{
"title": "pharmcat.example2",
"timestamp": "2026-02-09T21:20:39.191Z",
"pharmcatVersion": "v3.1.1-7-g1b371646",
"dataVersion": "2026-02-09-10-28",
"genes": {
"ABCG2": {
"alleleDefinitionVersion": "2026-02-09-10-28",
"alleleDefinitionSource": "CLINPGX",
"phenotypeVersion": "2026-02-09-10-28",
"geneSymbol": "ABCG2",
"chr": "chr4",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [],
"relatedDrugs": [
{
"name": "allopurinol",
"id": "PA448320"
},
{
"name": "rosuvastatin",
"id": "PA134308647"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "ABCG2",
"name": "rs2231142 reference (G)",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "ABCG2",
"name": "rs2231142 reference (G)",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "ABCG2",
"matchScore": 2,
"phenotypes": [
"Normal Function"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Function"
],
"label": "rs2231142 reference (G)/rs2231142 reference (G)",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"rs2231142 reference (G)": 2.0
}
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "ABCG2",
"name": "rs2231142 reference (G)",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "ABCG2",
"name": "rs2231142 reference (G)",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "ABCG2",
"matchScore": 2,
"phenotypes": [
"Normal Function"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Function"
],
"label": "rs2231142 reference (G)/rs2231142 reference (G)",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"rs2231142 reference (G)": 2.0
}
}
],
"variants": [
{
"gene": "ABCG2",
"chromosome": "chr4",
"position": 88131171,
"dbSnpId": "rs2231142",
"call": "G/G",
"alleles": [
"rs2231142 variant (T)"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"CACNA1S": {
"alleleDefinitionVersion": "2026-02-09-10-28",
"alleleDefinitionSource": "CLINPGX",
"phenotypeVersion": "2026-02-09-10-28",
"geneSymbol": "CACNA1S",
"chr": "chr1",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "reference-allele",
"version": null,
"matches": null,
"exception_type": "note",
"message": "The CACNA1S Reference allele assignment is characterized by the absence of variants at the positions that are included in the underlying allele definitions."
}
],
"relatedDrugs": [
{
"name": "desflurane",
"id": "PA164749136"
},
{
"name": "enflurane",
"id": "PA449461"
},
{
"name": "halothane",
"id": "PA449845"
},
{
"name": "isoflurane",
"id": "PA450106"
},
{
"name": "methoxyflurane",
"id": "PA450434"
},
{
"name": "sevoflurane",
"id": "PA451341"
},
{
"name": "succinylcholine",
"id": "PA451522"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "CACNA1S",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CACNA1S",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CACNA1S",
"matchScore": 4,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "CACNA1S",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CACNA1S",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CACNA1S",
"matchScore": 4,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
],
"variants": [
{
"gene": "CACNA1S",
"chromosome": "chr1",
"position": 201060815,
"dbSnpId": "rs1800559",
"call": "C/C",
"alleles": [
"c.3257G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CACNA1S",
"chromosome": "chr1",
"position": 201091993,
"dbSnpId": "rs772226819",
"call": "G/G",
"alleles": [
"c.520C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"CFTR": {
"alleleDefinitionVersion": "2026-02-09-10-28",
"alleleDefinitionSource": "CLINPGX",
"phenotypeVersion": "2026-02-09-10-28",
"geneSymbol": "CFTR",
"chr": "chr7",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [],
"relatedDrugs": [
{
"name": "ivacaftor",
"id": "PA165950341"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "CFTR",
"name": "ivacaftor non-responsive CFTR sequence",
"function": "ivacaftor non-responsive",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CFTR",
"name": "ivacaftor non-responsive CFTR sequence",
"function": "ivacaftor non-responsive",
"reference": true,
"activityValue": "n/a"
},
"gene": "CFTR",
"matchScore": 186,
"phenotypes": [
"ivacaftor non-responsive in CF patients"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"ivacaftor non-responsive in CF patients"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"ivacaftor non-responsive CFTR sequence": 2.0
}
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "CFTR",
"name": "ivacaftor non-responsive CFTR sequence",
"function": "ivacaftor non-responsive",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CFTR",
"name": "ivacaftor non-responsive CFTR sequence",
"function": "ivacaftor non-responsive",
"reference": true,
"activityValue": "n/a"
},
"gene": "CFTR",
"matchScore": 186,
"phenotypes": [
"ivacaftor non-responsive in CF patients"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"ivacaftor non-responsive in CF patients"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"ivacaftor non-responsive CFTR sequence": 2.0
}
}
],
"variants": [
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117509035,
"dbSnpId": "rs397508256",
"call": "G/G",
"alleles": [
"E56K"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117509069,
"dbSnpId": "rs368505753",
"call": "C/C",
"alleles": [
"P67L"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117509089,
"dbSnpId": "rs115545701",
"call": "C/C",
"alleles": [
"R74W"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117509093,
"dbSnpId": "rs1800076",
"call": "G/G",
"alleles": [
"R75Q"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117530953,
"dbSnpId": "rs113993958",
"call": "G/G",
"alleles": [
"D110H"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117530955,
"dbSnpId": "rs397508537",
"call": "C/C",
"alleles": [
"D110E"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117530974,
"dbSnpId": "rs77834169",
"call": "C/C",
"alleles": [
"R117C",
"R117G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117530975,
"dbSnpId": "rs78655421",
"call": "G/G",
"alleles": [
"R117H",
"R117L",
"R117P"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117530983,
"dbSnpId": "rs201958172",
"call": "G/G",
"alleles": [
"A120T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117531068,
"dbSnpId": "rs35516286",
"call": "T/T",
"alleles": [
"I148T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117531079,
"dbSnpId": "rs397508721",
"call": "A/A",
"alleles": [
"M152V"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117534295,
"dbSnpId": "rs1800079",
"call": "G/G",
"alleles": [
"R170H"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117534309,
"dbSnpId": "rs397508744",
"call": "A/A",
"alleles": [
"I175V"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117534318,
"dbSnpId": "rs80282562",
"call": "G/G",
"alleles": [
"G178R"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117534319,
"dbSnpId": "rs397508748",
"call": "G/G",
"alleles": [
"G178E"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117534361,
"dbSnpId": "rs397508758",
"call": "A/A",
"alleles": [
"D192G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117534363,
"dbSnpId": "rs397508759",
"call": "G/G",
"alleles": [
"E193K"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117534368,
"dbSnpId": "rs397508761",
"call": "A/A",
"alleles": [
"711+3A->G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117535248,
"dbSnpId": "rs376008630",
"call": "G/G",
"alleles": [
"G194R(G>A)",
"G194R(G>C)"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117535285,
"dbSnpId": "rs121908752",
"call": "T/T",
"alleles": [
"L206W"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117535363,
"dbSnpId": "rs397508783",
"call": "T/T",
"alleles": [
"V232D"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117535369,
"dbSnpId": "rs769016520",
"call": "C/C",
"alleles": [
"A234D"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117535377,
"dbSnpId": "rs397508784",
"call": "C/C",
"alleles": [
"Q237E"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117535379,
"dbSnpId": "rs397508785",
"call": "G/G",
"alleles": [
"Q237H"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117540156,
"dbSnpId": null,
"call": "CCTT/CCTT",
"alleles": [
"F311del"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "CCTT",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117540161,
"dbSnpId": "rs2116683801",
"call": "T/T",
"alleles": [
"F311L"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117540171,
"dbSnpId": "rs75763344",
"call": "G/G",
"alleles": [
"G314E"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117540188,
"dbSnpId": "rs144476686",
"call": "T/T",
"alleles": [
"L320V"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117540243,
"dbSnpId": "rs77409459",
"call": "C/C",
"alleles": [
"T338I"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117540270,
"dbSnpId": "rs77932196",
"call": "G/G",
"alleles": [
"R347H",
"R347L"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117540276,
"dbSnpId": "rs121909021",
"call": "C/C",
"alleles": [
"A349V"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117540285,
"dbSnpId": "rs121908753",
"call": "G/G",
"alleles": [
"R352Q"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117540306,
"dbSnpId": "rs397508153",
"call": "A/A",
"alleles": [
"Q359R"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117548795,
"dbSnpId": "rs74551128",
"call": "C/C",
"alleles": [
"A455E"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117559594,
"dbSnpId": "rs74571530",
"call": "T/T",
"alleles": [
"F508C",
"F508C,S1251N"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117587799,
"dbSnpId": "rs121908757",
"call": "A/A",
"alleles": [
"S549R(A>C)"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117587800,
"dbSnpId": "rs121908755",
"call": "G/G",
"alleles": [
"S549N"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117587801,
"dbSnpId": "rs121909005",
"call": "T/T",
"alleles": [
"S549R(T>G)"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117587805,
"dbSnpId": "rs121909013",
"call": "G/G",
"alleles": [
"G551S"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117587806,
"dbSnpId": "rs75527207",
"call": "G/G",
"alleles": [
"G551D"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117587812,
"dbSnpId": "rs121909044",
"call": "G/G",
"alleles": [
"R553Q"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117590357,
"dbSnpId": "rs1800097",
"call": "G/G",
"alleles": [
"V562I"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117590400,
"dbSnpId": "rs1800098",
"call": "G/G",
"alleles": [
"G576A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117590409,
"dbSnpId": "rs397508288",
"call": "A/A",
"alleles": [
"D579G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117590439,
"dbSnpId": "rs397508300",
"call": "G/G",
"alleles": [
"S589N"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117592169,
"dbSnpId": "rs1800100",
"call": "C/C",
"alleles": [
"R668C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117592377,
"dbSnpId": "rs186089140",
"call": "C/C",
"alleles": [
"S737F"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117592427,
"dbSnpId": "rs150157202",
"call": "G/G",
"alleles": [
"V754M"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117592541,
"dbSnpId": "rs145449046",
"call": "C/C",
"alleles": [
"R792G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117592588,
"dbSnpId": "rs1800103",
"call": "A/A",
"alleles": [
"I807M"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117592631,
"dbSnpId": "rs397508378",
"call": "G/G",
"alleles": [
"E822K"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117594930,
"dbSnpId": "rs397508387",
"call": "G/G",
"alleles": [
"E831X"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117602868,
"dbSnpId": "rs80224560",
"call": "G/G",
"alleles": [
"2789+5G->A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117603644,
"dbSnpId": "rs201759207",
"call": "G/G",
"alleles": [
"D924N"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117603671,
"dbSnpId": "rs397508436",
"call": "A/A",
"alleles": [
"R933G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117603690,
"dbSnpId": "rs397508440",
"call": "A/A",
"alleles": [
"H939R"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117603708,
"dbSnpId": "rs397508442",
"call": "C/C",
"alleles": [
"S945L"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117603729,
"dbSnpId": "rs142773283",
"call": "T/T",
"alleles": [
"M952T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117603730,
"dbSnpId": "rs151048781",
"call": "G/G",
"alleles": [
"M952I(G>A)",
"M952I(G>C)",
"M952I(G>T)"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117603774,
"dbSnpId": "rs1800110",
"call": "T/T",
"alleles": [
"L967S"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117606674,
"dbSnpId": "rs386134230",
"call": "G/G",
"alleles": [
"G970D"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117606695,
"dbSnpId": "rs141033578",
"call": "C/C",
"alleles": [
"S977F"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117610521,
"dbSnpId": "rs1800111",
"call": "G/G",
"alleles": [
"L997F(G>C)",
"L997F(G>T)"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117610571,
"dbSnpId": "rs149279509",
"call": "A/A",
"alleles": [
"Y1014C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117610610,
"dbSnpId": "rs1800112",
"call": "T/T",
"alleles": [
"I1027T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117610625,
"dbSnpId": "rs144055758",
"call": "A/A",
"alleles": [
"Y1032C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117611555,
"dbSnpId": "rs76151804",
"call": "A/A",
"alleles": [
"3272-26A->G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117611595,
"dbSnpId": "rs150212784",
"call": "T/T",
"alleles": [
"F1052V"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117611599,
"dbSnpId": "rs140883683",
"call": "C/C",
"alleles": [
"T1053I"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117611620,
"dbSnpId": "rs397508513",
"call": "A/A",
"alleles": [
"K1060T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117611640,
"dbSnpId": "rs121909020",
"call": "G/G",
"alleles": [
"A1067T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117611646,
"dbSnpId": "rs200321110",
"call": "G/G",
"alleles": [
"G1069R"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117611649,
"dbSnpId": "rs202179988",
"call": "C/C",
"alleles": [
"R1070W"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117611650,
"dbSnpId": "rs78769542",
"call": "G/G",
"alleles": [
"R1070Q"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117611663,
"dbSnpId": "rs186045772",
"call": "T/T",
"alleles": [
"F1074L"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117614660,
"dbSnpId": "rs397508556",
"call": "A/A",
"alleles": [
"I1139V"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117614699,
"dbSnpId": "rs75541969",
"call": "G/G",
"alleles": [
"D1152H"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117627528,
"dbSnpId": "rs397508572",
"call": "T/T",
"alleles": [
"S1159P"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117627529,
"dbSnpId": "rs397508573",
"call": "C/C",
"alleles": [
"S1159F"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117627538,
"dbSnpId": "rs1800120",
"call": "G/G",
"alleles": [
"R1162L"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117639961,
"dbSnpId": "rs75039782",
"call": "C/C",
"alleles": [
"3849+10kbC->T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117642451,
"dbSnpId": "rs267606723",
"call": "G/G",
"alleles": [
"G1244E"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117642465,
"dbSnpId": "rs397508602",
"call": "G/G",
"alleles": [
"G1249R(G>A)",
"G1249R(G>C)"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117642472,
"dbSnpId": "rs74503330",
"call": "G/G",
"alleles": [
"F508C,S1251N",
"S1251N"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117642483,
"dbSnpId": "rs121909041",
"call": "T/T",
"alleles": [
"S1255P"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117642528,
"dbSnpId": "rs11971167",
"call": "G/G",
"alleles": [
"D1270N"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117642564,
"dbSnpId": "rs397508616",
"call": "T/T",
"alleles": [
"W1282R"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117642568,
"dbSnpId": "rs77902683",
"call": "G/G",
"alleles": [
"R1283M"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117642592,
"dbSnpId": "rs397508621",
"call": "A/A",
"alleles": [
"Q1291R"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117652846,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"V1293G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117664770,
"dbSnpId": "rs193922525",
"call": "G/G",
"alleles": [
"G1349D"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117664848,
"dbSnpId": "rs397508678",
"call": "A/A",
"alleles": [
"H1375P"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CFTR",
"chromosome": "chr7",
"position": 117667104,
"dbSnpId": "rs758818611",
"call": "T/T",
"alleles": [
"L1480P"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"CYP2B6": {
"alleleDefinitionVersion": "2026-02-09-10-28",
"alleleDefinitionSource": "CLINPGX",
"phenotypeVersion": "2026-02-09-10-28",
"geneSymbol": "CYP2B6",
"chr": "chr19",
"phased": false,
"effectivelyPhased": false,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "CYP2B6 *1/*6 warning",
"version": "1",
"matches": {
"gene": "CYP2B6",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [
"*1/*6"
],
"drugs": [
"efavirenz"
]
},
"exception_type": "ambiguity",
"message": "The assigned genotype is *1/*6; however, *4/*9 cannot be ruled out without phased data."
