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104891"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product nalidixic acid (NDA014214)",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=014214"
}
],
"guidelines": [
{
"id": "PA166104891",
"name": "Annotation of FDA Label for nalidixic acid and G6PD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104891",
"annotations": []
}
]
},
"nitrofurantoin": {
"name": "nitrofurantoin",
"id": "PA450640",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "G6PD hemizygous samples",
"version": "2",
"matches": {
"gene": "G6PD",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"aminosalicylic acid",
"aspirin",
"chloramphenicol",
"chloroquine",
"ciprofloxacin",
"dapsone",
"dimercaprol",
"doxorubicin",
"furazolidone",
"glyburide",
"hydroxychloroquine",
"mafenide",
"methylene blue",
"nalidixic acid",
"nitrofurantoin",
"norfloxacin",
"ofloxacin",
"pegloticase",
"phenazopyridine",
"primaquine",
"quinine",
"rasburicase",
"sulfadiazine",
"sulfadimidine",
"sulfamethoxazole",
"trimethoprim",
"sulfanilamide",
"sulfasalazine",
"sulfisoxazole",
"tafenoquine",
"tolbutamide",
"toluidine blue",
"vitamin c",
"vitamin k"
]
},
"exception_type": "note",
"message": "PharmCAT reports based on VCF file input and some VCF files do not specify hemizygous (one X chromosome) and instead represent samples as homozygous. See PharmCAT FAQs (https://pharmcat.org/faqs/)."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104903"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Furadantin (Nitrofurantoin), NDA009175, Casper Pharma LLC",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=009175"
}
],
"guidelines": [
{
"id": "PA166104903",
"name": "Annotation of FDA Label for nitrofurantoin and G6PD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104903",
"annotations": []
}
]
},
"oliceridine": {
"name": "oliceridine",
"id": "PA166223601",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166225161"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product OLINVYK (OLICERIDINE), NDA210730, Trevena, Inc.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=210730"
}
],
"guidelines": [
{
"id": "PA166225161",
"name": "Annotation of FDA Label for oliceridine and CYP2D6",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166225161",
"annotations": []
}
]
},
"oxcarbazepine": {
"name": "oxcarbazepine",
"id": "PA450732",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166105213"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product OXTELLAR XR (OXCARBAZEPINE), NDA202810, Supernus Pharmaceuticals, Inc.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=202810"
},
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Oxtellar XR (oxcarbazepine), NDA202810/SUPPL-20, 08/14/2024",
"journal": null,
"year": 2024,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=202810"
}
],
"guidelines": [
{
"id": "PA166105213",
"name": "Annotation of FDA Label for oxcarbazepine and HLA-B",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166105213",
"annotations": [
{
"implications": [],
"drugRecommendation": ""The use of oxcarbazepine should be avoided in patients positive for HLA-B*1502 unless the benefits clearly outweigh the risks." See label for more information.",
"classification": "Unspecified",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "HLA-B",
"name": "*15:02",
"function": null,
"reference": false,
"activityValue": null
},
"allele2": {
"gene": "HLA-B",
"name": "*57:01",
"function": null,
"reference": false,
"activityValue": null
},
"gene": "HLA-B",
"matchScore": 0,
"phenotypes": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"label": "*15:02/*57:01",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": true,
"otherPrescribingGuidance": false,
"phenotypes": {
"HLA-B": "*15:02 positive"
},
"lookupKey": [
{
"HLA-B": "*15:02 positive"
}
]
}
]
}
]
},
"oxymetazoline and tetracaine": {
"name": "oxymetazoline and tetracaine",
"id": "PA166182885",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166184637"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product oxymetazoline and tetracaine (NDA208032)",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=208032"
}
],
"guidelines": [
{
"id": "PA166184637",
"name": "Annotation of FDA Label for oxymetazoline and tetracaine and BCHE, CYB5R3, G6PD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166184637",
"annotations": []
}
]
},
"pantoprazole": {
"name": "pantoprazole",
"id": "PA450774",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104901"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Protonix Delayed-Release (PANTOPRAZOLE SODIUM), Wyeth Pharmaceuticals LLC, a subsidiary of Pfizer Inc. - NDA020987/SUPPL-54, 06/07/2018",
"journal": null,
"year": 2018,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=020987"
}
],
"guidelines": [
{
"id": "PA166104901",
"name": "Annotation of FDA Label for pantoprazole and CYP2C19",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104901",
"annotations": []
}
]
},
"pegloticase": {
"name": "pegloticase",
"id": "PA165963961",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "G6PD hemizygous samples",
"version": "2",
"matches": {
"gene": "G6PD",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"aminosalicylic acid",
"aspirin",
"chloramphenicol",
"chloroquine",
"ciprofloxacin",
"dapsone",
"dimercaprol",
"doxorubicin",
"furazolidone",
"glyburide",
"hydroxychloroquine",
"mafenide",
"methylene blue",
"nalidixic acid",
"nitrofurantoin",
"norfloxacin",
"ofloxacin",
"pegloticase",
"phenazopyridine",
"primaquine",
"quinine",
"rasburicase",
"sulfadiazine",
"sulfadimidine",
"sulfamethoxazole",
"trimethoprim",
"sulfanilamide",
"sulfasalazine",
"sulfisoxazole",
"tafenoquine",
"tolbutamide",
"toluidine blue",
"vitamin c",
"vitamin k"
]
},
"exception_type": "note",
"message": "PharmCAT reports based on VCF file input and some VCF files do not specify hemizygous (one X chromosome) and instead represent samples as homozygous. See PharmCAT FAQs (https://pharmcat.org/faqs/)."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104900"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Krystexxa (pegloticase), BLA125293, Horizon Pharma Inc.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=125293"
}
],
"guidelines": [
{
"id": "PA166104900",
"name": "Annotation of FDA Label for pegloticase and G6PD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104900",
"annotations": []
}
]
},
"phenytoin": {
"name": "phenytoin",
"id": "PA450947",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "Phenytoin_HLA-B warning",
"version": "1",
"matches": {
"gene": null,
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"phenytoin",
"fosphenytoin"
]
},
"exception_type": "note",
"message": "The displayed recommendation for CYP2C9 and phenytoin is ONLY valid for non-carriers of the HLA-B*15:02 high-risk allele. PharmCAT Named Allele Matcher does not determine HLA status. CPIC guidance: Fos-/Phenytoin is contraindicated in individuals with the HLA-B*15:02 variant allele (\"HLA-B*15:02-positive\") due to significantly increased risk of fos-/phenytoin-induced cutaneous adverse reactions of Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN). In HLA-B*15:02 carriers, carbamazepine should not be used as an alternative. Alternative medications such as oxcarbazepine, eslicarbazepine acetate, and lamotrigine have some evidence linking SJS/TEN with the HLA-B*15:02 allele, and thus caution should be used in choosing alternatives to phenytoin."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104860"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA Drug Product: DILANTIN (phenytoin), NDA008762, Upjohn",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=008762"
}
],
"guidelines": [
{
"id": "PA166104860",
"name": "Annotation of FDA Label for phenytoin and CYP2C9, HLA-B",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104860",
"annotations": [
{
"implications": [],
"drugRecommendation": ""Consider avoiding DILANTIN [phenytoin] as an alternative to carbamazepine in patients who are positive for HLA-B*1502 or in CYP2C9*3 carriers." See label for more information.",
"classification": "Unspecified",
"activityScore": {
"CYP2C9": "2.0",
"HLA-B": "n/a"
},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "CYP2C9",
"matchScore": 166,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
},
{
"allele1": {
"gene": "HLA-B",
"name": "*15:02",
"function": null,
"reference": false,
"activityValue": null
},
"allele2": {
"gene": "HLA-B",
"name": "*57:01",
"function": null,
"reference": false,
"activityValue": null
},
"gene": "HLA-B",
"matchScore": 0,
"phenotypes": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"label": "*15:02/*57:01",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": true,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C9": "Normal Metabolizer",
"HLA-B": "*15:02 positive"
},
"lookupKey": [
{
"HLA-B": "*15:02 positive",
"CYP2C9": "2.0"
}
]
}
]
}
]
},
"pimozide": {
"name": "pimozide",
"id": "PA450965",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104870"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product ORAP (Pimozide), NDA017473, Teva Select Brands",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=017473"
}
],
"guidelines": [
{
"id": "PA166104870",
"name": "Annotation of FDA Label for pimozide and CYP2D6",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104870",
"annotations": []
}
]
},
"piroxicam": {
"name": "piroxicam",
"id": "PA450985",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166105222"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Feldene (piroxicam), NDA018147, Pfizer Laboratories Div Pfizer Inc",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=018147"
}
],
"guidelines": [
{
"id": "PA166105222",
"name": "Annotation of FDA Label for piroxicam and CYP2C9",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166105222",
"annotations": []
}
]
},
"pitolisant": {
"name": "pitolisant",
"id": "PA166185163",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166185168"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product pitolisant NDA 211150",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=211150"
},
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Wakix (PITOLISANT HYDROCHLORIDE), Harmony Biosciences, LLC - NDA211150/SUPPL-7, 05/23/2025",
"journal": null,
"year": 2025,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=211150"
}
],
"guidelines": [
{
"id": "PA166185168",
"name": "Annotation of FDA Label for pitolisant and CYP2D6",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166185168",
"annotations": []
}
]
},
"plazomicin": {
"name": "plazomicin",