},
{
"rule_name": "reference-allele",
"version": null,
"matches": null,
"exception_type": "note",
"message": "The CYP2B6 *1 allele assignment is characterized by the absence of variants at the positions that are included in the underlying allele definitions."
}
],
"relatedDrugs": [
{
"name": "efavirenz",
"id": "PA449441"
},
{
"name": "sertraline",
"id": "PA451333"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "CYP2B6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2B6",
"name": "*6",
"function": "Decreased function",
"reference": false,
"activityValue": "n/a"
},
"gene": "CYP2B6",
"matchScore": 50,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Intermediate Metabolizer"
],
"label": "*1/*6",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 1.0,
"*6": 1.0
}
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "CYP2B6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2B6",
"name": "*6",
"function": "Decreased function",
"reference": false,
"activityValue": "n/a"
},
"gene": "CYP2B6",
"matchScore": 50,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Intermediate Metabolizer"
],
"label": "*1/*6",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 1.0,
"*6": 1.0
}
}
],
"variants": [
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 40991224,
"dbSnpId": "rs34223104",
"call": "T/T",
"alleles": [
"*22",
"*34",
"*35",
"*36",
"*50"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 40991367,
"dbSnpId": "rs34883432",
"call": "A/A",
"alleles": [
"*10"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 40991369,
"dbSnpId": "rs8192709",
"call": "C/C",
"alleles": [
"*2",
"*10"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 40991381,
"dbSnpId": "rs33973337",
"call": "A/A",
"alleles": [
"*17"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 40991388,
"dbSnpId": "rs33980385",
"call": "A/A",
"alleles": [
"*17"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 40991390,
"dbSnpId": "rs33926104",
"call": "C/C",
"alleles": [
"*17"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 40991391,
"dbSnpId": "rs34284776",
"call": "G/G",
"alleles": [
"*17"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 40991441,
"dbSnpId": "rs35303484",
"call": "A/A",
"alleles": [
"*11"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41004015,
"dbSnpId": "rs281864907",
"call": "T/T",
"alleles": [
"*38"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41004125,
"dbSnpId": "rs36060847",
"call": "G/G",
"alleles": [
"*12"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41004133,
"dbSnpId": "rs148009906",
"call": "G/G",
"alleles": [
"*44"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41004158,
"dbSnpId": "rs186335453",
"call": "G/G",
"alleles": [
"*35"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41004303,
"dbSnpId": "rs139801276",
"call": "T/T",
"alleles": [
"*35"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41004377,
"dbSnpId": "rs12721655",
"call": "A/A",
"alleles": [
"*8",
"*13"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41004380,
"dbSnpId": "rs535039125",
"call": "C/C",
"alleles": [
"*39"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41004381,
"dbSnpId": "rs35773040",
"call": "G/G",
"alleles": [
"*14"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41004406,
"dbSnpId": "rs145884402",
"call": "G/G",
"alleles": [
"*35"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41004435,
"dbSnpId": "rs141666881",
"call": "G/G",
"alleles": [
"*50"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41006919,
"dbSnpId": "rs3826711",
"call": "C/C",
"alleles": [
"*26"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41006923,
"dbSnpId": "rs36056539",
"call": "C/C",
"alleles": [
"*20"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41006936,
"dbSnpId": "rs3745274",
"call": "G/T",
"alleles": [
"*6",
"*7",
"*9",
"*13",
"*19",
"*20",
"*26",
"*34",
"*36",
"*37",
"*38",
"*39",
"*40",
"*41",
"*42",
"*43"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41006967,
"dbSnpId": "rs58871670",
"call": "G/G",
"alleles": [
"*45"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41006968,
"dbSnpId": "rs373489637",
"call": "T/T",
"alleles": [
"*37"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41007013,
"dbSnpId": "rs36079186",
"call": "T/T",
"alleles": [
"*27",
"*35"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41009313,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"*46"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41009350,
"dbSnpId": "rs45482602",
"call": "C/C",
"alleles": [
"*3"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41009358,
"dbSnpId": "rs2279343",
"call": "A/G",
"alleles": [
"*4",
"*6",
"*7",
"*13",
"*18",
"*19",
"*20",
"*26",
"*34",
"*36",
"*37",
"*38",
"*39",
"*40",
"*41",
"*42",
"*43"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41010006,
"dbSnpId": "rs139029625",
"call": "G/G",
"alleles": [
"*35"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41010088,
"dbSnpId": "rs34698757",
"call": "C/C",
"alleles": [
"*28"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41010108,
"dbSnpId": "rs193922917",
"call": "C/C",
"alleles": [
"*31"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41012316,
"dbSnpId": "rs28399499",
"call": "T/T",
"alleles": [
"*18"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41012339,
"dbSnpId": "rs34826503",
"call": "C/C",
"alleles": [
"*19"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41012393,
"dbSnpId": "rs754621576",
"call": "T/T",
"alleles": [
"*47"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41012394,
"dbSnpId": "rs780991919",
"call": "A/A",
"alleles": [
"*47"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41012465,
"dbSnpId": "rs34097093",
"call": "C/C",
"alleles": [
"*28"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41012466,
"dbSnpId": "rs200458614",
"call": "G/G",
"alleles": [
"*40"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41012471,
"dbSnpId": "rs201500445",
"call": "T/T",
"alleles": [
"*41"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41012478,
"dbSnpId": "rs200238771",
"call": "T/T",
"alleles": [
"*48"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41012693,
"dbSnpId": "rs35979566",
"call": "T/T",
"alleles": [
"*15"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41012740,
"dbSnpId": "rs193922918",
"call": "G/G",
"alleles": [
"*32"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41012803,
"dbSnpId": "rs35010098",
"call": "C/C",
"alleles": [
"*21"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41016652,
"dbSnpId": "rs764288403",
"call": "G/G",
"alleles": [
"*49"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41016679,
"dbSnpId": "rs374099483",
"call": "G/G",
"alleles": [
"*42"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41016726,
"dbSnpId": "rs3211369",
"call": "A/A",
"alleles": [
"*23"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41016741,
"dbSnpId": "rs117872433",
"call": "G/G",
"alleles": [
"*43"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41016778,
"dbSnpId": "rs564083989",
"call": "G/G",
"alleles": [
"*24"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41016805,
"dbSnpId": "rs2516199080",
"call": "A/A",
"alleles": [
"*25"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2B6",
"chromosome": "chr19",
"position": 41016810,
"dbSnpId": "rs3211371",
"call": "C/C",
"alleles": [
"*5",
"*7",
"*33",
"*34"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"CYP2C19": {
"alleleDefinitionVersion": "2026-02-09-10-28",
"alleleDefinitionSource": "CLINPGX",
"phenotypeVersion": "2026-02-09-10-28",
"geneSymbol": "CYP2C19",
"chr": "chr10",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [],
"relatedDrugs": [
{
"name": "abrocitinib",
"id": "PA166272921"
},
{
"name": "amitriptyline",
"id": "PA448385"
},
{
"name": "belzutifan",
"id": "PA166268761"
},
{
"name": "brivaracetam",
"id": "PA166153491"
},
{
"name": "carisoprodol",
"id": "PA448809"
},
{
"name": "citalopram",
"id": "PA449015"
},
{
"name": "clobazam",
"id": "PA10888"
},
{
"name": "clomipramine",
"id": "PA449048"
},
{
"name": "clopidogrel",
"id": "PA449053"
},
{
"name": "dexlansoprazole",
"id": "PA166110257"
},
{
"name": "diazepam",
"id": "PA449283"
},
{
"name": "doxepin",
"id": "PA449409"
},
{
"name": "escitalopram",
"id": "PA10074"
},
{
"name": "esomeprazole",
"id": "PA10075"
},
{
"name": "flibanserin",
"id": "PA166153431"
},
{
"name": "imipramine",
"id": "PA449969"
},
{
"name": "lansoprazole",
"id": "PA450180"
},
{
"name": "mavacamten",
"id": "PA166272922"
},
{
"name": "omeprazole",
"id": "PA450704"
},
{
"name": "pantoprazole",
"id": "PA450774"
},
{
"name": "rabeprazole",
"id": "PA451216"
},
{
"name": "sertraline",
"id": "PA451333"
},
{
"name": "trimipramine",
"id": "PA451791"
},
{
"name": "voriconazole",
"id": "PA10233"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 6,
"phenotypes": [
"Poor Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Poor Metabolizer"
],
"label": "*2/*2",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*2": 2.0
}
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 6,
"phenotypes": [
"Poor Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Poor Metabolizer"
],
"label": "*2/*2",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*2": 2.0
}
}
],
"variants": [
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94761900,
"dbSnpId": "rs12248560",
"call": "C/C",
"alleles": [
"*1",
"*4",
"*17"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94762706,
"dbSnpId": "rs28399504",
"call": "A/A",
"alleles": [
"*1",
"*4"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94762712,
"dbSnpId": "rs367543002",
"call": "C/C",
"alleles": [
"*1",
"*34",
"*40"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94762715,
"dbSnpId": "rs367543003",
"call": "T/T",
"alleles": [
"*1",
"*34",
"*40"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94762755,
"dbSnpId": "rs55752064",
"call": "T/T",
"alleles": [
"*1",
"*14"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94762760,
"dbSnpId": "rs17882687",
"call": "A/A",
"alleles": [
"*1",
"*15",
"*28",
"*35",
"*39"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94762788,
"dbSnpId": "rs1564656981",
"call": "A/A",
"alleles": [
"*1",
"*29"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94762856,
"dbSnpId": "rs1564657013",
"call": "A/A",
"alleles": [
"*1",
"*19"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94775106,
"dbSnpId": "rs145328984",
"call": "C/C",
"alleles": [
"*1",
"*30"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94775121,
"dbSnpId": "rs1564660997",
"call": "C/C",
"alleles": [
"*1",
"*31"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94775160,
"dbSnpId": "rs118203756",
"call": "G/G",
"alleles": [
"*1",
"*23"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94775185,
"dbSnpId": "rs1288601658",
"call": "A/A",
"alleles": [
"*1",
"*32"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94775367,
"dbSnpId": "rs12769205",
"call": "G/G",
"alleles": [
"*1",
"*2",
"*35"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94775416,
"dbSnpId": "rs41291556",
"call": "T/T",
"alleles": [
"*1",
"*8"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94775423,
"dbSnpId": "rs17885179",
"call": "A/A",
"alleles": [
"*1",
"*39"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94775453,
"dbSnpId": "rs72552267",
"call": "G/G",
"alleles": [
"*1",
"*6"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94775489,
"dbSnpId": "rs17884712",
"call": "G/G",
"alleles": [
"*1",
"*9"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94775507,
"dbSnpId": "rs58973490",
"call": "G/G",
"alleles": [
"*1",
"*2",
"*11"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94780544,
"dbSnpId": "rs57700608",
"call": "A/A",
"alleles": [
"*1",
"*41"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94780574,
"dbSnpId": "rs140278421",
"call": "G/G",
"alleles": [
"*1",
"*22"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94780579,
"dbSnpId": "rs370803989",
"call": "G/G",
"alleles": [
"*1",
"*33"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94780653,
"dbSnpId": "rs4986893",
"call": "G/G",
"alleles": [
"*1",
"*3"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94781858,
"dbSnpId": "rs6413438",
"call": "C/C",
"alleles": [
"*1",
"*10"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94781859,
"dbSnpId": "rs4244285",
"call": "A/A",
"alleles": [
"*1",
"*2"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94781944,
"dbSnpId": "rs375781227",
"call": "G/G",
"alleles": [
"*1",
"*26"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94781999,
"dbSnpId": "rs72558186",
"call": "T/T",
"alleles": [
"*1",
"*7"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94842861,
"dbSnpId": "rs138142612",
"call": "G/G",
"alleles": [
"*1",
"*18"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94842866,
"dbSnpId": "rs3758581",
"call": "G/G",
"alleles": [
"*1",
"*2",
"*3",
"*4",
"*5",
"*6",
"*7",
"*8",
"*9",
"*10",
"*11",
"*12",
"*13",
"*14",
"*15",
"*17",
"*18",
"*19",
"*22",
"*23",
"*24",
"*25",
"*26",
"*28",
"*29",
"*31",
"*32",
"*33",
"*35",
"*39",
"*40",
"*41"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94842879,
"dbSnpId": "rs118203757",
"call": "G/G",
"alleles": [
"*1",
"*24"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94842995,
"dbSnpId": "rs113934938",
"call": "G/G",
"alleles": [
"*1",
"*28"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94849995,
"dbSnpId": "rs17879685",
"call": "C/C",
"alleles": [
"*1",
"*13"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94852738,
"dbSnpId": "rs56337013",
"call": "C/C",
"alleles": [
"*1",
"*5"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94852765,
"dbSnpId": "rs192154563",
"call": "C/C",
"alleles": [
"*1",
"*16"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94852785,
"dbSnpId": "rs118203759",
"call": "C/C",
"alleles": [
"*1",
"*25"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C19",
"chromosome": "chr10",
"position": 94852914,
"dbSnpId": "rs55640102",
"call": "A/A",
"alleles": [
"*1",
"*12"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"CYP2C9": {
"alleleDefinitionVersion": "2026-02-09-10-28",
"alleleDefinitionSource": "CLINPGX",
"phenotypeVersion": "2026-02-09-10-28",
"geneSymbol": "CYP2C9",
"chr": "chr10",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "reference-allele",
"version": null,
"matches": null,
"exception_type": "note",
"message": "The CYP2C9 *1 allele assignment is characterized by the absence of variants at the positions that are included in the underlying allele definitions."