"id": "PA166228921",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166316301"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Zemdri (plazomicin) (Plazomicin), Achaogen, Inc. - NDA210303/SUPPL-7, 02/10/2023",
"journal": null,
"year": 2023,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=210303"
}
],
"guidelines": [
{
"id": "PA166316301",
"name": "Annotation of FDA Label for plazomicin and MT-RNR1",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166316301",
"annotations": []
}
]
},
"primaquine": {
"name": "primaquine",
"id": "PA451103",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "G6PD hemizygous samples",
"version": "2",
"matches": {
"gene": "G6PD",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"aminosalicylic acid",
"aspirin",
"chloramphenicol",
"chloroquine",
"ciprofloxacin",
"dapsone",
"dimercaprol",
"doxorubicin",
"furazolidone",
"glyburide",
"hydroxychloroquine",
"mafenide",
"methylene blue",
"nalidixic acid",
"nitrofurantoin",
"norfloxacin",
"ofloxacin",
"pegloticase",
"phenazopyridine",
"primaquine",
"quinine",
"rasburicase",
"sulfadiazine",
"sulfadimidine",
"sulfamethoxazole",
"trimethoprim",
"sulfanilamide",
"sulfasalazine",
"sulfisoxazole",
"tafenoquine",
"tolbutamide",
"toluidine blue",
"vitamin c",
"vitamin k"
]
},
"exception_type": "note",
"message": "PharmCAT reports based on VCF file input and some VCF files do not specify hemizygous (one X chromosome) and instead represent samples as homozygous. See PharmCAT FAQs (https://pharmcat.org/faqs/)."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104876"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Primaquine Phosphate (Primaquine Phosphate), NDA008316, PD-Rx Pharmaceuticals, Inc.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=008316"
}
],
"guidelines": [
{
"id": "PA166104876",
"name": "Annotation of FDA Label for primaquine and G6PD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104876",
"annotations": []
}
]
},
"rasburicase": {
"name": "rasburicase",
"id": "PA10176",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "G6PD hemizygous samples",
"version": "2",
"matches": {
"gene": "G6PD",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"aminosalicylic acid",
"aspirin",
"chloramphenicol",
"chloroquine",
"ciprofloxacin",
"dapsone",
"dimercaprol",
"doxorubicin",
"furazolidone",
"glyburide",
"hydroxychloroquine",
"mafenide",
"methylene blue",
"nalidixic acid",
"nitrofurantoin",
"norfloxacin",
"ofloxacin",
"pegloticase",
"phenazopyridine",
"primaquine",
"quinine",
"rasburicase",
"sulfadiazine",
"sulfadimidine",
"sulfamethoxazole",
"trimethoprim",
"sulfanilamide",
"sulfasalazine",
"sulfisoxazole",
"tafenoquine",
"tolbutamide",
"toluidine blue",
"vitamin c",
"vitamin k"
]
},
"exception_type": "note",
"message": "PharmCAT reports based on VCF file input and some VCF files do not specify hemizygous (one X chromosome) and instead represent samples as homozygous. See PharmCAT FAQs (https://pharmcat.org/faqs/)."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166151881"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Elitek (rasburicase), BLA103946, sanofi-aventis U.S. LLC",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=103946"
},
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Elitek (rasburicase), Sanofi-Aventis U.S. LLC - BLA103946/SUPPL-5103, 12/12/2019",
"journal": null,
"year": 2019,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=103946"
}
],
"guidelines": [
{
"id": "PA166151881",
"name": "Annotation of FDA Label for rasburicase and G6PD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166151881",
"annotations": []
}
]
},
"relugolix / estradiol / norethindrone acetate": {
"name": "relugolix / estradiol / norethindrone acetate",
"id": "PA166397682",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166397721"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Myfembree (relugolix, estradiol hemihydrate, and norethindrone acetate), Sumitomo Pharma America, Inc - NDA214846/SUPPL-8, 07/17/2024",
"journal": null,
"year": 2024,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=214846"
}
],
"guidelines": [
{
"id": "PA166397721",
"name": "Annotation of FDA Label for relugolix / estradiol / norethindrone acetate and F5, PROC, PROS1, SERPINC1",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166397721",
"annotations": []
}
]
},
"ropivacaine": {
"name": "ropivacaine",
"id": "PA451271",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166182728"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product NAROPIN (ropivacaine hydrochloride), NDA020533, General Injectables & Vaccines, Inc",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=020533"
}
],
"guidelines": [
{
"id": "PA166182728",
"name": "Annotation of FDA Label for ropivacaine and CYB5R3, G6PD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166182728",
"annotations": []
}
]
},
"sacituzumab govitecan": {
"name": "sacituzumab govitecan",
"id": "PA166225061",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166225101"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product sacituzumab govitecan-hziy BLA761115",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=761115"
}
],
"guidelines": [
{
"id": "PA166225101",
"name": "Annotation of FDA Label for sacituzumab govitecan and UGT1A1",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166225101",
"annotations": []
}
]
},
"seladelpar": {
"name": "seladelpar",
"id": "PA166400041",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166400441"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Livdelzi (SELADELPAR LYSINE), Gilead Sciences, Inc - NDA217899/ORIG-1, 08/14/2024",
"journal": null,
"year": 2024,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=217899"
}
],
"guidelines": [
{
"id": "PA166400441",
"name": "Annotation of FDA Label for seladelpar and CYP2C9",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166400441",
"annotations": []
}
]
},
"sevoflurane": {
"name": "sevoflurane",
"id": "PA451341",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166129519"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Ultane (Sevoflurane), NDA020478, AbbVie Inc.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=020478"
}
],
"guidelines": [
{
"id": "PA166129519",
"name": "Annotation of FDA Label for sevoflurane and CACNA1S, RYR1",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166129519",
"annotations": [
{
"implications": [],
"drugRecommendation": ""CONTRAINDICATIONS: Known or suspected genetic susceptibility to malignant hyperthermia...ULTANE [sevoflurane] can induce malignant hyperthermia in patients with known or suspected susceptibility based on genetic factors or family history, including those with certain inherited ryanodine receptor (RYR1) or dihydropyridine receptor (CACNA1S) variants." See label for more information.",
"classification": "Unspecified",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CACNA1S",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CACNA1S",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CACNA1S",
"matchScore": 4,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
},
{
"allele1": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "RYR1",
"matchScore": 0,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": [
{
"allele1": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "RYR1",
"matchScore": 626,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
],
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": true,
"otherPrescribingGuidance": false,
"phenotypes": {
"CACNA1S": "Uncertain Susceptibility",
"RYR1": "Uncertain Susceptibility"
},
"lookupKey": [
{
"RYR1": "Uncertain Susceptibility",
"CACNA1S": "Uncertain Susceptibility"
}
]
}
]
}
]
},
"siponimod": {
"name": "siponimod",
"id": "PA166182736",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166182738"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product MAYZENT (siponimod), NDA209884, Novartis Pharmaceuticals Corporation",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=209884"
}
],
"guidelines": [
{
"id": "PA166182738",
"name": "Annotation of FDA Label for siponimod and CYP2C9",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166182738",
"annotations": [
{
"implications": [],
"drugRecommendation": "The MAYZENT (siponimod) label states: "Recommended Dosage in Patients With CYP2C9 Genotypes *1/*1, *1/*2, or *2/*2" "Initiate MAYZENT with a 5-day titration, as shown in Table 1... A starter pack should be used for patients who will be titrated to the 2-mg maintenance dosage" "After treatment titration (see Treatment Initiation), the recommended maintenance dosage of MAYZENT is 2 mg taken orally once daily starting on Day 6." See label for more information.",
"classification": "Unspecified",
"activityScore": {
"CYP2C9": "2.0"
},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "CYP2C9",
"matchScore": 166,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C9": "Normal Metabolizer"
},
"lookupKey": [
{
"CYP2C9": {
"*1": 2.0
}
}
]
}
]
}
]
},
"sodium ascorbate": {
"name": "sodium ascorbate",
"id": "PA166163262",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166293282"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Ascor (Ascorbic Acid), NDA209112, McGuff Pharmaceuticals, Inc.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=209112"
}
],
"guidelines": [
{
"id": "PA166293282",
"name": "Annotation of FDA Label for Ascorbic acid (vitamin C), combinations, Ascorbic acid (vitamin C), plain, sodium ascorbate and G6PD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166293282",
"annotations": []
}
]
},
"sodium nitrite": {
"name": "sodium nitrite",
"id": "PA166115361",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166115362"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Sodium Nitrite (Sodium Nitrite), NDA203922, Hope Pharmaceuticals",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=203922"
}
],
"guidelines": [
{
"id": "PA166115362",
"name": "Annotation of FDA Label for sodium nitrite and CYB5R3, G6PD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166115362",
"annotations": []
}
]
},
"streptomycin": {
"name": "streptomycin",
"id": "PA451512",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166316361"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Streptomycin (Streptomycin), ANDA064210, XGen Pharmaceuticals DJB, Inc.",
"journal": null,
"year": 2023,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=064210"
}
],
"guidelines": [
{
"id": "PA166316361",
"name": "Annotation of FDA Label for streptomycin and MT-RNR1",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166316361",
"annotations": []
}
]
},
"succinylcholine": {
"name": "succinylcholine",
"id": "PA451522",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166122970"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Anectine (Succinylcholine Chloride), NDA008453, Sandoz Inc",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=008453"
}
],
"guidelines": [
{
"id": "PA166122970",
"name": "Annotation of FDA Label for succinylcholine and BCHE, CACNA1S, RYR1",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166122970",
"annotations": [
{
"implications": [],
"drugRecommendation": ""ANECTINE [succinylcholine] is contraindicated in patients with...[k]nown or suspected genetic susceptibility to malignant hyperthermia...Anectine [succinylcholine] can induce malignant hyperthermia in patients with known or suspected susceptibility based on genetic factors or family history, including those with certain inherited ryanodine receptor (RYR1) or dihydropyridine receptor (CACNA1S) variants...Succinylcholine is metabolized by plasma cholinesterase and should be used with caution, if at all, in patients known to be or suspected of being homozygous for the atypical plasma cholinesterase gene [BCHE] ." See label for more information.",
"classification": "Unspecified",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CACNA1S",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CACNA1S",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CACNA1S",
"matchScore": 4,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
},
{
"allele1": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "RYR1",
"matchScore": 0,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": [
{
"allele1": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "RYR1",
"matchScore": 626,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
],
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": true,
"otherPrescribingGuidance": true,
"phenotypes": {
"CACNA1S": "Uncertain Susceptibility",
"RYR1": "Uncertain Susceptibility"
},
"lookupKey": [
{
"RYR1": "Uncertain Susceptibility",
"CACNA1S": "Uncertain Susceptibility"
}
]
}
]
}
]
},
"sulfasalazine": {
"name": "sulfasalazine",
"id": "PA451547",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "G6PD hemizygous samples",
"version": "2",
"matches": {
"gene": "G6PD",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"aminosalicylic acid",
"aspirin",
"chloramphenicol",
"chloroquine",
"ciprofloxacin",
"dapsone",
"dimercaprol",
"doxorubicin",
"furazolidone",
"glyburide",
"hydroxychloroquine",
"mafenide",
"methylene blue",
"nalidixic acid",
"nitrofurantoin",
"norfloxacin",
"ofloxacin",
"pegloticase",
"phenazopyridine",
"primaquine",
"quinine",
"rasburicase",
"sulfadiazine",
"sulfadimidine",
"sulfamethoxazole",
"trimethoprim",
"sulfanilamide",
"sulfasalazine",
"sulfisoxazole",
"tafenoquine",
"tolbutamide",
"toluidine blue",
"vitamin c",
"vitamin k"
]
},
"exception_type": "note",
"message": "PharmCAT reports based on VCF file input and some VCF files do not specify hemizygous (one X chromosome) and instead represent samples as homozygous. See PharmCAT FAQs (https://pharmcat.org/faqs/)."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104892"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Sulfasalazine (Sulfasalazine), NDA007073, REMEDYREPACK INC.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=007073"
}
],
"guidelines": [
{
"id": "PA166104892",
"name": "Annotation of FDA Label for sulfasalazine and G6PD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104892",
"annotations": []
}
]
},
"tafenoquine": {
"name": "tafenoquine",
"id": "PA166115580",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "G6PD hemizygous samples",
"version": "2",
"matches": {
"gene": "G6PD",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"aminosalicylic acid",
"aspirin",
"chloramphenicol",
"chloroquine",
"ciprofloxacin",
"dapsone",
"dimercaprol",
"doxorubicin",
"furazolidone",
"glyburide",
"hydroxychloroquine",
"mafenide",
"methylene blue",
"nalidixic acid",
"nitrofurantoin",
"norfloxacin",
"ofloxacin",
"pegloticase",
"phenazopyridine",
"primaquine",
"quinine",
"rasburicase",
"sulfadiazine",
"sulfadimidine",
"sulfamethoxazole",
"trimethoprim",
"sulfanilamide",
"sulfasalazine",
"sulfisoxazole",
"tafenoquine",
"tolbutamide",
"toluidine blue",
"vitamin c",
"vitamin k"
]
},
"exception_type": "note",
"message": "PharmCAT reports based on VCF file input and some VCF files do not specify hemizygous (one X chromosome) and instead represent samples as homozygous. See PharmCAT FAQs (https://pharmcat.org/faqs/)."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166182739"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Arakoda (Tafenoquine), NDA210607, 60 Degrees Pharmaceuticals, LLC",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=210607"
}
],
"guidelines": [
{
"id": "PA166182739",
"name": "Annotation of FDA Label for tafenoquine and G6PD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166182739",
"annotations": []
}
]
},
"tamsulosin": {
"name": "tamsulosin",
"id": "PA451583",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166160672"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Flomax (tamsulosin hydrochloride), NDA020579, REMEDYREPACK INC.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=020579"
}
],
"guidelines": [
{
"id": "PA166160672",
"name": "Annotation of FDA Label for tamsulosin and CYP2D6",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166160672",
"annotations": []
}
]
},
"tetrabenazine": {
"name": "tetrabenazine",
"id": "PA140222719",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104829"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Xenazine (tetrabenazine), Lundbeck Pharmaceuticals LLC - NDA021894/SUPPL-13, 09/13/2017",
"journal": null,
"year": 2017,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=021894"
}
],
"guidelines": [
{
"id": "PA166104829",
"name": "Annotation of FDA Label for tetrabenazine and CYP2D6",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104829",
"annotations": [
{
"implications": [],
"drugRecommendation": ""Genotyped patients who are identified as extensive (EMs) or intermediate metabolizers (IMs) of\nCYP2D6, who need doses of XENAZINE [tetrabenazine] above 50 mg per day, should be titrated up slowly at\nweekly intervals by 12.5 mg daily, to allow the identification of a tolerated dose that reduces\nchorea. Doses above 50 mg per day should be given in a three times a day regimen. The\nmaximum recommended daily dose is 100 mg and the maximum recommended single dose is\n37.5 mg. If adverse reactions such as akathisia, parkinsonism, depression, insomnia, anxiety or\nsedation occur, titration should be stopped and the dose should be reduced. If the adverse\nreaction does not resolve, consideration should be given to withdrawing XENAZINE [tetrabenazine] treatment\nor initiating other specific treatment." See label for more information",
"classification": "Unspecified",
"activityScore": {
"CYP2D6": "1.0"
},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2D6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2D6",
"name": "*3",
"function": "No function",
"reference": false,
"activityValue": "0.0"
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "1.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"1.0"
],
"label": "*1/*3",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2D6": "Intermediate Metabolizer"
},
"lookupKey": [
{
"CYP2D6": "1.0"
}
]
}
]
}
]
},
"thioguanine": {
"name": "thioguanine",
"id": "PA451663",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104838"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product TABLOID (thioguanine), NDA012429, Aspen Global Inc.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=012429"
}
],
"guidelines": [
{
"id": "PA166104838",
"name": "Annotation of FDA Label for thioguanine and NUDT15, TPMT",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104838",
"annotations": []
}
]
},
"thioridazine": {
"name": "thioridazine",
"id": "PA451666",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104805"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Thioridazine Hydrochloride (thioridazine hydrochloride), ANDA088004, REMEDYREPACK INC.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=088004"
}
],
"guidelines": [
{
"id": "PA166104805",
"name": "Annotation of FDA Label for thioridazine and CYP2D6",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104805",
"annotations": [
{
"implications": [],
"drugRecommendation": ""...thioridazine is contraindicated...in patients, comprising about 7% of the normal population, who are known to have a genetic defect leading to reduced levels of activity of P450 2D6." See label for more information.",
"classification": "Unspecified",
"activityScore": {
"CYP2D6": "1.0"
},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2D6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2D6",
"name": "*3",
"function": "No function",
"reference": false,
"activityValue": "0.0"
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "1.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"1.0"
],
"label": "*1/*3",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": true,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2D6": "Intermediate Metabolizer"
},
"lookupKey": [
{
"CYP2D6": "1.0"
}
]
}
]
}
]
},
"tobramycin": {
"name": "tobramycin",
"id": "PA451704",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166316341"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product BETHKIS (tobramycin), NDA201820, Chiesi USA, Inc.",
"journal": null,
"year": 2023,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=201820"
}
],
"guidelines": [
{
"id": "PA166316341",
"name": "Annotation of FDA Label for tobramycin and MT-RNR1",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166316341",
"annotations": []
}
]
},
"tolazamide": {
"name": "tolazamide",
"id": "PA164774902",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166182786"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Tolazamide (tolazamide), ANDA070259, PD-Rx Pharmaceuticals, Inc.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=070259"
}
],
"guidelines": [
{
"id": "PA166182786",
"name": "Annotation of FDA Label for tolazamide and G6PD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166182786",
"annotations": []
}
]
},
"tolbutamide": {
"name": "tolbutamide",
"id": "PA451718",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "G6PD hemizygous samples",
"version": "2",
"matches": {
"gene": "G6PD",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"aminosalicylic acid",
"aspirin",
"chloramphenicol",
"chloroquine",
"ciprofloxacin",
"dapsone",
"dimercaprol",
"doxorubicin",
"furazolidone",
"glyburide",
"hydroxychloroquine",
"mafenide",
"methylene blue",
"nalidixic acid",
"nitrofurantoin",
"norfloxacin",
"ofloxacin",
"pegloticase",
"phenazopyridine",
"primaquine",
"quinine",
"rasburicase",
"sulfadiazine",
"sulfadimidine",
"sulfamethoxazole",
"trimethoprim",
"sulfanilamide",
"sulfasalazine",