}
],
"relatedDrugs": [
{
"name": "avatrombopag",
"id": "PA166179849"
},
{
"name": "celecoxib",
"id": "PA448871"
},
{
"name": "deuruxolitinib",
"id": "PA166400021"
},
{
"name": "dronabinol",
"id": "PA449421"
},
{
"name": "erdafitinib",
"id": "PA166182720"
},
{
"name": "flurbiprofen",
"id": "PA449683"
},
{
"name": "fluvastatin",
"id": "PA449688"
},
{
"name": "fosphenytoin",
"id": "PA164746820"
},
{
"name": "ibuprofen",
"id": "PA449957"
},
{
"name": "lesinurad",
"id": "PA166160006"
},
{
"name": "lornoxicam",
"id": "PA165958395"
},
{
"name": "meloxicam",
"id": "PA450353"
},
{
"name": "nateglinide",
"id": "PA450600"
},
{
"name": "phenytoin",
"id": "PA450947"
},
{
"name": "piroxicam",
"id": "PA450985"
},
{
"name": "seladelpar",
"id": "PA166400041"
},
{
"name": "siponimod",
"id": "PA166182736"
},
{
"name": "tenoxicam",
"id": "PA131890625"
},
{
"name": "warfarin",
"id": "PA451906"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "CYP2C9",
"matchScore": 166,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "CYP2C9",
"matchScore": 166,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
],
"variants": [
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94938683,
"dbSnpId": "rs114071557",
"call": "A/A",
"alleles": [
"*36"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94938719,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"*80"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94938737,
"dbSnpId": "rs67807361",
"call": "C/C",
"alleles": [
"*7"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94938771,
"dbSnpId": "rs142240658",
"call": "C/C",
"alleles": [
"*21"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94938788,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"*83"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94938800,
"dbSnpId": "rs1364419386",
"call": "G/G",
"alleles": [
"*76"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94938803,
"dbSnpId": "rs2031308986",
"call": "A/A",
"alleles": [
"*22"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94938828,
"dbSnpId": "rs564813580",
"call": "A/A",
"alleles": [
"*37"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94941897,
"dbSnpId": "rs371055887",
"call": "G/G",
"alleles": [
"*20"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94941915,
"dbSnpId": "rs1216169538",
"call": "G/G",
"alleles": [
"*23"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94941958,
"dbSnpId": "rs72558187",
"call": "T/T",
"alleles": [
"*13"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94941975,
"dbSnpId": "rs2493006942",
"call": "G/G",
"alleles": [
"*77"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94941976,
"dbSnpId": "rs761033063",
"call": "G/G",
"alleles": [
"*38"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94941982,
"dbSnpId": "rs762239445",
"call": "G/G",
"alleles": [
"*39"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942018,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"*40"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942205,
"dbSnpId": "rs1304490498",
"call": "CAATGGAAAGA/CAATGGAAAGA",
"alleles": [
"*25"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "CAATGGAAAGA",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942216,
"dbSnpId": "rs774607211",
"call": "A/A",
"alleles": [
"*41"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942230,
"dbSnpId": "rs767576260",
"call": "C/C",
"alleles": [
"*43"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942231,
"dbSnpId": "rs12414460",
"call": "G/G",
"alleles": [
"*42"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942233,
"dbSnpId": "rs375805362",
"call": "C/C",
"alleles": [
"*62"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942234,
"dbSnpId": "rs72558189",
"call": "G/G",
"alleles": [
"*14",
"*35"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942240,
"dbSnpId": "rs530507053",
"call": "C/C",
"alleles": [
"*88"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942243,
"dbSnpId": "rs1375956433",
"call": "T/T",
"alleles": [
"*78"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942249,
"dbSnpId": "rs200965026",
"call": "C/C",
"alleles": [
"*26",
"*44"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942254,
"dbSnpId": "rs199523631",
"call": "C/C",
"alleles": [
"*45"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942255,
"dbSnpId": "rs200183364",
"call": "G/G",
"alleles": [
"*33"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942290,
"dbSnpId": "rs1799853",
"call": "C/C",
"alleles": [
"*2",
"*35",
"*61"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942291,
"dbSnpId": "rs141489852",
"call": "G/G",
"alleles": [
"*63"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942305,
"dbSnpId": "rs754487195",
"call": "G/G",
"alleles": [
"*46"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942306,
"dbSnpId": "rs1289704600",
"call": "C/C",
"alleles": [
"*72"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942308,
"dbSnpId": "rs17847037",
"call": "C/C",
"alleles": [
"*73"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94942309,
"dbSnpId": "rs7900194",
"call": "G/G",
"alleles": [
"*8",
"*27"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94947782,
"dbSnpId": "rs72558190",
"call": "C/C",
"alleles": [
"*15"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94947785,
"dbSnpId": "rs774550549",
"call": "C/C",
"alleles": [
"*47"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94947869,
"dbSnpId": "rs2492587526",
"call": "A/A",
"alleles": [
"*69"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94947907,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"*57"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94947917,
"dbSnpId": "rs1326630788",
"call": "T/T",
"alleles": [
"*48"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94947938,
"dbSnpId": "rs2031531005",
"call": "A/A",
"alleles": [
"*28"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94947939,
"dbSnpId": "rs370100007",
"call": "G/G",
"alleles": [
"*74"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94949129,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"*49"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94949144,
"dbSnpId": "rs2492591692",
"call": "C/C",
"alleles": [
"*50"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94949145,
"dbSnpId": "rs772782449",
"call": "C/C",
"alleles": [
"*82"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94949161,
"dbSnpId": null,
"call": "AT/AT",
"alleles": [
"*85"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "AT",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94949184,
"dbSnpId": "rs369745682",
"call": "T/T",
"alleles": [
"*86"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94949217,
"dbSnpId": "rs2256871",
"call": "A/A",
"alleles": [
"*9"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94949280,
"dbSnpId": "rs9332130",
"call": "A/A",
"alleles": [
"*10",
"*71"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94949281,
"dbSnpId": "rs9332131",
"call": "GA/GA",
"alleles": [
"*6"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "GA",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94972119,
"dbSnpId": "rs182132442",
"call": "C/C",
"alleles": [
"*29"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94972123,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"*64"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94972134,
"dbSnpId": "rs2492634549",
"call": "A/A",
"alleles": [
"*51"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94972179,
"dbSnpId": "rs72558192",
"call": "A/A",
"alleles": [
"*16"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94972180,
"dbSnpId": "rs988617574",
"call": "C/C",
"alleles": [
"*52"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94972183,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"*81"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94972194,
"dbSnpId": "rs546318684",
"call": "A/A",
"alleles": [
"*87"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94972233,
"dbSnpId": "rs1237225311",
"call": "C/C",
"alleles": [
"*53"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94981199,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"*65"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94981201,
"dbSnpId": "rs57505750",
"call": "T/T",
"alleles": [
"*31"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94981224,
"dbSnpId": "rs28371685",
"call": "C/C",
"alleles": [
"*11"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94981225,
"dbSnpId": "rs367826293",
"call": "G/G",
"alleles": [
"*34"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94981230,
"dbSnpId": "rs1274535931",
"call": "C/C",
"alleles": [
"*58"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94981250,
"dbSnpId": "rs750820937",
"call": "C/C",
"alleles": [
"*54"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94981258,
"dbSnpId": "rs1297714792",
"call": "C/C",
"alleles": [
"*79"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94981281,
"dbSnpId": "rs749060448",
"call": "G/G",
"alleles": [
"*24"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94981296,
"dbSnpId": "rs1057910",
"call": "A/A",
"alleles": [
"*3",
"*18",
"*68"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94981297,
"dbSnpId": "rs56165452",
"call": "T/T",
"alleles": [
"*4"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94981301,
"dbSnpId": "rs28371686",
"call": "C/C",
"alleles": [
"*5",
"*36"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94981302,
"dbSnpId": "rs1250577724",
"call": "C/C",
"alleles": [
"*55"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94981305,
"dbSnpId": "rs578144976",
"call": "C/C",
"alleles": [
"*66"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94981365,
"dbSnpId": "rs2492650213",
"call": "C/C",
"alleles": [
"*17"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94981371,
"dbSnpId": "rs542577750",
"call": "G/G",
"alleles": [
"*68"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94986042,
"dbSnpId": "rs764211126",
"call": "A/A",
"alleles": [
"*56"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94986073,
"dbSnpId": "rs72558193",
"call": "A/A",
"alleles": [
"*18"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94986136,
"dbSnpId": "rs1254213342",
"call": "A/A",
"alleles": [
"*75"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94986174,
"dbSnpId": "rs1441296358",
"call": "G/G",
"alleles": [
"*84"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94988852,
"dbSnpId": "rs776908257",
"call": "C/C",
"alleles": [
"*67"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94988855,
"dbSnpId": "rs2492662738",
"call": "A/A",
"alleles": [
"*59"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94988880,
"dbSnpId": "rs2492662839",
"call": "G/G",
"alleles": [
"*70"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94988917,
"dbSnpId": "rs769942899",
"call": "G/G",
"alleles": [
"*19"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94988925,
"dbSnpId": "rs202201137",
"call": "A/A",
"alleles": [
"*61"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94988955,
"dbSnpId": "rs767284820",
"call": "T/T",
"alleles": [
"*60"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94988984,
"dbSnpId": "rs781583846",
"call": "G/G",
"alleles": [
"*30"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94989020,
"dbSnpId": "rs9332239",
"call": "C/C",
"alleles": [
"*12",
"*71"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94989023,
"dbSnpId": "rs868182778",
"call": "G/G",
"alleles": [
"*32"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [
{
"gene": "CYP2C9",
"chromosome": "chr10",
"position": 94645745,
"dbSnpId": "rs12777823",
"call": "G/G",
"alleles": [],
"phased": false,
"phaseSet": null,
"referenceAllele": null,
"hasUndocumentedVariations": false,
"warnings": []
}
],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"CYP2D6": {
"alleleDefinitionVersion": null,
"alleleDefinitionSource": "UNKNOWN",
"phenotypeVersion": "2026-02-09-10-28",
"geneSymbol": "CYP2D6",
"chr": null,
"phased": false,
"effectivelyPhased": false,
"callSource": "NONE",
"uncalledHaplotypes": [],
"messages": [],
"relatedDrugs": [
{
"name": "acetaminophen / caffeine / dihydrocodeine",
"id": "PA166246281"
},
{
"name": "amitriptyline",
"id": "PA448385"
},
{
"name": "amoxapine",
"id": "PA448405"
},
{
"name": "amphetamine",
"id": "PA448408"
},
{
"name": "aripiprazole",
"id": "PA10026"
},
{
"name": "aripiprazole lauroxil",
"id": "PA166161216"
},
{
"name": "atomoxetine",
"id": "PA134688071"
},
{
"name": "brexpiprazole",
"id": "PA166160053"
},
{
"name": "carvedilol",
"id": "PA448817"
},
{
"name": "cevimeline",
"id": "PA164754754"
},
{
"name": "clomipramine",
"id": "PA449048"
},
{
"name": "clozapine",
"id": "PA449061"
},
{
"name": "codeine",
"id": "PA449088"
},
{
"name": "darifenacin",
"id": "PA164774901"
},
{
"name": "desipramine",
"id": "PA449233"
},
{
"name": "deutetrabenazine",
"id": "PA166169881"
},
{
"name": "dextromethorphan / quinidine",
"id": "PA166175998"
},
{
"name": "dextromethorphan hydrobromide / bupropion hydrochloride",
"id": "PA166278341"
},
{
"name": "donepezil",
"id": "PA449394"
},
{
"name": "doxepin",
"id": "PA449409"
},
{
"name": "eliglustat",
"id": "PA166123486"
},
{
"name": "fesoterodine",
"id": "PA165958376"
},
{
"name": "flecainide",
"id": "PA449646"
},
{
"name": "fluoxetine",
"id": "PA449673"
},
{
"name": "fluoxetine / olanzapine",
"id": "PA166176027"
},
{
"name": "fluvoxamine",
"id": "PA449690"
},
{
"name": "galantamine",
"id": "PA449726"
},
{
"name": "gefitinib",
"id": "PA131301952"
},
{
"name": "haloperidol",
"id": "PA449841"
},
{
"name": "hydrocodone",
"id": "PA449900"
},
{
"name": "iloperidone",
"id": "PA161199368"
},
{
"name": "imipramine",
"id": "PA449969"
},
{
"name": "lofexidine",
"id": "PA164744510"
},
{
"name": "meclizine",
"id": "PA450338"
},
{
"name": "metoclopramide",
"id": "PA450475"
},
{
"name": "metoprolol",
"id": "PA450480"
},
{
"name": "mirabegron",
"id": "PA166177513"
},
{
"name": "nebivolol",
"id": "PA151958426"
},
{
"name": "nortriptyline",
"id": "PA450657"
},
{
"name": "oliceridine",
"id": "PA166223601"
},
{
"name": "ondansetron",
"id": "PA450705"
},
{
"name": "paroxetine",
"id": "PA450801"
},
{
"name": "perphenazine",
"id": "PA450882"
},
{
"name": "pimozide",
"id": "PA450965"
},
{
"name": "pitolisant",
"id": "PA166185163"
},
{
"name": "propafenone",
"id": "PA451131"
},
{
"name": "propranolol",
"id": "PA451145"
},
{
"name": "protriptyline",
"id": "PA451168"
},
{
"name": "risperidone",
"id": "PA451257"
},
{
"name": "tamoxifen",
"id": "PA451581"
},
{
"name": "tamsulosin",
"id": "PA451583"
},
{
"name": "tetrabenazine",
"id": "PA140222719"
},
{
"name": "thioridazine",
"id": "PA451666"
},
{
"name": "tolterodine",
"id": "PA164746757"
},
{
"name": "tramadol",
"id": "PA451735"
},
{
"name": "trimipramine",
"id": "PA451791"
},
{
"name": "tropisetron",
"id": "PA161925594"
},
{
"name": "valbenazine",
"id": "PA166170051"
},
{
"name": "venlafaxine",
"id": "PA451866"
},
{
"name": "viloxazine",
"id": "PA166251581"
},
{
"name": "vortioxetine",
"id": "PA166122595"
},
{
"name": "zuclopenthixol",
"id": "PA452629"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "CYP2D6",
"name": "Unknown",
"function": null,
"reference": false,
"activityValue": null
},
"allele2": {
"gene": "CYP2D6",
"name": "Unknown",
"function": null,
"reference": false,
"activityValue": null
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"No Result"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "No Result",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"No Result"
],
"label": "Unknown/Unknown",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Unknown": 2.0
}
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "CYP2D6",
"name": "Unknown",
"function": null,
"reference": false,
"activityValue": null
},
"allele2": {
"gene": "CYP2D6",
"name": "Unknown",
"function": null,
"reference": false,
"activityValue": null
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"No Result"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "No Result",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"No Result"
],
"label": "Unknown/Unknown",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Unknown": 2.0
}
}
],
"variants": [],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"CYP3A4": {
"alleleDefinitionVersion": "2026-02-09-10-28",
"alleleDefinitionSource": "CLINPGX",
"phenotypeVersion": "2026-02-09-10-28",
"geneSymbol": "CYP3A4",
"chr": "chr7",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "CYP3A4",
"version": "2",
"matches": {
"gene": "CYP3A4",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"quetiapine"
]
},
"exception_type": "note",
"message": "The CYP3A4 alleles are determined based on PharmVar CYP3A4 allele definitions. See PharmCAT disclaimer for further information."
},
{
"rule_name": "reference-allele",
"version": null,
"matches": null,
"exception_type": "note",
"message": "The CYP3A4 *1 allele assignment is characterized by the absence of variants at the positions that are included in the underlying allele definitions."