"sulfisoxazole",
"tafenoquine",
"tolbutamide",
"toluidine blue",
"vitamin c",
"vitamin k"
]
},
"exception_type": "note",
"message": "PharmCAT reports based on VCF file input and some VCF files do not specify hemizygous (one X chromosome) and instead represent samples as homozygous. See PharmCAT FAQs (https://pharmcat.org/faqs/)."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166182787"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Tolbutamide (tolbutamide), ANDA086445, Mylan Pharmaceuticals Inc.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=086445"
}
],
"guidelines": [
{
"id": "PA166182787",
"name": "Annotation of FDA Label for tolbutamide and G6PD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166182787",
"annotations": []
}
]
},
"tramadol": {
"name": "tramadol",
"id": "PA451735",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104799"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product ULTRAM (tramadol hydrochloride), NDA020281, Janssen Pharmaceuticals, Inc.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=020281"
}
],
"guidelines": [
{
"id": "PA166104799",
"name": "Annotation of FDA Label for tramadol and CYP2D6",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104799",
"annotations": []
}
]
},
"valbenazine": {
"name": "valbenazine",
"id": "PA166170051",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166170052"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product INGREZZA (Valbenazine), NDA209241, Neurocrine Biosciences, Inc.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=209241"
}
],
"guidelines": [
{
"id": "PA166170052",
"name": "Annotation of FDA Label for valbenazine and CYP2D6",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166170052",
"annotations": []
}
]
},
"vortioxetine": {
"name": "vortioxetine",
"id": "PA166122595",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166122607"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Trintellix (vortioxetine), NDA204447, Cardinal Health",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=204447"
}
],
"guidelines": [
{
"id": "PA166122607",
"name": "Annotation of FDA Label for vortioxetine and CYP2D6",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166122607",
"annotations": []
}
]
},
"warfarin": {
"name": "warfarin",
"id": "PA451906",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104776"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product COUMADIN (warfarin sodium), NDA009218, Bristol-Myers Squibb Pharma Company",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=009218"
}
],
"guidelines": [
{
"id": "PA166104776",
"name": "Annotation of FDA Label for warfarin and CYP2C9, VKORC1",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104776",
"annotations": [
{
"implications": [],
"drugRecommendation": "Table 1 in the drug label provides ranges of expected maintenance daily doses of warfarin (COUMADIN) based on CYP2C9*2, CYP2C9*3 and VKORC1−1639G>A (rs9923231) genotypes. For CYP2C9*1/*1, VKORC1 GG (rs9923231CC), the range of expected maintenance daily dose is 5-7 mg.",
"classification": "Unspecified",
"activityScore": {
"CYP2C9": "2.0",
"VKORC1": "n/a"
},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "CYP2C9",
"matchScore": 166,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
},
{
"allele1": {
"gene": "VKORC1",
"name": "rs9923231 reference (C)",
"function": "Normal coumarin sensitivity",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "VKORC1",
"name": "rs9923231 reference (C)",
"function": "Normal coumarin sensitivity",
"reference": true,
"activityValue": "n/a"
},
"gene": "VKORC1",
"matchScore": 2,
"phenotypes": [
"-1639 GG"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"-1639 GG"
],
"label": "rs9923231 reference (C)/rs9923231 reference (C)",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"rs9923231 reference (C)": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C9": "Normal Metabolizer",
"VKORC1": "-1639 GG"
},
"lookupKey": [
{
"CYP2C9": {
"*1": 2.0
},
"VKORC1": {
"rs9923231 reference (C)": 2.0
}
}
]
}
]
}
]
}
},
"FDA PGx Association": {
"abacavir": {
"name": "abacavir",
"id": "PA448004",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329541"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329541",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Abacavir - HLA-B",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329541",
"annotations": [
{
"implications": [],
"drugRecommendation": ""Results in higher adverse reaction risk (hypersensitivity reactions). Do not use abacavir in patients positive for HLA-B*57:01."",
"classification": "Unspecified",
"activityScore": {},
"population": "Affected subgroup: HLA-B*57:01 allele positive",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "HLA-B",
"name": "*15:02",
"function": null,
"reference": false,
"activityValue": null
},
"allele2": {
"gene": "HLA-B",
"name": "*57:01",
"function": null,
"reference": false,
"activityValue": null
},
"gene": "HLA-B",
"matchScore": 0,
"phenotypes": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"label": "*15:02/*57:01",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": true,
"otherPrescribingGuidance": false,
"phenotypes": {
"HLA-B": "*57:01 positive"
},
"lookupKey": [
{
"HLA-B": "*57:01 positive"
}
]
}
]
}
]
},
"abrocitinib": {
"name": "abrocitinib",
"id": "PA166272921",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329542"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329542",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Abrocitinib - CYP2C19",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329542",
"annotations": []
}
]
},
"allopurinol": {
"name": "allopurinol",
"id": "PA448320",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329603"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329603",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Indicate a Potential Impact on Safety or Response]: Allopurinol - HLA-B",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329603",
"annotations": []
}
]
},
"amifampridine": {
"name": "amifampridine",
"id": "PA166185150",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329543"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329543",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Amifampridine - NAT2",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329543",
"annotations": []
}
]
},
"amifampridine phosphate": {
"name": "amifampridine phosphate",
"id": "PA166182002",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329544"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329544",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Amifampridine Phosphate - NAT2",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329544",
"annotations": []
}
]
},
"amitriptyline": {
"name": "amitriptyline",
"id": "PA448385",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329627"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329627",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Amitriptyline - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329627",
"annotations": [
{
"implications": [],
"drugRecommendation": ""May alter systemic concentrations."",
"classification": "Unspecified",
"activityScore": {
"CYP2D6": "1.0"
},
"population": "Affected subgroup: CYP2D6 ultrarapid, intermediate, or poor metabolizers",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2D6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2D6",
"name": "*3",
"function": "No function",
"reference": false,
"activityValue": "0.0"
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "1.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"1.0"
],
"label": "*1/*3",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2D6": "Intermediate Metabolizer"
},
"lookupKey": [
{
"CYP2D6": "1.0"
}
]
}
]
}
]
},
"amoxapine": {
"name": "amoxapine",
"id": "PA448405",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329628"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329628",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Amoxapine - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329628",
"annotations": [
{
"implications": [],
"drugRecommendation": ""May alter systemic concentrations."",
"classification": "Unspecified",
"activityScore": {
"CYP2D6": "1.0"
},
"population": "Affected subgroup: CYP2D6 ultrarapid, intermediate, or poor metabolizers",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2D6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2D6",
"name": "*3",
"function": "No function",
"reference": false,
"activityValue": "0.0"
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "1.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"1.0"
],
"label": "*1/*3",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2D6": "Intermediate Metabolizer"
},
"lookupKey": [
{
"CYP2D6": "1.0"
}
]
}
]
}
]
},
"amphetamine": {
"name": "amphetamine",
"id": "PA448408",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329545"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329545",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Amphetamine - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329545",
"annotations": []
}
]
},
"aripiprazole": {
"name": "aripiprazole",
"id": "PA10026",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329546"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329546",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Aripiprazole - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329546",
"annotations": []
}
]
},
"aripiprazole lauroxil": {
"name": "aripiprazole lauroxil",
"id": "PA166161216",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329547"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329547",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Aripiprazole Lauroxil - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329547",
"annotations": []
}
]
},
"atomoxetine": {
"name": "atomoxetine",
"id": "PA134688071",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329548"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329548",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Atomoxetine - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329548",
"annotations": []
}
]
},
"atorvastatin": {
"name": "atorvastatin",
"id": "PA448500",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "SLCO1B1-drug text",
"version": "1",
"matches": {
"gene": "SLCO1B1",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"simvastatin",
"rosuvastatin",
"pravastatin",
"pitavastatin",
"lovastatin",
"fluvastatin",
"atorvastatin"
]
},
"exception_type": "note",
"message": "The SLCO1B1 genotype (star nomenclature) will be displayed if determinable with the provided VCF based on the SLCO1B1 star allele definition published by CPIC and recommendations are provided based on the genotype.
In case no genotype can be determined, recommendations are based on the rs4149056 genotype alone as per guideline. The minor C allele at rs4149056 defines SLCO1B1*5."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329629"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329629",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Atorvastatin - SLCO1B1",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329629",
"annotations": []
}
]
},
"avatrombopag": {
"name": "avatrombopag",
"id": "PA166179849",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329630"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329630",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Avatrombopag - CYP2C9",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329630",
"annotations": []
}
]
},
"azathioprine": {
"name": "azathioprine",
"id": "PA448515",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329549"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329549",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Azathioprine - TPMT and/or NUDT15",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329549",
"annotations": []
}
]
},
"belinostat": {
"name": "belinostat",
"id": "PA165971474",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329550"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329550",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Belinostat - UGT1A1",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329550",
"annotations": []
}
]
},
"belzutifan": {
"name": "belzutifan",
"id": "PA166268761",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329551"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329551",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Belzutifan - CYP2C19 and/or UGT2B17",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329551",
"annotations": []
}
]
},
"brexpiprazole": {
"name": "brexpiprazole",
"id": "PA166160053",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329552"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329552",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Brexpiprazole - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329552",
"annotations": []
}
]
},
"brivaracetam": {
"name": "brivaracetam",
"id": "PA166153491",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329553"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329553",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Brivaracetam - CYP2C19",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329553",
"annotations": []
}
]
},
"capecitabine": {
"name": "capecitabine",
"id": "PA448771",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329554"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329554",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Capecitabine - DPYD",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329554",
"annotations": []
}
]
},
"carbamazepine": {
"name": "carbamazepine",
"id": "PA448785",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329604",
"https://www.clinpgx.org/fdaPgxAssociations#PA166329555"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329604",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Indicate a Potential Impact on Safety or Response]: Carbamazepine - HLA-A",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329604",
"annotations": []
},
{
"id": "PA166329555",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Carbamazepine - HLA-B",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329555",
"annotations": [
{
"implications": [],
"drugRecommendation": ""Results in higher adverse reaction risk (severe skin reactions). Avoid use unless potential benefits outweigh risks and consider risks of alternative therapies. Patients positive for HLA-B*15:02 may be at increased risk of severe skin reactions with other drugs that are associated with a risk of Stevens Johnson Syndrome/Toxic Epidermal necrolysis (SJS/TEN). Genotyping is not a substitute for clinical vigilance."",
"classification": "Unspecified",
"activityScore": {},
"population": "Affected subgroup: HLA-B*15:02 allele positive",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "HLA-B",
"name": "*15:02",
"function": null,
"reference": false,
"activityValue": null
},
"allele2": {
"gene": "HLA-B",
"name": "*57:01",
"function": null,
"reference": false,
"activityValue": null
},
"gene": "HLA-B",
"matchScore": 0,
"phenotypes": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"label": "*15:02/*57:01",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": true,
"otherPrescribingGuidance": false,
"phenotypes": {
"HLA-B": "*15:02 positive"
},
"lookupKey": [
{
"HLA-B": "*15:02 positive"
}
]
}
]
}
]
},
"carisoprodol": {
"name": "carisoprodol",
"id": "PA448809",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329631"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329631",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Carisoprodol - CYP2C19",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329631",
"annotations": []
}
]
},
"carvedilol": {
"name": "carvedilol",
"id": "PA448817",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329605"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329605",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Indicate a Potential Impact on Safety or Response]: Carvedilol - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329605",
"annotations": []
}
]
},
"celecoxib": {
"name": "celecoxib",
"id": "PA448871",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329556"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329556",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Celecoxib - CYP2C9",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329556",
"annotations": []
}
]
},
"cevimeline": {
"name": "cevimeline",
"id": "PA164754754",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329606"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329606",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Indicate a Potential Impact on Safety or Response]: Cevimeline - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329606",
"annotations": []
}
]
},
"citalopram": {
"name": "citalopram",
"id": "PA449015",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329557"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329557",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Citalopram - CYP2C19",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329557",
"annotations": []
}
]
},
"clobazam": {
"name": "clobazam",
"id": "PA10888",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329558"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329558",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Clobazam - CYP2C19",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329558",
"annotations": []
}
]
},
"clomipramine": {
"name": "clomipramine",
"id": "PA449048",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329632"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329632",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Clomipramine - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329632",
"annotations": [
{
"implications": [],
"drugRecommendation": ""May alter systemic concentrations."",
"classification": "Unspecified",
"activityScore": {
"CYP2D6": "1.0"
},
"population": "Affected subgroup: CYP2D6 ultrarapid, intermediate, or poor metabolizers",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2D6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2D6",
"name": "*3",
"function": "No function",
"reference": false,
"activityValue": "0.0"
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "1.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"1.0"
],
"label": "*1/*3",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2D6": "Intermediate Metabolizer"
},
"lookupKey": [
{
"CYP2D6": "1.0"
}
]
}
]
}
]
},
"clopidogrel": {
"name": "clopidogrel",
"id": "PA449053",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329559"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329559",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Clopidogrel - CYP2C19",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329559",
"annotations": []
}
]
},
"clozapine": {
"name": "clozapine",
"id": "PA449061",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329560"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329560",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Clozapine - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329560",
"annotations": []
}
]
},
"codeine": {
"name": "codeine",
"id": "PA449088",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329607",
"https://www.clinpgx.org/fdaPgxAssociations#PA166329561"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329607",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Indicate a Potential Impact on Safety or Response]: Codeine - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329607",
"annotations": []
},
{
"id": "PA166329561",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Codeine - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329561",
"annotations": []
}
]
},
"darifenacin": {
"name": "darifenacin",
"id": "PA164774901",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329633"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329633",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Darifenacin - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329633",
"annotations": []
}
]
},
"desipramine": {
"name": "desipramine",
"id": "PA449233",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329634"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329634",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Desipramine - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329634",
"annotations": [
{
"implications": [],
"drugRecommendation": ""May alter systemic concentrations."",
"classification": "Unspecified",
"activityScore": {
"CYP2D6": "1.0"
},
"population": "Affected subgroup: CYP2D6 ultrarapid, intermediate, or poor metabolizers",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2D6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2D6",
"name": "*3",
"function": "No function",
"reference": false,
"activityValue": "0.0"
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "1.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"1.0"
],
"label": "*1/*3",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2D6": "Intermediate Metabolizer"
},
"lookupKey": [
{
"CYP2D6": "1.0"
}
]
}
]
}
]
},
"deutetrabenazine": {
"name": "deutetrabenazine",
"id": "PA166169881",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329562"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329562",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Deutetrabenazine - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329562",
"annotations": []
}
]
},
"dexlansoprazole": {
"name": "dexlansoprazole",
"id": "PA166110257",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329635"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329635",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Dexlansoprazole - CYP2C19",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329635",
"annotations": []
}
]
},
"diazepam": {
"name": "diazepam",
"id": "PA449283",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329636"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329636",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Diazepam - CYP2C19",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329636",
"annotations": []
}
]
},
"dolutegravir": {
"name": "dolutegravir",
"id": "PA166114961",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329637"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329637",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Dolutegravir - UGT1A1",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329637",
"annotations": []
}
]
},
"donepezil": {
"name": "donepezil",
"id": "PA449394",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329638"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329638",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Donepezil - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329638",
"annotations": []
}
]
},
"doxepin": {
"name": "doxepin",
"id": "PA449409",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329639",
"https://www.clinpgx.org/fdaPgxAssociations#PA166329640"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329639",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Doxepin - CYP2C19",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329639",
"annotations": []
},
{
"id": "PA166329640",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Doxepin - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329640",
"annotations": [
{
"implications": [],
"drugRecommendation": ""May alter systemic concentrations."",
"classification": "Unspecified",
"activityScore": {
"CYP2D6": "1.0"
},
"population": "Affected subgroup: CYP2D6 ultrarapid, intermediate, or poor metabolizers",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2D6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2D6",
"name": "*3",
"function": "No function",
"reference": false,
"activityValue": "0.0"
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "1.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"1.0"
],
"label": "*1/*3",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2D6": "Intermediate Metabolizer"
},
"lookupKey": [
{
"CYP2D6": "1.0"
}
]
}
]
}
]
},
"dronabinol": {
"name": "dronabinol",
"id": "PA449421",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329563"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329563",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Dronabinol - CYP2C9",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329563",
"annotations": []
}
]
},
"efavirenz": {
"name": "efavirenz",
"id": "PA449441",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329608"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329608",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Indicate a Potential Impact on Safety or Response]: Efavirenz - CYP2B6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329608",
"annotations": []
}
]
},
"elagolix": {
"name": "elagolix",
"id": "PA166182348",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329641"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329641",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Elagolix - SLCO1B1",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329641",
"annotations": []
}
]
},
"eliglustat": {
"name": "eliglustat",
"id": "PA166123486",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329564"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329564",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Eliglustat - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329564",
"annotations": [