}
],
"relatedDrugs": [
{
"name": "quetiapine",
"id": "PA451201"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "CYP3A4",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP3A4",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP3A4",
"matchScore": 86,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "CYP3A4",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP3A4",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP3A4",
"matchScore": 86,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
],
"variants": [
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99758183,
"dbSnpId": "rs67666821",
"call": "G/G",
"alleles": [
"*20"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99758228,
"dbSnpId": "rs1584538410",
"call": "T/T",
"alleles": [
"*46"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99760836,
"dbSnpId": "rs4986913",
"call": "G/G",
"alleles": [
"*19"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99760901,
"dbSnpId": "rs4986910",
"call": "A/A",
"alleles": [
"*3",
"*37",
"*38"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99760956,
"dbSnpId": "rs774109750",
"call": "T/T",
"alleles": [
"*34"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99762047,
"dbSnpId": "rs4986909",
"call": "G/G",
"alleles": [
"*13"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99762054,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"*45"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99762069,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"*47"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99762177,
"dbSnpId": "rs12721629",
"call": "G/G",
"alleles": [
"*12"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99762186,
"dbSnpId": "rs756833413",
"call": "C/C",
"alleles": [
"*33"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99762206,
"dbSnpId": "rs67784355",
"call": "G/G",
"alleles": [
"*11",
"*38"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99762234,
"dbSnpId": "rs1318364992",
"call": "C/C",
"alleles": [
"*48"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99763877,
"dbSnpId": "rs368296206",
"call": "A/A",
"alleles": [
"*32"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99763909,
"dbSnpId": "rs1303250043",
"call": "G/G",
"alleles": [
"*31"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99763925,
"dbSnpId": "rs201821708",
"call": "T/T",
"alleles": [
"*21"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99764003,
"dbSnpId": "rs28371759",
"call": "A/A",
"alleles": [
"*18"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99766411,
"dbSnpId": "rs4646438",
"call": "G/G",
"alleles": [
"*6"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99766424,
"dbSnpId": "rs1429705359",
"call": "T/T",
"alleles": [
"*44"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99766439,
"dbSnpId": "rs145582851",
"call": "C/C",
"alleles": [
"*43"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99766440,
"dbSnpId": "rs138105638",
"call": "G/G",
"alleles": [
"*26"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99768360,
"dbSnpId": "rs55785340",
"call": "A/A",
"alleles": [
"*2"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99768371,
"dbSnpId": "rs55901263",
"call": "G/G",
"alleles": [
"*5"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99768424,
"dbSnpId": "rs113667357",
"call": "T/T",
"alleles": [
"*24"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99768447,
"dbSnpId": "rs3208361",
"call": "T/T",
"alleles": [
"*42"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99768458,
"dbSnpId": "rs4987161",
"call": "A/A",
"alleles": [
"*17"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99768470,
"dbSnpId": "rs12721627",
"call": "G/G",
"alleles": [
"*16"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99768693,
"dbSnpId": "rs35599367",
"call": "G/G",
"alleles": [
"*22",
"*37"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99769769,
"dbSnpId": "rs4986908",
"call": "C/C",
"alleles": [
"*10"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99769781,
"dbSnpId": "rs72552798",
"call": "C/C",
"alleles": [
"*9"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99769804,
"dbSnpId": "rs4986907",
"call": "C/C",
"alleles": [
"*15"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99769805,
"dbSnpId": "rs57409622",
"call": "G/G",
"alleles": [
"*23"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99770150,
"dbSnpId": "rs1483230173",
"call": "G/G",
"alleles": [
"*49"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99770165,
"dbSnpId": "rs72552799",
"call": "C/C",
"alleles": [
"*8"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99770166,
"dbSnpId": "rs778013004",
"call": "G/G",
"alleles": [
"*30"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99770196,
"dbSnpId": "rs2485889420",
"call": "T/T",
"alleles": [
"*41"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99770202,
"dbSnpId": "rs55951658",
"call": "T/T",
"alleles": [
"*4"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99770217,
"dbSnpId": "rs1449865051",
"call": "A/A",
"alleles": [
"*29"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99778079,
"dbSnpId": "rs56324128",
"call": "C/C",
"alleles": [
"*7"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99780036,
"dbSnpId": "rs2485908963",
"call": "G/G",
"alleles": [
"*40"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99784018,
"dbSnpId": "rs570051168",
"call": "G/G",
"alleles": [
"*28"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99784038,
"dbSnpId": "rs12721634",
"call": "A/A",
"alleles": [
"*14"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99784075,
"dbSnpId": "rs188389063",
"call": "G/G",
"alleles": [
"*35"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A4",
"chromosome": "chr7",
"position": 99784078,
"dbSnpId": "rs1226205448",
"call": "C/C",
"alleles": [
"*39"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"CYP3A5": {
"alleleDefinitionVersion": "2026-02-09-10-28",
"alleleDefinitionSource": "CLINPGX",
"phenotypeVersion": "2026-02-09-10-28",
"geneSymbol": "CYP3A5",
"chr": "chr7",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "CYP3A5 reverse complement footnote",
"version": "1",
"matches": {
"gene": "CYP3A5",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": []
},
"exception_type": "footnote",
"message": "The CYP3A5 gene is on the negative chromosomal strand, all genotype calls for CYP3A5 in this report refer to the positive chromosomal strand. Therefore, genotype calls are complemented from gene bases."
},
{
"rule_name": "reference-allele",
"version": null,
"matches": null,
"exception_type": "note",
"message": "The CYP3A5 *1 allele assignment is characterized by the absence of variants at the positions that are included in the underlying allele definitions."
}
],
"relatedDrugs": [
{
"name": "tacrolimus",
"id": "PA451578"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "CYP3A5",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP3A5",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP3A5",
"matchScore": 10,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "CYP3A5",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP3A5",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP3A5",
"matchScore": 10,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
],
"variants": [
{
"gene": "CYP3A5",
"chromosome": "chr7",
"position": 99652770,
"dbSnpId": "rs41303343",
"call": "T/T",
"alleles": [
"*7"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A5",
"chromosome": "chr7",
"position": 99660516,
"dbSnpId": "rs28383479",
"call": "C/C",
"alleles": [
"*9"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A5",
"chromosome": "chr7",
"position": 99665212,
"dbSnpId": "rs10264272",
"call": "C/C",
"alleles": [
"*6"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A5",
"chromosome": "chr7",
"position": 99672916,
"dbSnpId": "rs776746",
"call": "T/T",
"alleles": [
"*3"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP3A5",
"chromosome": "chr7",
"position": 99676198,
"dbSnpId": "rs55817950",
"call": "G/G",
"alleles": [
"*8"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"CYP4F2": {
"alleleDefinitionVersion": "2026-02-09-10-28",
"alleleDefinitionSource": "CLINPGX",
"phenotypeVersion": null,
"geneSymbol": "CYP4F2",
"chr": "chr19",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "reference-allele",
"version": null,
"matches": null,
"exception_type": "note",
"message": "The CYP4F2 *1 allele assignment is characterized by the absence of variants at the positions that are included in the underlying allele definitions."
}
],
"relatedDrugs": [
{
"name": "warfarin",
"id": "PA451906"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "CYP4F2",
"name": "*1",
"function": null,
"reference": true,
"activityValue": null
},
"allele2": {
"gene": "CYP4F2",
"name": "*1",
"function": null,
"reference": true,
"activityValue": null
},
"gene": "CYP4F2",
"matchScore": 40,
"phenotypes": [],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "CYP4F2",
"name": "*1",
"function": null,
"reference": true,
"activityValue": null
},
"allele2": {
"gene": "CYP4F2",
"name": "*1",
"function": null,
"reference": true,
"activityValue": null
},
"gene": "CYP4F2",
"matchScore": 40,
"phenotypes": [],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
],
"variants": [
{
"gene": "CYP4F2",
"chromosome": "chr19",
"position": 15878779,
"dbSnpId": "rs3093200",
"call": "G/G",
"alleles": [
"*5",
"*23"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP4F2",
"chromosome": "chr19",
"position": 15878886,
"dbSnpId": "rs3952537",
"call": "G/G",
"alleles": [
"*19"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP4F2",
"chromosome": "chr19",
"position": 15878920,
"dbSnpId": "rs4020346",
"call": "T/T",
"alleles": [
"*17"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP4F2",
"chromosome": "chr19",
"position": 15879412,
"dbSnpId": "rs138971789",
"call": "C/C",
"alleles": [
"*15"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP4F2",
"chromosome": "chr19",
"position": 15879413,
"dbSnpId": "rs142113670",
"call": "G/G",
"alleles": [
"*21"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP4F2",
"chromosome": "chr19",
"position": 15879621,
"dbSnpId": "rs2108622",
"call": "C/C",
"alleles": [
"*3",
"*4",
"*22"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP4F2",
"chromosome": "chr19",
"position": 15886018,
"dbSnpId": "rs145174239",
"call": "G/G",
"alleles": [
"*14"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP4F2",
"chromosome": "chr19",
"position": 15889671,
"dbSnpId": "rs144233412",
"call": "C/C",
"alleles": [
"*13"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP4F2",
"chromosome": "chr19",
"position": 15890405,
"dbSnpId": "rs3093153",
"call": "C/C",
"alleles": [
"*6"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP4F2",
"chromosome": "chr19",
"position": 15892379,
"dbSnpId": "rs200629062",
"call": "G/G",
"alleles": [
"*20"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP4F2",
"chromosome": "chr19",
"position": 15892398,
"dbSnpId": "rs556151888",
"call": "G/G",
"alleles": [
"*23"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP4F2",
"chromosome": "chr19",
"position": 15892541,
"dbSnpId": "rs145875499",
"call": "C/C",
"alleles": [
"*12"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP4F2",
"chromosome": "chr19",
"position": 15895526,
"dbSnpId": "rs148396222",
"call": "C/C",
"alleles": [
"*18"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP4F2",
"chromosome": "chr19",
"position": 15895527,
"dbSnpId": "rs114396708",
"call": "G/G",
"alleles": [
"*11"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP4F2",
"chromosome": "chr19",
"position": 15895551,
"dbSnpId": "rs150579280",
"call": "T/T",
"alleles": [
"*22"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP4F2",
"chromosome": "chr19",
"position": 15895560,
"dbSnpId": "rs144455532",
"call": "G/G",
"alleles": [
"*10"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP4F2",
"chromosome": "chr19",
"position": 15897466,
"dbSnpId": "rs201380574",
"call": "C/C",
"alleles": [
"*9"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP4F2",
"chromosome": "chr19",
"position": 15897473,
"dbSnpId": "rs115517770",
"call": "G/G",
"alleles": [
"*8"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP4F2",
"chromosome": "chr19",
"position": 15897566,
"dbSnpId": "rs114099324",
"call": "C/C",
"alleles": [
"*7"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "CYP4F2",
"chromosome": "chr19",
"position": 15897578,
"dbSnpId": "rs3093105",
"call": "A/A",
"alleles": [
"*2",
"*4"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"DPYD": {
"alleleDefinitionVersion": "2026-02-09-10-28",
"alleleDefinitionSource": "CLINPGX",
"phenotypeVersion": "2026-02-09-10-28",
"geneSymbol": "DPYD",
"chr": "chr1",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "DPYD lowest activity score note",
"version": "2",
"matches": {
"gene": "DPYD",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": []
},
"exception_type": "note",
"message": "The two lowest activity values (variant activity scores, see CPIC guideline PMID:29152729) are used for unphased data and the lowest activity value per allele is used for phased data to determine the gene activity score and phenotype to retrieve prescribing recommendations. "
},
{
"rule_name": "DPYD reverse complement footnote",
"version": "1",
"matches": {
"gene": "DPYD",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": []
},
"exception_type": "footnote",
"message": "The DPYD gene is on the negative chromosomal strand, all genotype calls for DPYD in this report refer to the positive chromosomal strand. Therefore, genotype calls are complemented from gene bases."
},
{
"rule_name": "reference-allele",
"version": null,
"matches": null,
"exception_type": "note",
"message": "The DPYD Reference allele assignment is characterized by the absence of variants at the positions that are included in the underlying allele definitions."