{
"implications": [],
"drugRecommendation": ""Alters systemic concentrations, effectiveness, and adverse reaction risk (QT prolongation). Indicated for normal, intermediate, and poor metabolizer patients. Ultrarapid metabolizers may not achieve adequate concentrations to achieve a therapeutic effect. The recommended dosages are based on CYP2D6 metabolizer status. Coadministration with strong CYP3A inhibitors is contraindicated in intermediate and poor CYP2D6 metabolizers. Refer to FDA labeling for specific dosing recommendations."",
"classification": "Unspecified",
"activityScore": {
"CYP2D6": "1.0"
},
"population": "Affected subgroup: CYP2D6 ultrarapid, normal, intermediate, or poor metabolizers",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2D6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2D6",
"name": "*3",
"function": "No function",
"reference": false,
"activityValue": "0.0"
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "1.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"1.0"
],
"label": "*1/*3",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": true,
"phenotypes": {
"CYP2D6": "Intermediate Metabolizer"
},
"lookupKey": [
{
"CYP2D6": "1.0"
}
]
}
]
}
]
},
"erdafitinib": {
"name": "erdafitinib",
"id": "PA166182720",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329565"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329565",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Erdafitinib - CYP2C9",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329565",
"annotations": []
}
]
},
"escitalopram": {
"name": "escitalopram",
"id": "PA10074",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329642"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329642",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Escitalopram - CYP2C19",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329642",
"annotations": []
}
]
},
"esomeprazole": {
"name": "esomeprazole",
"id": "PA10075",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329643"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329643",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Esomeprazole - CYP2C19",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329643",
"annotations": []
}
]
},
"fesoterodine": {
"name": "fesoterodine",
"id": "PA165958376",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329644"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329644",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Fesoterodine - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329644",
"annotations": []
}
]
},
"flibanserin": {
"name": "flibanserin",
"id": "PA166153431",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329566"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329566",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Flibanserin - CYP2C19",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329566",
"annotations": []
}
]
},
"fluorouracil": {
"name": "fluorouracil",
"id": "PA128406956",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329568"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329568",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Fluorouracil - DPYD",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329568",
"annotations": []
}
]
},
"flurbiprofen": {
"name": "flurbiprofen",
"id": "PA449683",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329567"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329567",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Flurbiprofen - CYP2C9",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329567",
"annotations": []
}
]
},
"fluvoxamine": {
"name": "fluvoxamine",
"id": "PA449690",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329645"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329645",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Fluvoxamine - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329645",
"annotations": []
}
]
},
"fosphenytoin": {
"name": "fosphenytoin",
"id": "PA164746820",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "Phenytoin_HLA-B warning",
"version": "1",
"matches": {
"gene": null,
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"phenytoin",
"fosphenytoin"
]
},
"exception_type": "note",
"message": "The displayed recommendation for CYP2C9 and phenytoin is ONLY valid for non-carriers of the HLA-B*15:02 high-risk allele. PharmCAT Named Allele Matcher does not determine HLA status. CPIC guidance: Fos-/Phenytoin is contraindicated in individuals with the HLA-B*15:02 variant allele (\"HLA-B*15:02-positive\") due to significantly increased risk of fos-/phenytoin-induced cutaneous adverse reactions of Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN). In HLA-B*15:02 carriers, carbamazepine should not be used as an alternative. Alternative medications such as oxcarbazepine, eslicarbazepine acetate, and lamotrigine have some evidence linking SJS/TEN with the HLA-B*15:02 allele, and thus caution should be used in choosing alternatives to phenytoin."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329569",
"https://www.clinpgx.org/fdaPgxAssociations#PA166329570"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329569",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Fosphenytoin - CYP2C9",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329569",
"annotations": []
},
{
"id": "PA166329570",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Fosphenytoin - HLA-B",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329570",
"annotations": [
{
"implications": [],
"drugRecommendation": ""May result in higher adverse reaction risk (severe cutaneous reactions). Patients positive for HLA-B*15:02 may be at increased risk of Stevens Johnson Syndrome/Toxic Epidermal necrolysis (SJS/TEN). Consider avoiding fosphenytoin as an alternative to carbamazepine in patients who are positive for HLA-B*15:02. Genotyping is not a substitute for clinical vigilance and patient management."",
"classification": "Unspecified",
"activityScore": {},
"population": "HLA-B*15:02 allele positive",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "HLA-B",
"name": "*15:02",
"function": null,
"reference": false,
"activityValue": null
},
"allele2": {
"gene": "HLA-B",
"name": "*57:01",
"function": null,
"reference": false,
"activityValue": null
},
"gene": "HLA-B",
"matchScore": 0,
"phenotypes": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"label": "*15:02/*57:01",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": true,
"otherPrescribingGuidance": false,
"phenotypes": {
"HLA-B": "*15:02 positive"
},
"lookupKey": [
{
"HLA-B": "*15:02 positive"
}
]
}
]
}
]
},
"galantamine": {
"name": "galantamine",
"id": "PA449726",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329646"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329646",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Galantamine - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329646",
"annotations": []
}
]
},
"gefitinib": {
"name": "gefitinib",
"id": "PA131301952",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329571"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329571",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Gefitinib - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329571",
"annotations": []
}
]
},
"hydralazine": {
"name": "hydralazine",
"id": "PA449894",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329647"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329647",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Hydralazine - Nonspecific (NAT)",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329647",
"annotations": []
}
]
},
"ibuprofen": {
"name": "ibuprofen",
"id": "PA449957",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329648"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329648",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Ibuprofen - CYP2C9",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329648",
"annotations": []
}
]
},
"iloperidone": {
"name": "iloperidone",
"id": "PA161199368",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329572"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329572",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Iloperidone - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329572",
"annotations": []
}
]
},
"imipramine": {
"name": "imipramine",
"id": "PA449969",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329649"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329649",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Imipramine - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329649",
"annotations": [
{
"implications": [],
"drugRecommendation": ""May alter systemic concentrations."",
"classification": "Unspecified",
"activityScore": {
"CYP2D6": "1.0"
},
"population": "Affected subgroup: CYP2D6 ultrarapid, intermediate, or poor metabolizers",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2D6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2D6",
"name": "*3",
"function": "No function",
"reference": false,
"activityValue": "0.0"
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "1.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"1.0"
],
"label": "*1/*3",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2D6": "Intermediate Metabolizer"
},
"lookupKey": [
{
"CYP2D6": "1.0"
}
]
}
]
}
]
},
"irinotecan": {
"name": "irinotecan",
"id": "PA450085",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329573"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329573",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Irinotecan - UGT1A1",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329573",
"annotations": []
}
]
},
"isoniazid": {
"name": "isoniazid",
"id": "PA450112",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329609"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329609",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Indicate a Potential Impact on Safety or Response]: Isoniazid - Nonspecific (NAT)",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329609",
"annotations": []
}
]
},
"lansoprazole": {
"name": "lansoprazole",
"id": "PA450180",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329650"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329650",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Lansoprazole - CYP2C19",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329650",
"annotations": []
}
]
},
"lofexidine": {
"name": "lofexidine",
"id": "PA164744510",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329574"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329574",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Lofexidine - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329574",
"annotations": []
}
]
},
"mavacamten": {
"name": "mavacamten",
"id": "PA166272922",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329612"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329612",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Indicate a Potential Impact on Safety or Response]: Mavacamten - CYP2C19",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329612",
"annotations": []
}
]
},
"meclizine": {
"name": "meclizine",
"id": "PA450338",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329575"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329575",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Meclizine - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329575",
"annotations": [
{
"implications": [],
"drugRecommendation": ""May affect systemic concentrations. Monitor for adverse reactions and clinical effect."",
"classification": "Unspecified",
"activityScore": {
"CYP2D6": "1.0"
},
"population": "Affected subgroup: CYP2D6 ultrarapid, intermediate, or poor metabolizers",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2D6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2D6",
"name": "*3",
"function": "No function",
"reference": false,
"activityValue": "0.0"
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "1.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"1.0"
],
"label": "*1/*3",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": true,
"phenotypes": {
"CYP2D6": "Intermediate Metabolizer"
},
"lookupKey": [
{
"CYP2D6": "1.0"
}
]
}
]
}
]
},
"meloxicam": {
"name": "meloxicam",
"id": "PA450353",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329576"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329576",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Meloxicam - CYP2C9",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329576",
"annotations": []
}
]
},
"mercaptopurine": {
"name": "mercaptopurine",
"id": "PA450379",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329578"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329578",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Mercaptopurine - TPMT and/or NUDT15",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329578",
"annotations": []
}
]
},
"metoclopramide": {
"name": "metoclopramide",
"id": "PA450475",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329577"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329577",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Metoclopramide - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329577",
"annotations": []
}
]
},
"metoprolol": {
"name": "metoprolol",
"id": "PA450480",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329651"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329651",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Metoprolol - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329651",
"annotations": []
}
]
},
"mirabegron": {
"name": "mirabegron",
"id": "PA166177513",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329652"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329652",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Mirabegron - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329652",
"annotations": []
}
]
},
"nateglinide": {
"name": "nateglinide",
"id": "PA450600",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329580"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329580",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Nateglinide - CYP2C9",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329580",
"annotations": []
}
]
},
"nebivolol": {
"name": "nebivolol",
"id": "PA151958426",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329653"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329653",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Nebivolol - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329653",
"annotations": []
}
]
},
"nilotinib": {
"name": "nilotinib",
"id": "PA165958345",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329613"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329613",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Indicate a Potential Impact on Safety or Response]: Nilotinib - UGT1A1",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329613",
"annotations": []
}
]
},
"nortriptyline": {
"name": "nortriptyline",
"id": "PA450657",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329654"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329654",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Nortriptyline - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329654",
"annotations": [
{
"implications": [],
"drugRecommendation": ""May alter systemic concentrations."",
"classification": "Unspecified",
"activityScore": {
"CYP2D6": "1.0"
},
"population": "Affected subgroup: CYP2D6 ultrarapid, intermediate, or poor metabolizers",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2D6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2D6",
"name": "*3",
"function": "No function",
"reference": false,
"activityValue": "0.0"
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "1.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"1.0"
],
"label": "*1/*3",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2D6": "Intermediate Metabolizer"
},
"lookupKey": [
{
"CYP2D6": "1.0"
}
]
}
]
}
]
},
"oliceridine": {
"name": "oliceridine",
"id": "PA166223601",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329581"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329581",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Oliceridine - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329581",
"annotations": []
}
]
},
"omeprazole": {
"name": "omeprazole",
"id": "PA450704",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329655"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329655",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Omeprazole - CYP2C19",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329655",
"annotations": []
}
]
},
"oxcarbazepine": {
"name": "oxcarbazepine",
"id": "PA450732",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329616"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329616",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Indicate a Potential Impact on Safety or Response]: Oxcarbazepine - HLA-B",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329616",
"annotations": [
{
"implications": [],
"drugRecommendation": ""Results in higher adverse reaction risk (severe skin reactions). Patients positive for HLA-B*15:02 may be at increased risk of severe skin reactions with other drugs that are associated with a risk of Stevens Johnson Syndrome/Toxic Epidermal necrolysis (SJS/TEN). Genotyping is not a substitute for clinical vigilance."",
"classification": "Unspecified",
"activityScore": {},
"population": "Affected subgroup: HLA-B*15:02 allele positive",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "HLA-B",
"name": "*15:02",
"function": null,
"reference": false,
"activityValue": null
},
"allele2": {
"gene": "HLA-B",
"name": "*57:01",
"function": null,
"reference": false,
"activityValue": null
},
"gene": "HLA-B",
"matchScore": 0,
"phenotypes": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"label": "*15:02/*57:01",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": true,
"phenotypes": {
"HLA-B": "*15:02 positive"
},
"lookupKey": [
{
"HLA-B": "*15:02 positive"
}
]
}
]
}
]
},
"pantoprazole": {
"name": "pantoprazole",
"id": "PA450774",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329582"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329582",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Pantoprazole - CYP2C19",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329582",
"annotations": []
}
]
},
"paroxetine": {
"name": "paroxetine",
"id": "PA450801",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329656"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329656",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Paroxetine - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329656",
"annotations": [
{
"implications": [],
"drugRecommendation": ""May alter systemic concentrations."",
"classification": "Unspecified",
"activityScore": {
"CYP2D6": "1.0"
},
"population": "Affected subgroup: CYP2D6 ultrarapid, intermediate, or poor metabolizers",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2D6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2D6",
"name": "*3",
"function": "No function",
"reference": false,
"activityValue": "0.0"
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "1.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"1.0"
],
"label": "*1/*3",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2D6": "Intermediate Metabolizer"
},
"lookupKey": [
{
"CYP2D6": "1.0"
}
]
}
]
}
]
},
"pazopanib": {
"name": "pazopanib",
"id": "PA165291492",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329617",
"https://www.clinpgx.org/fdaPgxAssociations#PA166329618"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329617",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Indicate a Potential Impact on Safety or Response]: Pazopanib - HLA-B",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329617",
"annotations": [
{
"implications": [],
"drugRecommendation": ""May result in higher adverse reaction risk (liver enzyme elevations). Monitor liver function tests regardless of genotype."",
"classification": "Unspecified",
"activityScore": {},
"population": "Affected subgroup: HLA-B*57:01 allele positive",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "HLA-B",
"name": "*15:02",
"function": null,
"reference": false,
"activityValue": null
},
"allele2": {
"gene": "HLA-B",
"name": "*57:01",
"function": null,
"reference": false,
"activityValue": null
},
"gene": "HLA-B",
"matchScore": 0,
"phenotypes": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"label": "*15:02/*57:01",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": true,
"phenotypes": {
"HLA-B": "*57:01 positive"
},
"lookupKey": [
{
"HLA-B": "*57:01 positive"
}
]
}
]
},
{
"id": "PA166329618",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Indicate a Potential Impact on Safety or Response]: Pazopanib - UGT1A1",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329618",
"annotations": []
}
]
},
"perphenazine": {
"name": "perphenazine",
"id": "PA450882",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329619"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329619",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Indicate a Potential Impact on Safety or Response]: Perphenazine - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329619",
"annotations": []
}
]
},
"phenytoin": {
"name": "phenytoin",
"id": "PA450947",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "Phenytoin_HLA-B warning",
"version": "1",
"matches": {
"gene": null,
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"phenytoin",
"fosphenytoin"
]
},
"exception_type": "note",
"message": "The displayed recommendation for CYP2C9 and phenytoin is ONLY valid for non-carriers of the HLA-B*15:02 high-risk allele. PharmCAT Named Allele Matcher does not determine HLA status. CPIC guidance: Fos-/Phenytoin is contraindicated in individuals with the HLA-B*15:02 variant allele (\"HLA-B*15:02-positive\") due to significantly increased risk of fos-/phenytoin-induced cutaneous adverse reactions of Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN). In HLA-B*15:02 carriers, carbamazepine should not be used as an alternative. Alternative medications such as oxcarbazepine, eslicarbazepine acetate, and lamotrigine have some evidence linking SJS/TEN with the HLA-B*15:02 allele, and thus caution should be used in choosing alternatives to phenytoin."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329583",
"https://www.clinpgx.org/fdaPgxAssociations#PA166329584"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329583",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Phenytoin - CYP2C9",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329583",
"annotations": []
},
{
"id": "PA166329584",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Phenytoin - HLA-B",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329584",
"annotations": [
{
"implications": [],
"drugRecommendation": ""May result in higher adverse reaction risk (severe cutaneous reactions). Patients positive for HLA-B*15:02 may be at increased risk of Stevens Johnson Syndrome/Toxic Epidermal necrolysis (SJS/TEN). Consider avoiding phenytoin as an alternative to carbamazepine in patients who are positive for HLA-B*15:02. Genotyping is not a substitute for clinical vigilance and patient management."",
"classification": "Unspecified",
"activityScore": {},
"population": "HLA-B*15:02 allele positive",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "HLA-B",
"name": "*15:02",
"function": null,
"reference": false,
"activityValue": null
},
"allele2": {
"gene": "HLA-B",
"name": "*57:01",
"function": null,
"reference": false,
"activityValue": null
},
"gene": "HLA-B",
"matchScore": 0,
"phenotypes": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"*15:02 positive",
"*57:01 positive",
"*58:01 negative"
],
"label": "*15:02/*57:01",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": true,
"otherPrescribingGuidance": false,
"phenotypes": {
"HLA-B": "*15:02 positive"
},
"lookupKey": [
{
"HLA-B": "*15:02 positive"
}
]
}
]
}
]
},
"pimozide": {
"name": "pimozide",
"id": "PA450965",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329585"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329585",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Pimozide - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329585",
"annotations": []
}
]
},
"piroxicam": {
"name": "piroxicam",
"id": "PA450985",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329586"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329586",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Piroxicam - CYP2C9",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329586",
"annotations": []
}
]
},
"pitolisant": {
"name": "pitolisant",
"id": "PA166185163",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329587"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329587",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Pitolisant - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329587",
"annotations": []
}
]
},
"procainamide": {
"name": "procainamide",
"id": "PA451108",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329620"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329620",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Indicate a Potential Impact on Safety or Response]: Procainamide - Nonspecific (NAT)",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329620",
"annotations": []
}
]
},
"propafenone": {
"name": "propafenone",
"id": "PA451131",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329588"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329588",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Propafenone - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329588",
"annotations": []
}
]
},
"propranolol": {
"name": "propranolol",
"id": "PA451145",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329614"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329614",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Propranolol - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329614",
"annotations": []
}
]
},
"protriptyline": {
"name": "protriptyline",
"id": "PA451168",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329615"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329615",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Protriptyline - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329615",
"annotations": []
}
]
},
"rabeprazole": {
"name": "rabeprazole",
"id": "PA451216",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329657"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329657",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Rabeprazole - CYP2C19",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329657",
"annotations": []
}
]
},
"raltegravir": {
"name": "raltegravir",
"id": "PA164888966",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329658"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329658",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Raltegravir - UGT1A1",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329658",
"annotations": []
}
]
},
"risperidone": {
"name": "risperidone",
"id": "PA451257",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329659"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329659",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Risperidone - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329659",
"annotations": []
}
]
},
"rosuvastatin": {
"name": "rosuvastatin",
"id": "PA134308647",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "SLCO1B1-drug text",
"version": "1",
"matches": {
"gene": "SLCO1B1",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"simvastatin",
"rosuvastatin",
"pravastatin",
"pitavastatin",
"lovastatin",
"fluvastatin",
"atorvastatin"
]
},
"exception_type": "note",
"message": "The SLCO1B1 genotype (star nomenclature) will be displayed if determinable with the provided VCF based on the SLCO1B1 star allele definition published by CPIC and recommendations are provided based on the genotype.
In case no genotype can be determined, recommendations are based on the rs4149056 genotype alone as per guideline. The minor C allele at rs4149056 defines SLCO1B1*5."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329660"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329660",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Rosuvastatin - SLCO1B1",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329660",
"annotations": []
}
]
},
"sacituzumab govitecan": {
"name": "sacituzumab govitecan",
"id": "PA166225061",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329589"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329589",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Sacituzumab Govitecan-hziy - UGT1A1",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329589",
"annotations": []
}
]
},
"simvastatin": {
"name": "simvastatin",
"id": "PA451363",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "SLCO1B1-drug text",
"version": "1",
"matches": {
"gene": "SLCO1B1",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"simvastatin",
"rosuvastatin",
"pravastatin",
"pitavastatin",
"lovastatin",
"fluvastatin",
"atorvastatin"
]
},
"exception_type": "note",
"message": "The SLCO1B1 genotype (star nomenclature) will be displayed if determinable with the provided VCF based on the SLCO1B1 star allele definition published by CPIC and recommendations are provided based on the genotype.