}
],
"relatedDrugs": [
{
"name": "capecitabine",
"id": "PA448771"
},
{
"name": "flucytosine",
"id": "PA449654"
},
{
"name": "fluorouracil",
"id": "PA128406956"
},
{
"name": "tegafur",
"id": "PA452620"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "DPYD",
"matchScore": 166,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
],
"matcherComponentHaplotypes": [
{
"allele1": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": null,
"gene": "DPYD",
"matchScore": 83,
"phenotypes": [
"Indeterminate"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "n/a",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"n/a"
],
"label": "Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 1.0
}
}
],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "DPYD",
"matchScore": 0,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": [
{
"allele1": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "DPYD",
"matchScore": 166,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
],
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
],
"variants": [
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97078987,
"dbSnpId": "rs114096998",
"call": "G/G",
"alleles": [
"c.3067C>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97078993,
"dbSnpId": "rs148799944",
"call": "C/C",
"alleles": [
"c.3061G>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97079005,
"dbSnpId": "rs140114515",
"call": "C/C",
"alleles": [
"c.3049G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97079071,
"dbSnpId": "rs1801268",
"call": "C/C",
"alleles": [
"c.2983G>T (*10)"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97079076,
"dbSnpId": "rs139459586",
"call": "A/A",
"alleles": [
"c.2978T>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97079077,
"dbSnpId": "rs202144771",
"call": "G/G",
"alleles": [
"c.2977C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97079121,
"dbSnpId": "rs72547601",
"call": "T/T",
"alleles": [
"c.2933A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97079133,
"dbSnpId": "rs72547602",
"call": "T/T",
"alleles": [
"c.2921A>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97079139,
"dbSnpId": "rs145529148",
"call": "T/T",
"alleles": [
"c.2915A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97082365,
"dbSnpId": "rs141044036",
"call": "T/T",
"alleles": [
"c.2872A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97082391,
"dbSnpId": "rs67376798",
"call": "T/T",
"alleles": [
"c.2846A>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97098598,
"dbSnpId": "rs1801267",
"call": "C/C",
"alleles": [
"c.2657G>A (*9B)"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97098599,
"dbSnpId": "rs147545709",
"call": "G/G",
"alleles": [
"c.2656C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97098616,
"dbSnpId": "rs55674432",
"call": "C/C",
"alleles": [
"c.2639G>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97098632,
"dbSnpId": "rs201035051",
"call": "T/T",
"alleles": [
"c.2623A>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97193109,
"dbSnpId": "rs60139309",
"call": "T/T",
"alleles": [
"c.2582A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97193209,
"dbSnpId": "rs200687447",
"call": "C/C",
"alleles": [
"c.2482G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97234958,
"dbSnpId": "rs199634007",
"call": "G/G",
"alleles": [
"c.2336C>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97234991,
"dbSnpId": "rs56005131",
"call": "G/G",
"alleles": [
"c.2303C>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97305279,
"dbSnpId": "rs112766203",
"call": "G/G",
"alleles": [
"c.2279C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97305363,
"dbSnpId": "rs60511679",
"call": "A/A",
"alleles": [
"c.2195T>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97305364,
"dbSnpId": "rs1801160",
"call": "C/C",
"alleles": [
"c.2194G>A (*6)"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97305372,
"dbSnpId": "rs146529561",
"call": "G/G",
"alleles": [
"c.2186C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97306195,
"dbSnpId": "rs145548112",
"call": "C/C",
"alleles": [
"c.2161G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97373598,
"dbSnpId": "rs137999090",
"call": "C/C",
"alleles": [
"c.2021G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97373629,
"dbSnpId": "rs138545885",
"call": "C/C",
"alleles": [
"c.1990G>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97382461,
"dbSnpId": "rs55971861",
"call": "T/T",
"alleles": [
"c.1906A>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97450058,
"dbSnpId": "rs3918290",
"call": "C/C",
"alleles": [
"c.1905+1G>A (*2A)"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97450059,
"dbSnpId": "rs3918289",
"call": "G/G",
"alleles": [
"c.1905C>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97450065,
"dbSnpId": "rs72549303",
"call": "TG/TG",
"alleles": [
"c.1898delC (*3)"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "TG",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97450068,
"dbSnpId": "rs17376848",
"call": "A/A",
"alleles": [
"c.1896T>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97450168,
"dbSnpId": "rs147601618",
"call": "A/A",
"alleles": [
"c.1796T>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97450187,
"dbSnpId": "rs145773863",
"call": "C/C",
"alleles": [
"c.1777G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97450189,
"dbSnpId": "rs138616379",
"call": "C/C",
"alleles": [
"c.1775G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97450190,
"dbSnpId": "rs59086055",
"call": "G/G",
"alleles": [
"c.1774C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97515784,
"dbSnpId": "rs201615754",
"call": "C/C",
"alleles": [
"c.1682G>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97515787,
"dbSnpId": "rs55886062",
"call": "A/A",
"alleles": [
"c.1679T>G (*13)"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97515839,
"dbSnpId": "rs1801159",
"call": "T/T",
"alleles": [
"c.1627A>G (*5)"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97515851,
"dbSnpId": "rs142619737",
"call": "C/C",
"alleles": [
"c.1615G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97515865,
"dbSnpId": "rs1801158",
"call": "C/C",
"alleles": [
"c.1601G>A (*4)"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97515889,
"dbSnpId": "rs190951787",
"call": "G/G",
"alleles": [
"c.1577C>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97515923,
"dbSnpId": "rs148994843",
"call": "C/C",
"alleles": [
"c.1543G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97549565,
"dbSnpId": "rs138391898",
"call": "C/C",
"alleles": [
"c.1519G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97549600,
"dbSnpId": "rs111858276",
"call": "T/T",
"alleles": [
"c.1484A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97549609,
"dbSnpId": "rs72549304",
"call": "G/G",
"alleles": [
"c.1475C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97549681,
"dbSnpId": "rs199549923",
"call": "G/G",
"alleles": [
"c.1403C>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97549713,
"dbSnpId": "rs57918000",
"call": "G/G",
"alleles": [
"c.1371C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97549726,
"dbSnpId": "rs144395748",
"call": "G/G",
"alleles": [
"c.1358C>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97549735,
"dbSnpId": "rs72975710",
"call": "G/G",
"alleles": [
"c.1349C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97573785,
"dbSnpId": "rs186169810",
"call": "A/A",
"alleles": [
"c.1314T>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97573805,
"dbSnpId": "rs142512579",
"call": "C/C",
"alleles": [
"c.1294G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97573821,
"dbSnpId": "rs764666241",
"call": "C/C",
"alleles": [
"c.1278G>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97573839,
"dbSnpId": "rs200064537",
"call": "A/A",
"alleles": [
"c.1260T>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97573863,
"dbSnpId": "rs56038477",
"call": "C/C",
"alleles": [
"c.1129-5923C>G, c.1236G>A (HapB3)"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97573881,
"dbSnpId": "rs61622928",
"call": "C/C",
"alleles": [
"c.1218G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97573918,
"dbSnpId": "rs143815742",
"call": "C/C",
"alleles": [
"c.1181G>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97573919,
"dbSnpId": "rs140602333",
"call": "G/G",
"alleles": [
"c.1180C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97573943,
"dbSnpId": "rs78060119",
"call": "C/C",
"alleles": [
"c.1156G>T (*12)"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97579893,
"dbSnpId": "rs75017182",
"call": "G/G",
"alleles": [
"c.1129-5923C>G",
"c.1129-5923C>G, c.1236G>A (HapB3)"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97593238,
"dbSnpId": "rs72549305",
"call": "T/T",
"alleles": [
"c.1108A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97593289,
"dbSnpId": "rs143154602",
"call": "G/G",
"alleles": [
"c.1057C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97593322,
"dbSnpId": "rs183385770",
"call": "C/C",
"alleles": [
"c.1024G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97593343,
"dbSnpId": "rs72549306",
"call": "C/C",
"alleles": [
"c.1003G>T (*11)"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97593379,
"dbSnpId": "rs201018345",
"call": "C/C",
"alleles": [
"c.967G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97595083,
"dbSnpId": "rs145112791",
"call": "G/G",
"alleles": [
"c.934C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97595088,
"dbSnpId": "rs150437414",
"call": "A/A",
"alleles": [
"c.929T>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97595149,
"dbSnpId": "rs146356975",
"call": "T/T",
"alleles": [
"c.868A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97679170,
"dbSnpId": "rs45589337",
"call": "T/T",
"alleles": [
"c.775A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97691776,
"dbSnpId": "rs1801266",
"call": "G/G",
"alleles": [
"c.703C>T (*8)"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97699399,
"dbSnpId": "rs72549307",
"call": "T/T",
"alleles": [
"c.632A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97699430,
"dbSnpId": "rs72549308",
"call": "T/T",
"alleles": [
"c.601A>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97699474,
"dbSnpId": "rs115232898",
"call": "T/T",
"alleles": [
"c.557A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97699506,
"dbSnpId": "rs6670886",
"call": "C/C",
"alleles": [
"c.525G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97699533,
"dbSnpId": "rs139834141",
"call": "C/C",
"alleles": [
"c.498G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97699535,
"dbSnpId": "rs2297595",
"call": "T/T",
"alleles": [
"c.496A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97721542,
"dbSnpId": "rs200562975",
"call": "T/T",
"alleles": [
"c.451A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97721650,
"dbSnpId": "rs141462178",
"call": "T/T",
"alleles": [
"c.343A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97740400,
"dbSnpId": "rs150385342",
"call": "C/C",
"alleles": [
"c.313G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97740410,
"dbSnpId": "rs72549309",
"call": "GATGA/GATGA",
"alleles": [
"c.295_298delTCAT (*7)"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "GATGA",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97883329,
"dbSnpId": "rs1801265",
"call": "A/A",
"alleles": [
"c.85T>C (*9A)"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97883352,
"dbSnpId": "rs80081766",
"call": "C/C",
"alleles": [
"c.62G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97883353,
"dbSnpId": "rs72549310",
"call": "G/G",
"alleles": [
"c.61C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "DPYD",
"chromosome": "chr1",
"position": 97883368,
"dbSnpId": "rs150036960",
"call": "G/G",
"alleles": [
"c.46C>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"G6PD": {
"alleleDefinitionVersion": "2026-02-09-10-28",
"alleleDefinitionSource": "CLINPGX",
"phenotypeVersion": "2026-02-09-10-28",
"geneSymbol": "G6PD",
"chr": "chrX",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "G6PD hemizygous samples",
"version": "2",
"matches": {
"gene": "G6PD",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"aminosalicylic acid",
"aspirin",
"chloramphenicol",
"chloroquine",
"ciprofloxacin",
"dapsone",
"dimercaprol",
"doxorubicin",
"furazolidone",
"glyburide",
"hydroxychloroquine",
"mafenide",
"methylene blue",
"nalidixic acid",
"nitrofurantoin",
"norfloxacin",
"ofloxacin",
"pegloticase",
"phenazopyridine",
"primaquine",
"quinine",
"rasburicase",
"sulfadiazine",
"sulfadimidine",
"sulfamethoxazole",
"trimethoprim",
"sulfanilamide",
"sulfasalazine",
"sulfisoxazole",
"tafenoquine",
"tolbutamide",
"toluidine blue",
"vitamin c",
"vitamin k"
]
},
"exception_type": "note",
"message": "PharmCAT reports based on VCF file input and some VCF files do not specify hemizygous (one X chromosome) and instead represent samples as homozygous. See PharmCAT FAQs (https://pharmcat.org/faqs/)."
},
{
"rule_name": "reference-allele",
"version": null,
"matches": null,
"exception_type": "note",
"message": "The G6PD B (reference) allele assignment is characterized by the absence of variants at the positions that are included in the underlying allele definitions."
}
],
"relatedDrugs": [
{
"name": "Ascorbic acid (vitamin C), combinations",
"id": "PA164712515"
},
{
"name": "Ascorbic acid (vitamin C), plain",
"id": "PA164712516"
},
{
"name": "articaine / epinephrine",
"id": "PA166182783"
},
{
"name": "bupivacaine",
"id": "PA135057240"
},
{
"name": "chloroquine",
"id": "PA448948"
},
{
"name": "chlorpropamide",
"id": "PA448966"
},
{
"name": "dabrafenib",
"id": "PA166114911"
},
{
"name": "dapsone",
"id": "PA449211"
},
{
"name": "flutamide",
"id": "PA449685"
},
{
"name": "glimepiride",
"id": "PA449761"
},
{
"name": "glipizide",
"id": "PA449762"
},
{
"name": "glyburide",
"id": "PA449782"
},
{
"name": "hydroxychloroquine",
"id": "PA164777036"
},
{
"name": "lidocaine / prilocaine",
"id": "PA166176018"
},
{
"name": "lidocaine and tetracaine",
"id": "PA166182735"
},
{
"name": "mepivacaine",
"id": "PA164748741"
},
{
"name": "methylene blue",
"id": "PA450457"
},
{
"name": "moviprep",
"id": "PA166163260"
},
{
"name": "nalidixic acid",
"id": "PA164746384"
},
{
"name": "nitrofurantoin",
"id": "PA450640"
},
{
"name": "oxymetazoline and tetracaine",
"id": "PA166182885"
},
{
"name": "pegloticase",
"id": "PA165963961"
},
{
"name": "primaquine",
"id": "PA451103"
},
{
"name": "rasburicase",
"id": "PA10176"
},
{
"name": "ropivacaine",
"id": "PA451271"
},
{
"name": "sodium ascorbate",
"id": "PA166163262"
},
{
"name": "sodium nitrite",
"id": "PA166115361"
},
{
"name": "sulfasalazine",
"id": "PA451547"
},
{
"name": "tafenoquine",
"id": "PA166115580"
},
{
"name": "tolazamide",
"id": "PA164774902"
},
{
"name": "tolbutamide",
"id": "PA451718"
},
{
"name": "toluidine blue",
"id": "PA166268821"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "G6PD",
"name": "B (reference)",
"function": "IV/Normal",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "G6PD",
"name": "B (reference)",
"function": "IV/Normal",
"reference": true,
"activityValue": "n/a"
},
"gene": "G6PD",
"matchScore": 342,
"phenotypes": [
"Normal"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal"
],
"label": "B (reference)/B (reference)",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"B (reference)": 2.0
}
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "G6PD",
"name": "B (reference)",
"function": "IV/Normal",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "G6PD",
"name": "B (reference)",
"function": "IV/Normal",
"reference": true,
"activityValue": "n/a"
},
"gene": "G6PD",
"matchScore": 342,
"phenotypes": [
"Normal"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal"
],
"label": "B (reference)/B (reference)",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"B (reference)": 2.0
}
}
],
"variants": [
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532046,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"Bangkok Noi"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532055,
"dbSnpId": null,
"call": "CTCT/CTCT",
"alleles": [
"Brighton"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "CTCT",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532082,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Arakawa"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532083,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Buenos Aires"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532085,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Campinas"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532086,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Fukaya"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532203,
"dbSnpId": "rs137852348",
"call": "G/G",
"alleles": [
"Split"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532231,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"Laibin"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532245,
"dbSnpId": "rs137852344",
"call": "G/G",
"alleles": [
"Neapolis"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532257,
"dbSnpId": "rs72554664",
"call": "C/C",
"alleles": [
"Kaiping, Anant, Dhon, Sapporo-like, Wosera"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532258,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Flores",
"Kamiube, Keelung"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532264,
"dbSnpId": "rs782608284",
"call": "C/C",
"alleles": [
"Yunan"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532265,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Nice"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532269,
"dbSnpId": "rs72554665",
"call": "C/C",
"alleles": [
"Bangkok Noi",
"Canton, Taiwan-Hakka, Gifu-like, Agrigento-like",
"Cosenza"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532278,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"Amiens"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532279,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Figuera da Foz"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532389,
"dbSnpId": "rs137852324",
"call": "C/C",
"alleles": [
"Andalus"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532390,
"dbSnpId": "rs398123546",
"call": "G/G",
"alleles": [
"Hermoupolis",
"Honiara",
"Union,Maewo, Chinese-2, Kalo"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532392,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"Harima"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532403,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Cassano",
"Hermoupolis"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532408,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"S. Antioco"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532411,
"dbSnpId": "rs137852317",
"call": "C/C",
"alleles": [
"Santiago de Cuba, Morioka"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532432,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Telti, Kobe"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532434,
"dbSnpId": "rs137852337",
"call": "C/C",
"alleles": [
"Pawnee"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532458,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"Sumare"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532459,
"dbSnpId": "rs782098548",
"call": "C/C",
"alleles": [
"Surabaya"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532570,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Georgia"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532590,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"202G>A_376A>G_1264C>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532608,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Tokyo, Fukushima"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532623,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"Munich"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532625,
"dbSnpId": "rs137852336",
"call": "C/C",
"alleles": [
"Japan, Shinagawa",
"Kawasaki"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532626,
"dbSnpId": "rs137852323",
"call": "C/C",
"alleles": [
"Riverside"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532628,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Suwalki"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532629,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Utrecht"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532634,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"Abeno"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532639,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Clinic"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532649,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Covao do Lobo"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532661,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"Anadia"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532662,
"dbSnpId": "rs137852325",
"call": "C/C",
"alleles": [
"Puerto Limon"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532667,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Bari"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532674,
"dbSnpId": "rs137852335",
"call": "C/C",
"alleles": [
"Alhambra"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532676,
"dbSnpId": "rs137852316",
"call": "C/C",
"alleles": [
"Nashville, Anaheim, Portici"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532677,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Wisconsin"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532679,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"Krakow"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532688,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"Praha"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532692,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"Hartford"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532694,
"dbSnpId": "rs137852321",
"call": "C/C",
"alleles": [
"Beverly Hills, Genova, Iwate, Niigata, Yamaguchi"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532695,
"dbSnpId": "rs137852334",
"call": "G/G",
"alleles": [
"Guadalajara",
"Mt Sinai"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532698,
"dbSnpId": "rs137852320",
"call": "T/T",
"alleles": [
"Iowa, Walter Reed, Springfield"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532699,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Madrid"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532700,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Lynwood"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532701,
"dbSnpId": "rs137852322",
"call": "A/A",
"alleles": [
"Tomah"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532713,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"Olomouc"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532715,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"Riley"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532716,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"Calvo Mackenna"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532722,
"dbSnpId": "rs371489738",
"call": "C/C",
"alleles": [
"Montpellier"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532752,
"dbSnpId": null,
"call": "CGGCCTTGCGCTCGTTCAG/CGGCCTTGCGCTCGTTCAG",
"alleles": [
"Tondela"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "CGGCCTTGCGCTCGTTCAG",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532758,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"Tenri"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532765,
"dbSnpId": "rs137852329",
"call": "G/G",
"alleles": [
"Aachen",
"Loma Linda"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532772,
"dbSnpId": "rs137852345",
"call": "G/G",
"alleles": [
"Serres"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532773,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Iwatsuki"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532797,
"dbSnpId": "rs137852333",
"call": "G/G",
"alleles": [
"Ierapetra"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532802,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Partenope"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532945,
"dbSnpId": "rs34193178",
"call": "C/C",
"alleles": [
"Mira d'Aire"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532956,
"dbSnpId": "rs398123544",
"call": "T/T",
"alleles": [
"Cincinnati"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532969,
"dbSnpId": "rs137852342",
"call": "G/G",
"alleles": [
"Chinese-5"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532987,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"Torun"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532989,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Fushan"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154532990,
"dbSnpId": "rs5030869",
"call": "C/C",
"alleles": [
"Chatham"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533004,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Insuli"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533012,
"dbSnpId": null,
"call": "CGTGGGGTCGTCCAGGTACCCTTTG/CGTGGGGTCGTCCAGGTACCCTTTG",
"alleles": [
"Nara"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "CGTGGGGTCGTCCAGGTACCCTTTG",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533016,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Farroupilha"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533025,
"dbSnpId": "rs76723693",
"call": "A/A",
"alleles": [
"A- 968C_376G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533029,
"dbSnpId": "rs137852347",
"call": "A/A",
"alleles": [
"Rehevot"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533031,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Manhattan"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533044,
"dbSnpId": "rs137852339",
"call": "C/C",
"alleles": [
"Kalyan-Kerala, Jamnaga, Rohini"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533064,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Ludhiana"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533072,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Omiya"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533077,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Seoul"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533083,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"West Virginia"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533122,
"dbSnpId": "rs137852327",
"call": "C/C",
"alleles": [
"Ananindeua",
"Hechi",
"Viangchan, Jammu"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533586,
"dbSnpId": "rs74575103",
"call": "C/C",
"alleles": [
"Montalbano"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533587,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Osaka"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533589,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"Piotrkow"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533591,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Papua"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533592,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"Mizushima"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533596,
"dbSnpId": "rs137852318",
"call": "C/C",
"alleles": [
"Bajo Maumere",
"Seattle, Lodi, Modena, Ferrara II, Athens-like"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533605,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"Chinese-1",
"Haikou"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533607,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Wexham"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533608,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"La Jolla"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533614,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Sugao"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533615,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Bangkok"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533619,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"Lille"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533620,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Cleveland Corum"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533629,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Roubaix"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154533634,
"dbSnpId": "rs137852346",
"call": "C/C",
"alleles": [
"Aveiro"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534036,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Wayne"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534074,
"dbSnpId": null,
"call": "TCAGTGC/TCAGTGC",
"alleles": [
"Stonybrook"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "TCAGTGC",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534092,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"Durham"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534102,
"dbSnpId": "rs782757170",
"call": "G/G",
"alleles": [
"Nanning"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534110,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Asahikawa"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534116,
"dbSnpId": null,
"call": "ATGT/ATGT",
"alleles": [
"North Dallas"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "ATGT",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534125,
"dbSnpId": "rs137852328",
"call": "C/C",
"alleles": [
"A- 680T_376G",
"Mexico City"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534126,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Radlowo"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534157,
"dbSnpId": "rs137852319",
"call": "A/A",
"alleles": [
"Harilaou"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534345,
"dbSnpId": "rs137852326",
"call": "C/C",
"alleles": [
"Cincinnati",
"Minnesota, Marion, Gastonia, LeJeune"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534348,
"dbSnpId": "rs782754619",
"call": "T/T",
"alleles": [
"Sibari"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534387,
"dbSnpId": "rs781865768",
"call": "T/T",
"alleles": [
"Dagua"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534389,
"dbSnpId": "rs137852332",
"call": "C/C",
"alleles": [
"Nilgiri",
"Santiago"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534390,
"dbSnpId": "rs137852330",
"call": "G/G",
"alleles": [
"Coimbra Shunde",
"Vancouver"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534409,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Pedoplis-Ckaro"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534414,
"dbSnpId": null,
"call": "GGGA/GGGA",
"alleles": [
"Tsukui"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "GGGA",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534419,
"dbSnpId": "rs5030868",
"call": "G/G",
"alleles": [
"Mediterranean, Dallas, Panama, Sassari, Cagliari, Birmingham"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534438,
"dbSnpId": "rs267606836",
"call": "G/G",
"alleles": [
"Vancouver"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534440,
"dbSnpId": "rs5030872",
"call": "T/T",
"alleles": [
"Malaga",
"Santa Maria"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534447,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"Chikugo"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534455,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"Shinshu"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534463,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Miaoli"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534465,
"dbSnpId": "rs137852343",
"call": "A/A",
"alleles": [
"Nankang"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534468,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Volendam"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534485,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Naone"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534486,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Toledo"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534489,
"dbSnpId": "rs137852331",
"call": "T/T",
"alleles": [
"Taipei, Chinese-3"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534494,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Plymouth"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154534495,
"dbSnpId": "rs137852314",
"call": "C/C",
"alleles": [
"Mahidol"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535176,
"dbSnpId": "rs370918918",
"call": "C/C",
"alleles": [
"Gond"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535180,
"dbSnpId": "rs782487723",
"call": "C/C",
"alleles": [
"Shenzen"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535187,
"dbSnpId": "rs137852313",
"call": "C/C",
"alleles": [
"Ilesha"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535190,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Acrokorinthos"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535211,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Liuzhou"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535244,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Belem"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535247,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Valladolid"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535249,
"dbSnpId": "rs782322505",
"call": "T/T",
"alleles": [
"Cairo"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535261,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Quing Yan"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535269,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Crispim"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535270,
"dbSnpId": "rs78365220",
"call": "A/A",
"alleles": [
"Crispim",
"Salerno Pyrgos",
"Vanua Lava"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535274,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Crispim"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535277,
"dbSnpId": "rs1050829",
"call": "T/T",
"alleles": [
"202G>A_376A>G_1264C>G",
"A",
"A- 202A_376G",
"A- 680T_376G",
"A- 968C_376G",
"Acrokorinthos",
"Ananindeua",
"Mt Sinai",
"Santa Maria",
"Sierra Leone"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535278,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Crispim"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535301,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"Bao Loc"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535316,
"dbSnpId": "rs5030870",
"call": "C/C",
"alleles": [
"Sao Borja"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535330,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"Hammersmith"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535336,
"dbSnpId": "rs267606835",
"call": "G/G",
"alleles": [
"Vancouver"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535342,
"dbSnpId": "rs181277621",
"call": "C/C",
"alleles": [
"Sierra Leone"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535367,
"dbSnpId": null,
"call": "GCTT/GCTT",
"alleles": [
"Urayasu"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "GCTT",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535379,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Guangzhou"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535962,
"dbSnpId": "rs782308266",
"call": "C/C",
"alleles": [
"Lagosanto"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535963,
"dbSnpId": "rs138687036",
"call": "G/G",
"alleles": [
"Ube Konan"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535980,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"Swansea"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535995,
"dbSnpId": "rs782090947",
"call": "T/T",
"alleles": [
"Murcia Oristano"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154535996,
"dbSnpId": "rs137852349",
"call": "A/A",
"alleles": [
"Namouru"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154536002,
"dbSnpId": "rs1050828",
"call": "C/C",
"alleles": [
"202G>A_376A>G_1264C>G",
"A- 202A_376G",
"Asahi",
"Hechi"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154536008,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"Songklanagarind"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154536019,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Amazonia",
"Musashino"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154536021,
"dbSnpId": null,
"call": "CAGA/CAGA",
"alleles": [
"Amsterdam"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "CAGA",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154536025,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"Costanzo"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154536032,
"dbSnpId": "rs137852315",
"call": "C/C",
"alleles": [
"Metaponto"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154536034,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Palestrina"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154536035,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Kamogawa"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154536045,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Kozukata"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154536151,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"Kambos"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154536156,
"dbSnpId": "rs76645461",
"call": "A/A",
"alleles": [
"Aures"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154536168,
"dbSnpId": "rs78478128",
"call": "G/G",
"alleles": [
"Orissa"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154536169,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Rignano"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154546045,
"dbSnpId": "rs137852338",
"call": "CATG/CATG",
"alleles": [
"Sunderland"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "CATG",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154546046,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"Gidra"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154546057,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"Honiara"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154546061,
"dbSnpId": "rs137852340",
"call": "T/T",
"alleles": [
"Gaohe"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154546116,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Lages"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154546122,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"Sinnai"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "G6PD",
"chromosome": "chrX",
"position": 154546131,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"No name"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"HLA-A": {
"alleleDefinitionVersion": null,
"alleleDefinitionSource": "UNKNOWN",
"phenotypeVersion": null,
"geneSymbol": "HLA-A",
"chr": null,
"phased": false,
"effectivelyPhased": false,
"callSource": "NONE",
"uncalledHaplotypes": [],
"messages": [],
"relatedDrugs": [
{
"name": "carbamazepine",
"id": "PA448785"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "HLA-A",
"name": "Unknown",
"function": null,
"reference": false,
"activityValue": null
},
"allele2": {
"gene": "HLA-A",
"name": "Unknown",
"function": null,
"reference": false,
"activityValue": null
},
"gene": "HLA-A",
"matchScore": 0,
"phenotypes": [],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"No Result"
],
"label": "Unknown/Unknown",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Unknown": 2.0
}
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "HLA-A",
"name": "Unknown",
"function": null,
"reference": false,
"activityValue": null
},
"allele2": {
"gene": "HLA-A",
"name": "Unknown",
"function": null,
"reference": false,
"activityValue": null
},
"gene": "HLA-A",
"matchScore": 0,
"phenotypes": [],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"No Result"
],
"label": "Unknown/Unknown",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Unknown": 2.0
}
}
],
"variants": [],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"HLA-B": {
"alleleDefinitionVersion": null,
"alleleDefinitionSource": "UNKNOWN",
"phenotypeVersion": null,
"geneSymbol": "HLA-B",
"chr": null,
"phased": false,
"effectivelyPhased": false,
"callSource": "NONE",
"uncalledHaplotypes": [],
"messages": [],
"relatedDrugs": [
{
"name": "abacavir",
"id": "PA448004"
},
{
"name": "allopurinol",
"id": "PA448320"
},
{
"name": "carbamazepine",
"id": "PA448785"
},
{
"name": "flucloxacillin",
"id": "PA164781042"
},
{
"name": "fosphenytoin",
"id": "PA164746820"
},
{
"name": "lamotrigine",
"id": "PA450164"
},
{
"name": "oxcarbazepine",
"id": "PA450732"
},
{
"name": "pazopanib",
"id": "PA165291492"
},
{
"name": "phenytoin",
"id": "PA450947"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "HLA-B",
"name": "Unknown",
"function": null,
"reference": false,
"activityValue": null
},
"allele2": {
"gene": "HLA-B",
"name": "Unknown",
"function": null,
"reference": false,
"activityValue": null
},
"gene": "HLA-B",
"matchScore": 0,
"phenotypes": [],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"No Result"
],
"label": "Unknown/Unknown",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Unknown": 2.0
}
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "HLA-B",
"name": "Unknown",
"function": null,
"reference": false,
"activityValue": null
},
"allele2": {
"gene": "HLA-B",
"name": "Unknown",
"function": null,
"reference": false,
"activityValue": null
},
"gene": "HLA-B",
"matchScore": 0,
"phenotypes": [],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"No Result"
],
"label": "Unknown/Unknown",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Unknown": 2.0
}
}
],
"variants": [],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"IFNL3": {
"alleleDefinitionVersion": "2026-02-09-10-28",
"alleleDefinitionSource": "CLINPGX",
"phenotypeVersion": "2026-02-09-10-28",
"geneSymbol": "IFNL3",
"chr": "chr19",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "IFNL3 reverse complement footnote",
"version": "1",
"matches": {
"gene": "IFNL3",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": []
},
"exception_type": "footnote",
"message": "The IFNL3 gene is on the negative chromosomal strand, all genotype calls for IFNL3 in this report refer to the positive chromosomal strand. Therefore, genotype calls are complemented from gene bases."
}
],
"relatedDrugs": [
{
"name": "peginterferon alfa-2a",
"id": "PA164749390"
},
{
"name": "peginterferon alfa-2b",
"id": "PA164784024"
},
{
"name": "ribavirin",
"id": "PA451241"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "IFNL3",
"name": "rs12979860 reference (C)",
"function": "Favorable response allele",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "IFNL3",
"name": "rs12979860 reference (C)",
"function": "Favorable response allele",
"reference": true,
"activityValue": "n/a"
},
"gene": "IFNL3",
"matchScore": 2,
"phenotypes": [
"n/a"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"n/a"
],
"label": "rs12979860 reference (C)/rs12979860 reference (C)",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"rs12979860 reference (C)": 2.0
}
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "IFNL3",
"name": "rs12979860 reference (C)",
"function": "Favorable response allele",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "IFNL3",
"name": "rs12979860 reference (C)",
"function": "Favorable response allele",
"reference": true,
"activityValue": "n/a"
},
"gene": "IFNL3",
"matchScore": 2,
"phenotypes": [
"n/a"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"n/a"
],
"label": "rs12979860 reference (C)/rs12979860 reference (C)",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"rs12979860 reference (C)": 2.0
}
}
],
"variants": [
{
"gene": "IFNL3",
"chromosome": "chr19",
"position": 39248147,
"dbSnpId": "rs12979860",
"call": "C/C",
"alleles": [
"rs12979860 variant (T)"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"MT-RNR1": {
"alleleDefinitionVersion": null,
"alleleDefinitionSource": "UNKNOWN",
"phenotypeVersion": "2026-02-09-10-28",
"geneSymbol": "MT-RNR1",
"chr": null,
"phased": false,
"effectivelyPhased": false,
"callSource": "NONE",
"uncalledHaplotypes": [],
"messages": [],
"relatedDrugs": [
{
"name": "amikacin",
"id": "PA164744372"
},
{
"name": "dibekacin",
"id": "PA166292901"
},
{
"name": "gentamicin",
"id": "PA449753"
},
{
"name": "kanamycin",
"id": "PA450137"
},
{
"name": "neomycin",
"id": "PA450608"
},
{
"name": "netilmicin",
"id": "PA164754913"
},
{
"name": "paromomycin",
"id": "PA164784023"
},
{
"name": "plazomicin",
"id": "PA166228921"
},
{
"name": "ribostamycin",
"id": "PA166292902"
},
{
"name": "streptomycin",
"id": "PA451512"
},
{
"name": "tobramycin",
"id": "PA451704"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "MT-RNR1",
"name": "Unknown",
"function": null,
"reference": false,
"activityValue": null
},
"allele2": null,
"gene": "MT-RNR1",
"matchScore": 0,
"phenotypes": [
"No Result"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"No Result"
],
"label": "Unknown",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Unknown": 1.0
}
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "MT-RNR1",
"name": "Unknown",
"function": null,
"reference": false,
"activityValue": null
},
"allele2": null,
"gene": "MT-RNR1",
"matchScore": 0,
"phenotypes": [
"No Result"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"No Result"
],
"label": "Unknown",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Unknown": 1.0
}
}
],
"variants": [],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"NAT2": {
"alleleDefinitionVersion": "2026-02-09-10-28",
"alleleDefinitionSource": "CLINPGX",
"phenotypeVersion": "2026-02-09-10-28",
"geneSymbol": "NAT2",
"chr": "chr8",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "reference-allele",
"version": null,
"matches": null,
"exception_type": "note",
"message": "The NAT2 *1 allele assignment is characterized by the absence of variants at the positions that are included in the underlying allele definitions."