In case no genotype can be determined, recommendations are based on the rs4149056 genotype alone as per guideline. The minor C allele at rs4149056 defines SLCO1B1*5."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329621"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329621",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Indicate a Potential Impact on Safety or Response]: Simvastatin - SLCO1B1",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329621",
"annotations": []
}
]
},
"siponimod": {
"name": "siponimod",
"id": "PA166182736",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329590"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329590",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Siponimod - CYP2C9",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329590",
"annotations": []
}
]
},
"sulfamethoxazole / trimethoprim": {
"name": "sulfamethoxazole / trimethoprim",
"id": "PA10715",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329622"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329622",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Indicate a Potential Impact on Safety or Response]: Sulfamethoxazole and Trimethoprim - Nonspecific (NAT)",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329622",
"annotations": []
}
]
},
"sulfasalazine": {
"name": "sulfasalazine",
"id": "PA451547",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "G6PD hemizygous samples",
"version": "2",
"matches": {
"gene": "G6PD",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"aminosalicylic acid",
"aspirin",
"chloramphenicol",
"chloroquine",
"ciprofloxacin",
"dapsone",
"dimercaprol",
"doxorubicin",
"furazolidone",
"glyburide",
"hydroxychloroquine",
"mafenide",
"methylene blue",
"nalidixic acid",
"nitrofurantoin",
"norfloxacin",
"ofloxacin",
"pegloticase",
"phenazopyridine",
"primaquine",
"quinine",
"rasburicase",
"sulfadiazine",
"sulfadimidine",
"sulfamethoxazole",
"trimethoprim",
"sulfanilamide",
"sulfasalazine",
"sulfisoxazole",
"tafenoquine",
"tolbutamide",
"toluidine blue",
"vitamin c",
"vitamin k"
]
},
"exception_type": "note",
"message": "PharmCAT reports based on VCF file input and some VCF files do not specify hemizygous (one X chromosome) and instead represent samples as homozygous. See PharmCAT FAQs (https://pharmcat.org/faqs/)."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329623"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329623",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Indicate a Potential Impact on Safety or Response]: Sulfasalazine - Nonspecific (NAT)",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329623",
"annotations": []
}
]
},
"tacrolimus": {
"name": "tacrolimus",
"id": "PA451578",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329592"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329592",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Tacrolimus - CYP3A5",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329592",
"annotations": [
{
"implications": [],
"drugRecommendation": ""Results in lower systemic concentrations, lower probability of achieving target concentrations and may result in higher rejection risk. Measure drug concentrations and adjust dosage based on trough whole blood tacrolimus concentrations."",
"classification": "Unspecified",
"activityScore": {},
"population": "Affected subgroup: CYP3A5 intermediate or normal metabolizers",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP3A5",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP3A5",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP3A5",
"matchScore": 10,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP3A5": "Normal Metabolizer"
},
"lookupKey": [
{
"CYP3A5": "Normal Metabolizer"
}
]
}
]
}
]
},
"tamoxifen": {
"name": "tamoxifen",
"id": "PA451581",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329661"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329661",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Tamoxifen - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329661",
"annotations": [
{
"implications": [],
"drugRecommendation": ""Results in lower systemic active metabolite concentrations. The impact of CYP2D6 intermediate or poor metabolism on efficacy is not well established."",
"classification": "Unspecified",
"activityScore": {
"CYP2D6": "1.0"
},
"population": "Affected subgroup: CYP2D6 intermediate or poor metabolizers",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2D6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2D6",
"name": "*3",
"function": "No function",
"reference": false,
"activityValue": "0.0"
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "1.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"1.0"
],
"label": "*1/*3",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2D6": "Intermediate Metabolizer"
},
"lookupKey": [
{
"CYP2D6": "1.0"
}
]
}
]
}
]
},
"tamsulosin": {
"name": "tamsulosin",
"id": "PA451583",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329662"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329662",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Tamsulosin - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329662",
"annotations": []
}
]
},
"tetrabenazine": {
"name": "tetrabenazine",
"id": "PA140222719",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329593"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329593",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Tetrabenazine - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329593",
"annotations": []
}
]
},
"thioguanine": {
"name": "thioguanine",
"id": "PA451663",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329594"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329594",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Thioguanine - TPMT and/or NUDT15",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329594",
"annotations": []
}
]
},
"thioridazine": {
"name": "thioridazine",
"id": "PA451666",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329595"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329595",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Thioridazine - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329595",
"annotations": []
}
]
},
"tolterodine": {
"name": "tolterodine",
"id": "PA164746757",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329624"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329624",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Indicate a Potential Impact on Safety or Response]: Tolterodine - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329624",
"annotations": []
}
]
},
"tramadol": {
"name": "tramadol",
"id": "PA451735",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329625",
"https://www.clinpgx.org/fdaPgxAssociations#PA166329596"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329625",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Indicate a Potential Impact on Safety or Response]: Tramadol - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329625",
"annotations": []
},
{
"id": "PA166329596",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Tramadol - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329596",
"annotations": []
}
]
},
"trimipramine": {
"name": "trimipramine",
"id": "PA451791",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329663"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329663",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Trimipramine - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329663",
"annotations": [
{
"implications": [],
"drugRecommendation": ""May alter systemic concentrations."",
"classification": "Unspecified",
"activityScore": {
"CYP2D6": "1.0"
},
"population": "Affected subgroup: CYP2D6 ultrarapid, intermediate, or poor metabolizers",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2D6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2D6",
"name": "*3",
"function": "No function",
"reference": false,
"activityValue": "0.0"
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "1.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"1.0"
],
"label": "*1/*3",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2D6": "Intermediate Metabolizer"
},
"lookupKey": [
{
"CYP2D6": "1.0"
}
]
}
]
}
]
},
"valbenazine": {
"name": "valbenazine",
"id": "PA166170051",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329597"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329597",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Valbenazine - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329597",
"annotations": []
}
]
},
"venlafaxine": {
"name": "venlafaxine",
"id": "PA451866",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329598"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329598",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Venlafaxine - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329598",
"annotations": []
}
]
},
"viloxazine": {
"name": "viloxazine",
"id": "PA166251581",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329664"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329664",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Viloxazine - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329664",
"annotations": []
}
]
},
"voriconazole": {
"name": "voriconazole",
"id": "PA10233",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329626"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329626",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Indicate a Potential Impact on Safety or Response]: Voriconazole - CYP2C19",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329626",
"annotations": []
}
]
},
"vortioxetine": {
"name": "vortioxetine",
"id": "PA166122595",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329599"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329599",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Vortioxetine - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329599",
"annotations": []
}
]
},
"warfarin": {
"name": "warfarin",
"id": "PA451906",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329600",
"https://www.clinpgx.org/fdaPgxAssociations#PA166329602"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329600",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Warfarin - CYP2C9",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329600",
"annotations": []
},
{
"id": "PA166329602",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Warfarin - VKORC1",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329602",
"annotations": []
}
]
}
}
},
"messages": [],
"matcherMetadata": {
"namedAlleleMatcherVersion": "2.0.0",
"genomeBuild": "GRCh38.p14",
"inputFilename": "pharmcat.example.vcf",
"timestamp": "2026-02-09T21:20:29.421Z",
"topCandidatesOnly": true,
"findCombinations": false,
"callCyp2d": false,
"sampleId": "Sample_1",
"sampleProps": null
},
"unannotatedGeneCalls": [
{
"alleleDefinitionVersion": "2026-02-09-10-28",
"alleleDefinitionSource": "CLINPGX",
"phenotypeVersion": "2026-02-09-10-28",
"geneSymbol": "F2",
"chr": "chr11",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [],
"relatedDrugs": [],
"sourceDiplotypes": [
{
"allele1": {
"gene": "F2",
"name": "rs1799963 reference (G)",
"function": "Prothrombin 20210A negative",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "F2",
"name": "rs1799963 reference (G)",
"function": "Prothrombin 20210A negative",
"reference": true,
"activityValue": "n/a"
},
"gene": "F2",
"matchScore": 2,
"phenotypes": [
"n/a"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"n/a"
],
"label": "rs1799963 reference (G)/rs1799963 reference (G)",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"rs1799963 reference (G)": 2.0
}
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "F2",
"name": "rs1799963 reference (G)",
"function": "Prothrombin 20210A negative",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "F2",
"name": "rs1799963 reference (G)",
"function": "Prothrombin 20210A negative",
"reference": true,
"activityValue": "n/a"
},
"gene": "F2",
"matchScore": 2,
"phenotypes": [
"n/a"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"n/a"
],
"label": "rs1799963 reference (G)/rs1799963 reference (G)",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"rs1799963 reference (G)": 2.0
}
}
],
"variants": [
{
"gene": "F2",
"chromosome": "chr11",
"position": 46739505,
"dbSnpId": "rs1799963",
"call": "G/G",
"alleles": [
"rs1799963 Prothrombin 20210A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
{
"alleleDefinitionVersion": "2026-02-09-10-28",
"alleleDefinitionSource": "CLINPGX",
"phenotypeVersion": "2026-02-09-10-28",
"geneSymbol": "F5",
"chr": "chr1",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [],
"relatedDrugs": [],
"sourceDiplotypes": [
{
"allele1": {
"gene": "F5",
"name": "rs6025 reference (C)",
"function": "Factor V Leiden negative",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "F5",
"name": "rs6025 reference (C)",
"function": "Factor V Leiden negative",
"reference": true,
"activityValue": "n/a"
},
"gene": "F5",
"matchScore": 2,
"phenotypes": [
"n/a"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"n/a"
],
"label": "rs6025 reference (C)/rs6025 reference (C)",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"rs6025 reference (C)": 2.0
}
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "F5",
"name": "rs6025 reference (C)",
"function": "Factor V Leiden negative",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "F5",
"name": "rs6025 reference (C)",
"function": "Factor V Leiden negative",
"reference": true,
"activityValue": "n/a"
},
"gene": "F5",
"matchScore": 2,
"phenotypes": [
"n/a"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"n/a"
],
"label": "rs6025 reference (C)/rs6025 reference (C)",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"rs6025 reference (C)": 2.0
}
}
],
"variants": [
{
"gene": "F5",
"chromosome": "chr1",
"position": 169549811,
"dbSnpId": "rs6025",
"call": "C/C",
"alleles": [
"rs6025 Factor V Leiden (T)"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
}
]
}