}
],
"relatedDrugs": [
{
"name": "amifampridine",
"id": "PA166185150"
},
{
"name": "amifampridine phosphate",
"id": "PA166182002"
},
{
"name": "hydralazine",
"id": "PA449894"
},
{
"name": "isoniazid",
"id": "PA450112"
},
{
"name": "procainamide",
"id": "PA451108"
},
{
"name": "sulfamethoxazole / trimethoprim",
"id": "PA10715"
},
{
"name": "sulfasalazine",
"id": "PA451547"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "NAT2",
"name": "*1",
"function": "Increased function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "NAT2",
"name": "*1",
"function": "Increased function",
"reference": true,
"activityValue": "n/a"
},
"gene": "NAT2",
"matchScore": 94,
"phenotypes": [
"Rapid Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Rapid Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "NAT2",
"name": "*1",
"function": "Increased function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "NAT2",
"name": "*1",
"function": "Increased function",
"reference": true,
"activityValue": "n/a"
},
"gene": "NAT2",
"matchScore": 94,
"phenotypes": [
"Rapid Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Rapid Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
],
"variants": [
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400010,
"dbSnpId": "rs200893121",
"call": "A/A",
"alleles": [
"*50"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400032,
"dbSnpId": "rs72466456",
"call": "T/T",
"alleles": [
"*45",
"*54"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400054,
"dbSnpId": "rs201339185",
"call": "C/C",
"alleles": [
"*55"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400061,
"dbSnpId": "rs532310930",
"call": "G/G",
"alleles": [
"*56"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400070,
"dbSnpId": "rs1464413878",
"call": "A/A",
"alleles": [
"*72"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400073,
"dbSnpId": "rs45477599",
"call": "T/T",
"alleles": [
"*31"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400124,
"dbSnpId": "rs149283608",
"call": "A/A",
"alleles": [
"*51"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400155,
"dbSnpId": "rs72466457",
"call": "G/G",
"alleles": [
"*35"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400193,
"dbSnpId": "rs1805158",
"call": "C/C",
"alleles": [
"*19"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400194,
"dbSnpId": "rs1801279",
"call": "G/G",
"alleles": [
"*14",
"*15",
"*29",
"*46",
"*47"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400206,
"dbSnpId": "rs72466458",
"call": "G/G",
"alleles": [
"*32"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400251,
"dbSnpId": "rs561124342",
"call": "G/G",
"alleles": [
"*53"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400267,
"dbSnpId": "rs2535896050",
"call": "G/G",
"alleles": [
"*75"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400324,
"dbSnpId": "rs549917500",
"call": "C/C",
"alleles": [
"*57"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400344,
"dbSnpId": "rs1801280",
"call": "T/T",
"alleles": [
"*5",
"*16",
"*29",
"*30",
"*31",
"*32",
"*33",
"*49",
"*69",
"*70",
"*72",
"*73",
"*75"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400349,
"dbSnpId": "rs183409091",
"call": "G/G",
"alleles": [
"*58"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400367,
"dbSnpId": "rs4986996",
"call": "G/G",
"alleles": [
"*48"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400406,
"dbSnpId": "rs12720065",
"call": "C/C",
"alleles": [
"*36",
"*44"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400461,
"dbSnpId": "rs72466460",
"call": "C/C",
"alleles": [
"*21"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400475,
"dbSnpId": "rs139351995",
"call": "A/A",
"alleles": [
"*33"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400478,
"dbSnpId": "rs537007806",
"call": "T/T",
"alleles": [
"*59"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400494,
"dbSnpId": "rs139512288",
"call": "T/T",
"alleles": [
"*60"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400502,
"dbSnpId": "rs72554617",
"call": "G/G",
"alleles": [
"*10"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400509,
"dbSnpId": "rs200585149",
"call": "A/A",
"alleles": [
"*61"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400521,
"dbSnpId": "rs369500066",
"call": "A/A",
"alleles": [
"*52"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400539,
"dbSnpId": "rs572750517",
"call": "A/A",
"alleles": [
"*62"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400581,
"dbSnpId": "rs79050330",
"call": "C/C",
"alleles": [
"*41",
"*49"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400583,
"dbSnpId": "rs774002627",
"call": "C/C",
"alleles": [
"*68"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400592,
"dbSnpId": "rs375746304",
"call": "C/C",
"alleles": [
"*27",
"*69"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400593,
"dbSnpId": "rs1799930",
"call": "G/G",
"alleles": [
"*6",
"*15",
"*30",
"*34",
"*35",
"*36",
"*37",
"*38",
"*39",
"*50",
"*52",
"*53",
"*56",
"*58",
"*62",
"*63",
"*64",
"*66",
"*67"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400599,
"dbSnpId": "rs761741098",
"call": "T/T",
"alleles": [
"*70"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400612,
"dbSnpId": "rs45618543",
"call": "G/G",
"alleles": [
"*43"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400616,
"dbSnpId": "rs45607939",
"call": "A/A",
"alleles": [
"*65"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400625,
"dbSnpId": "rs56387565",
"call": "T/T",
"alleles": [
"*42"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400641,
"dbSnpId": "rs138707146",
"call": "C/C",
"alleles": [
"*37"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400653,
"dbSnpId": "rs568110818",
"call": "T/T",
"alleles": [
"*63"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400685,
"dbSnpId": "rs150329557",
"call": "C/C",
"alleles": [
"*66"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400686,
"dbSnpId": "rs45518335",
"call": "C/C",
"alleles": [
"*47"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400707,
"dbSnpId": "rs756616433",
"call": "T/T",
"alleles": [
"*71"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400769,
"dbSnpId": "rs55700793",
"call": "A/A",
"alleles": [
"*38"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400799,
"dbSnpId": "rs539346244",
"call": "G/G",
"alleles": [
"*64"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400805,
"dbSnpId": "rs910738034",
"call": "A/A",
"alleles": [
"*73"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400806,
"dbSnpId": "rs1208",
"call": "G/G",
"alleles": [
"*4",
"*6",
"*7",
"*10",
"*14",
"*15",
"*16",
"*19",
"*21",
"*27",
"*30",
"*35",
"*36",
"*37",
"*38",
"*39",
"*47",
"*50",
"*52",
"*53",
"*54",
"*55",
"*56",
"*57",
"*58",
"*59",
"*60",
"*61",
"*62",
"*63",
"*64",
"*65",
"*66",
"*67",
"*68",
"*74"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400826,
"dbSnpId": "rs148566670",
"call": "T/T",
"alleles": [
"*67"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400841,
"dbSnpId": "rs56393504",
"call": "G/G",
"alleles": [
"*39"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400848,
"dbSnpId": "rs56054745",
"call": "A/A",
"alleles": [
"*74"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NAT2",
"chromosome": "chr8",
"position": 18400860,
"dbSnpId": "rs1799931",
"call": "G/G",
"alleles": [
"*7",
"*40",
"*59",
"*68"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"NUDT15": {
"alleleDefinitionVersion": "2026-02-09-10-28",
"alleleDefinitionSource": "CLINPGX",
"phenotypeVersion": "2026-02-09-10-28",
"geneSymbol": "NUDT15",
"chr": "chr13",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "reference-allele",
"version": null,
"matches": null,
"exception_type": "note",
"message": "The NUDT15 *1 allele assignment is characterized by the absence of variants at the positions that are included in the underlying allele definitions."
}
],
"relatedDrugs": [
{
"name": "azathioprine",
"id": "PA448515"
},
{
"name": "mercaptopurine",
"id": "PA450379"
},
{
"name": "thioguanine",
"id": "PA451663"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "NUDT15",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "NUDT15",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "NUDT15",
"matchScore": 36,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "NUDT15",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "NUDT15",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "NUDT15",
"matchScore": 36,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
],
"variants": [
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48037748,
"dbSnpId": "rs769369441",
"call": "T/T",
"alleles": [
"*10"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48037749,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"*19"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48037782,
"dbSnpId": "rs746071566",
"call": "AGGAGTC/AGGAGTC",
"alleles": [
"*3",
"*6",
"*9"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "AGGAGTC",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48037798,
"dbSnpId": "rs186364861",
"call": "G/G",
"alleles": [
"*5"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48037825,
"dbSnpId": "rs777311140",
"call": "C/C",
"alleles": [
"*14"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48037834,
"dbSnpId": "rs1202487323",
"call": "C/C",
"alleles": [
"*16"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48037847,
"dbSnpId": "rs766023281",
"call": "G/G",
"alleles": [
"*7"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48037849,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"*8"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48037885,
"dbSnpId": "rs1950545307",
"call": "G/G",
"alleles": [
"*11"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48037902,
"dbSnpId": "rs149436418",
"call": "C/C",
"alleles": [
"*12"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48040977,
"dbSnpId": "rs1457579126",
"call": "GA/GA",
"alleles": [
"*18"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "GA",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48041103,
"dbSnpId": "rs761191455",
"call": "T/T",
"alleles": [
"*13"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48041113,
"dbSnpId": "rs1368252918",
"call": "G/G",
"alleles": [
"*17"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48045690,
"dbSnpId": "rs768324690",
"call": "C/C",
"alleles": [
"*20"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48045714,
"dbSnpId": "rs1185228044",
"call": "G/G",
"alleles": [
"*21"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48045719,
"dbSnpId": "rs116855232",
"call": "C/C",
"alleles": [
"*3"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48045720,
"dbSnpId": "rs147390019",
"call": "G/G",
"alleles": [
"*4"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "NUDT15",
"chromosome": "chr13",
"position": 48045771,
"dbSnpId": "rs139551410",
"call": "T/T",
"alleles": [
"*15"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"RYR1": {
"alleleDefinitionVersion": "2026-02-09-10-28",
"alleleDefinitionSource": "CLINPGX",
"phenotypeVersion": "2026-02-09-10-28",
"geneSymbol": "RYR1",
"chr": "chr19",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "reference-allele",
"version": null,
"matches": null,
"exception_type": "note",
"message": "The RYR1 Reference allele assignment is characterized by the absence of variants at the positions that are included in the underlying allele definitions."
}
],
"relatedDrugs": [
{
"name": "desflurane",
"id": "PA164749136"
},
{
"name": "enflurane",
"id": "PA449461"
},
{
"name": "halothane",
"id": "PA449845"
},
{
"name": "isoflurane",
"id": "PA450106"
},
{
"name": "methoxyflurane",
"id": "PA450434"
},
{
"name": "sevoflurane",
"id": "PA451341"
},
{
"name": "succinylcholine",
"id": "PA451522"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "RYR1",
"matchScore": 626,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
],
"matcherComponentHaplotypes": [
{
"allele1": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": null,
"gene": "RYR1",
"matchScore": 313,
"phenotypes": [
"n/a"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"n/a"
],
"label": "Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 1.0
}
}
],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "RYR1",
"matchScore": 0,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": [
{
"allele1": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "RYR1",
"matchScore": 626,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
],
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
],
"variants": [
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38433867,
"dbSnpId": "rs193922744",
"call": "T/T",
"alleles": [
"c.38T>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38440747,
"dbSnpId": "rs193922745",
"call": "CGAT/CGAT",
"alleles": [
"c.51_53del"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "CGAT",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38440796,
"dbSnpId": "rs193922746",
"call": "A/A",
"alleles": [
"c.97A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38440802,
"dbSnpId": "rs193922747",
"call": "T/T",
"alleles": [
"c.103T>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38440818,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.119G>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38440829,
"dbSnpId": "rs193922748",
"call": "C/C",
"alleles": [
"c.130C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38440830,
"dbSnpId": "rs139161723",
"call": "G/G",
"alleles": [
"c.131G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38440851,
"dbSnpId": "rs193922749",
"call": "C/C",
"alleles": [
"c.152C>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38442361,
"dbSnpId": "rs118192160",
"call": "G/G",
"alleles": [
"c.178G>A",
"c.178G>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38442373,
"dbSnpId": "rs995399438",
"call": "T/T",
"alleles": [
"c.190T>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38442395,
"dbSnpId": "rs118192113",
"call": "C/C",
"alleles": [
"c.212C>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38442434,
"dbSnpId": "rs186983396",
"call": "C/C",
"alleles": [
"c.251C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38443790,
"dbSnpId": "rs142474192",
"call": "G/G",
"alleles": [
"c.418G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38444179,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"c.455C>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38444187,
"dbSnpId": "rs193922750",
"call": "C/C",
"alleles": [
"c.463C>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38444191,
"dbSnpId": "rs193922751",
"call": "G/G",
"alleles": [
"c.467G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38444203,
"dbSnpId": "rs193922752",
"call": "A/A",
"alleles": [
"c.479A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38444211,
"dbSnpId": "rs118192161",
"call": "C/C",
"alleles": [
"c.487C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38444212,
"dbSnpId": "rs193922753",
"call": "G/G",
"alleles": [
"c.488G>A",
"c.488G>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38444217,
"dbSnpId": "rs193922754",
"call": "G/G",
"alleles": [
"c.493G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38444220,
"dbSnpId": "rs193922755",
"call": "G/G",
"alleles": [
"c.496G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38444221,
"dbSnpId": "rs193922756",
"call": "A/A",
"alleles": [
"c.497A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38444250,
"dbSnpId": "rs761616815",
"call": "G/G",
"alleles": [
"c.526G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38444252,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.528G>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38444253,
"dbSnpId": "rs193922757",
"call": "C/C",
"alleles": [
"c.529C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38444257,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"c.533A>C",
"c.533A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38444671,
"dbSnpId": "rs771058055",
"call": "G/G",
"alleles": [
"c.625G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38446481,
"dbSnpId": "rs727504129",
"call": "C/C",
"alleles": [
"c.641C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38446492,
"dbSnpId": "rs193922759",
"call": "G/G",
"alleles": [
"c.652G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38446517,
"dbSnpId": "rs112596687",
"call": "T/T",
"alleles": [
"c.677T>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38446520,
"dbSnpId": "rs193922760",
"call": "A/A",
"alleles": [
"c.680A>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38446710,
"dbSnpId": "rs1801086",
"call": "G/G",
"alleles": [
"c.742G>A",
"c.742G>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38448500,
"dbSnpId": "rs752652072",
"call": "C/C",
"alleles": [
"c.946C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38448501,
"dbSnpId": "rs193922761",
"call": "G/G",
"alleles": [
"c.947G>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38448673,
"dbSnpId": "rs193922762",
"call": "C/C",
"alleles": [
"c.982C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38448680,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"c.992_994dup"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38448712,
"dbSnpId": "rs121918592",
"call": "G/G",
"alleles": [
"c.1021G>A",
"c.1021G>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38448715,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.1024G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38448791,
"dbSnpId": "rs113332073",
"call": "G/G",
"alleles": [
"c.1100G>A",
"c.1100G>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38451785,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"c.1144C>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38451842,
"dbSnpId": "rs193922764",
"call": "C/C",
"alleles": [
"c.1201C>A",
"c.1201C>G",
"c.1201C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38451843,
"dbSnpId": "rs193922766",
"call": "G/G",
"alleles": [
"c.1202G>A",
"c.1202G>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38451850,
"dbSnpId": "rs118192116",
"call": "C/C",
"alleles": [
"c.1209C>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38452985,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"c.1411C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38452996,
"dbSnpId": "rs193922767",
"call": "G/G",
"alleles": [
"c.1422G>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38455247,
"dbSnpId": "rs147723844",
"call": "A/A",
"alleles": [
"c.1453A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38455253,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"c.1459C>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38455254,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"c.1460T>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38455269,
"dbSnpId": "rs901087791",
"call": "G/G",
"alleles": [
"c.1475G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38455347,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"c.1553T>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38455359,
"dbSnpId": "rs118192162",
"call": "A/A",
"alleles": [
"c.1565A>C",
"c.1565A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38455463,
"dbSnpId": "rs111888148",
"call": "G/G",
"alleles": [
"c.1589G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38455471,
"dbSnpId": "rs193922768",
"call": "C/C",
"alleles": [
"c.1597C>A",
"c.1597C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38455472,
"dbSnpId": "rs144336148",
"call": "G/G",
"alleles": [
"c.1598G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38455489,
"dbSnpId": "rs193922769",
"call": "T/T",
"alleles": [
"c.1615T>C",
"c.1615T>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38455504,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.1630G>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38455528,
"dbSnpId": "rs193922770",
"call": "C/C",
"alleles": [
"c.1654C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38457539,
"dbSnpId": "rs118204423",
"call": "G/G",
"alleles": [
"c.1834G>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38457545,
"dbSnpId": "rs118192172",
"call": "C/C",
"alleles": [
"c.1840C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38457546,
"dbSnpId": "rs193922772",
"call": "G/G",
"alleles": [
"c.1841G>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38458175,
"dbSnpId": "rs747177274",
"call": "G/G",
"alleles": [
"c.2050G>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38458247,
"dbSnpId": "rs138874610",
"call": "G/G",
"alleles": [
"c.2122G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38460461,
"dbSnpId": "rs376149732",
"call": "C/C",
"alleles": [
"c.2447C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38460551,
"dbSnpId": "rs193922775",
"call": "C/C",
"alleles": [
"c.2537C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38463499,
"dbSnpId": "rs370634440",
"call": "G/G",
"alleles": [
"c.2654G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38464649,
"dbSnpId": "rs148623597",
"call": "G/G",
"alleles": [
"c.2797G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38466144,
"dbSnpId": "rs778241277",
"call": "G/G",
"alleles": [
"c.2924G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38466216,
"dbSnpId": "rs180714609",
"call": "G/G",
"alleles": [
"c.2996G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38466315,
"dbSnpId": "rs141942845",
"call": "G/G",
"alleles": [
"c.3095G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38466347,
"dbSnpId": "rs111272095",
"call": "C/C",
"alleles": [
"c.3127C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38466386,
"dbSnpId": "rs2145447772",
"call": "G/G",
"alleles": [
"c.3166G>A",
"c.3166G>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38466392,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.3172G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38467655,
"dbSnpId": "rs749040743",
"call": "G/G",
"alleles": [
"c.3224G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38469002,
"dbSnpId": "rs193922776",
"call": "C/C",
"alleles": [
"c.3418C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38469111,
"dbSnpId": "rs549201486",
"call": "C/C",
"alleles": [
"c.3527C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38469404,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"c.3656A>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38469415,
"dbSnpId": "rs936513262",
"call": "G/G",
"alleles": [
"c.3667G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38473635,
"dbSnpId": "rs34694816",
"call": "A/A",
"alleles": [
"c.4024A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38475335,
"dbSnpId": "rs137933390",
"call": "A/A",
"alleles": [
"c.4178A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38477816,
"dbSnpId": "rs145573319",
"call": "A/A",
"alleles": [
"c.4400A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38483293,
"dbSnpId": "rs146429605",
"call": "A/A",
"alleles": [
"c.4711A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38483329,
"dbSnpId": "rs754476250",
"call": "C/C",
"alleles": [
"c.4747C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38483345,
"dbSnpId": "rs151029675",
"call": "C/C",
"alleles": [
"c.4763C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38483357,
"dbSnpId": "rs193922777",
"call": "C/C",
"alleles": [
"c.4775C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38485679,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"c.5024T>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38485688,
"dbSnpId": "rs781104539",
"call": "A/A",
"alleles": [
"c.5033A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38485691,
"dbSnpId": "rs146504767",
"call": "G/G",
"alleles": [
"c.5036G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38485787,
"dbSnpId": "rs754785770",
"call": "A/A",
"alleles": [
"c.5132A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38485838,
"dbSnpId": "rs193922781",
"call": "C/C",
"alleles": [
"c.5183C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38485841,
"dbSnpId": "rs193922782",
"call": "T/T",
"alleles": [
"c.5186T>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38485972,
"dbSnpId": "rs192863857",
"call": "C/C",
"alleles": [
"c.5317C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38485996,
"dbSnpId": "rs372958050",
"call": "T/T",
"alleles": [
"c.5341T>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38486015,
"dbSnpId": "rs34934920",
"call": "C/C",
"alleles": [
"c.5360C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38486095,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"c.5440A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38486096,
"dbSnpId": "rs193922783",
"call": "T/T",
"alleles": [
"c.5441T>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38490151,
"dbSnpId": "rs145801146",
"call": "C/C",
"alleles": [
"c.5890C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38490642,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"c.6037A>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38492540,
"dbSnpId": "rs35364374",
"call": "G/G",
"alleles": [
"c.6178G>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38494379,
"dbSnpId": "rs746818096",
"call": "T/T",
"alleles": [
"c.6302T>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38494381,
"dbSnpId": "rs770593660",
"call": "G/G",
"alleles": [
"c.6304G>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38494426,
"dbSnpId": "rs193922788",
"call": "G/G",
"alleles": [
"c.6349G>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38494454,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.6377G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38494464,
"dbSnpId": "rs117886618",
"call": "C/C",
"alleles": [
"c.6387C>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38494465,
"dbSnpId": "rs193922789",
"call": "G/G",
"alleles": [
"c.6388G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38494555,
"dbSnpId": "rs143398211",
"call": "G/G",
"alleles": [
"c.6478G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38494564,
"dbSnpId": "rs118192175",
"call": "C/C",
"alleles": [
"c.6487C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38494565,
"dbSnpId": "rs118192163",
"call": "G/G",
"alleles": [
"c.6488G>A",
"c.6488G>C",
"c.6488G>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38494579,
"dbSnpId": "rs118192176",
"call": "G/G",
"alleles": [
"c.6502G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38494621,
"dbSnpId": "rs193922790",
"call": "A/A",
"alleles": [
"c.6544A>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38494625,
"dbSnpId": "rs959170123",
"call": "G/G",
"alleles": [
"c.6548G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38496265,
"dbSnpId": "rs193922791",
"call": "C/C",
"alleles": [
"c.6599C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38496278,
"dbSnpId": "rs141646642",
"call": "C/C",
"alleles": [
"c.6612C>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38496283,
"dbSnpId": "rs118192177",
"call": "C/C",
"alleles": [
"c.6617C>G",
"c.6617C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38496294,
"dbSnpId": "rs193922792",
"call": "G/G",
"alleles": [
"c.6628G>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38496301,
"dbSnpId": "rs193922793",
"call": "T/T",
"alleles": [
"c.6635T>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38496306,
"dbSnpId": "rs193922795",
"call": "G/G",
"alleles": [
"c.6640G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38496415,
"dbSnpId": "rs199870223",
"call": "C/C",
"alleles": [
"c.6670C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38496416,
"dbSnpId": "rs537994744",
"call": "G/G",
"alleles": [
"c.6671G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38496455,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.6710G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38496487,
"dbSnpId": "rs763352221",
"call": "C/C",
"alleles": [
"c.6742C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38496488,
"dbSnpId": "rs140152019",
"call": "G/G",
"alleles": [
"c.6743G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38496502,
"dbSnpId": "rs917523269",
"call": "C/C",
"alleles": [
"c.6757C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38496901,
"dbSnpId": "rs193922797",
"call": "G/G",
"alleles": [
"c.6838G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38496910,
"dbSnpId": "rs118192121",
"call": "A/A",
"alleles": [
"c.6847A>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499177,
"dbSnpId": "rs34390345",
"call": "A/A",
"alleles": [
"c.6961A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499223,
"dbSnpId": "rs112563513",
"call": "G/G",
"alleles": [
"c.7007G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499234,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"c.7018T>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499241,
"dbSnpId": "rs147213895",
"call": "A/A",
"alleles": [
"c.7025A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499639,
"dbSnpId": "rs193922798",
"call": "G/G",
"alleles": [
"c.7032G>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499642,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"c.7035C>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499643,
"dbSnpId": "rs193922799",
"call": "G/G",
"alleles": [
"c.7036G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499644,
"dbSnpId": "rs121918596",
"call": "TGGA/TGGA",
"alleles": [
"c.7042_7044delGAG"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "TGGA",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499650,
"dbSnpId": "rs193922801",
"call": "A/A",
"alleles": [
"c.7043A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499655,
"dbSnpId": "rs193922802",
"call": "G/G",
"alleles": [
"c.7048G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499667,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.7060G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499670,
"dbSnpId": "rs193922803",
"call": "C/C",
"alleles": [
"c.7063C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499680,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"c.7073T>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499682,
"dbSnpId": "rs769482889",
"call": "C/C",
"alleles": [
"c.7075C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499683,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.7076G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499691,
"dbSnpId": "rs762401851",
"call": "G/G",
"alleles": [
"c.7084G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499692,
"dbSnpId": "rs193922804",
"call": "A/A",
"alleles": [
"c.7085A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499696,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"c.7089C>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499697,
"dbSnpId": "rs193922805",
"call": "T/T",
"alleles": [
"c.7090T>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499704,
"dbSnpId": "rs193922806",
"call": "C/C",
"alleles": [
"c.7097C>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499706,
"dbSnpId": "rs146306934",
"call": "G/G",
"alleles": [
"c.7099G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499719,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"c.7112A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499730,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.7123G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499731,
"dbSnpId": "rs193922807",
"call": "G/G",
"alleles": [
"c.7124G>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499806,
"dbSnpId": "rs976108591",
"call": "A/A",
"alleles": [
"c.7199A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499817,
"dbSnpId": "rs111364296",
"call": "G/G",
"alleles": [
"c.7210G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499975,
"dbSnpId": "rs193922809",
"call": "G/G",
"alleles": [
"c.7282G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499984,
"dbSnpId": "rs193922810",
"call": "G/G",
"alleles": [
"c.7291G>A",
"c.7291G>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499985,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"c.7292A>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499993,
"dbSnpId": "rs121918593",
"call": "G/G",
"alleles": [
"c.7300G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38499997,
"dbSnpId": "rs28933396",
"call": "G/G",
"alleles": [
"c.7304G>A",
"c.7304G>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38500000,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.7307G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38500003,
"dbSnpId": "rs193922812",
"call": "C/C",
"alleles": [
"c.7310C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38500010,
"dbSnpId": "rs193922813",
"call": "G/G",
"alleles": [
"c.7317G>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38500636,
"dbSnpId": "rs118192124",
"call": "C/C",
"alleles": [
"c.7354C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38500637,
"dbSnpId": "rs193922815",
"call": "G/G",
"alleles": [
"c.7355G>A",
"c.7355G>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38500640,
"dbSnpId": "rs118192123",
"call": "T/T",
"alleles": [
"c.7358T>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38500642,
"dbSnpId": "rs193922816",
"call": "C/C",
"alleles": [
"c.7360C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38500643,
"dbSnpId": "rs118192122",
"call": "G/G",
"alleles": [
"c.7361G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38500654,
"dbSnpId": "rs28933397",
"call": "C/C",
"alleles": [
"c.7372C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38500655,
"dbSnpId": "rs121918594",
"call": "G/G",
"alleles": [
"c.7373G>A",
"c.7373G>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38500667,
"dbSnpId": "rs551223467",
"call": "C/C",
"alleles": [
"c.7385C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38500863,
"dbSnpId": "rs193922817",
"call": "C/C",
"alleles": [
"c.7487C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38500898,
"dbSnpId": "rs118192178",
"call": "C/C",
"alleles": [
"c.7522C>G",
"c.7522C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38500899,
"dbSnpId": "rs193922818",
"call": "G/G",
"alleles": [
"c.7523G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38500904,
"dbSnpId": "rs193922819",
"call": "T/T",
"alleles": [
"c.7528T>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38502652,
"dbSnpId": "rs767553612",
"call": "A/A",
"alleles": [
"c.7760A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38502663,
"dbSnpId": "rs193922822",
"call": "C/C",
"alleles": [
"c.7771C>G",
"c.7771C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38502669,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"c.7777C>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38502670,
"dbSnpId": "rs751180702",
"call": "G/G",
"alleles": [
"c.7778G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38502679,
"dbSnpId": "rs193922824",
"call": "C/C",
"alleles": [
"c.7787C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38502708,
"dbSnpId": "rs748575133",
"call": "T/T",
"alleles": [
"c.7816T>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38502923,
"dbSnpId": "rs914804033",
"call": "G/G",
"alleles": [
"c.7879G>A",
"c.7879G>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38504298,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.8005G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38504319,
"dbSnpId": "rs193922826",
"call": "C/C",
"alleles": [
"c.8026C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38504347,
"dbSnpId": "rs781126470",
"call": "C/C",
"alleles": [
"c.8054C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38504868,
"dbSnpId": "rs193922827",
"call": "G/G",
"alleles": [
"c.8188G>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38504869,
"dbSnpId": "rs112196644",
"call": "A/A",
"alleles": [
"c.8189A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38504878,
"dbSnpId": "rs193922828",
"call": "G/G",
"alleles": [
"c.8198G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38505061,
"dbSnpId": "rs193922829",
"call": "G/G",
"alleles": [
"c.8290G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38505325,
"dbSnpId": "rs147707463",
"call": "C/C",
"alleles": [
"c.8327C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38505358,
"dbSnpId": "rs35180584",
"call": "C/C",
"alleles": [
"c.8360C>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38505923,
"dbSnpId": "rs193922830",
"call": "C/C",
"alleles": [
"c.8518C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38505932,
"dbSnpId": "rs768535909",
"call": "T/T",
"alleles": [
"c.8527T>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38506361,
"dbSnpId": "rs193922831",
"call": "T/T",
"alleles": [
"c.8600T>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38506492,
"dbSnpId": "rs112772310",
"call": "G/G",
"alleles": [
"c.8638G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38506508,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"c.8654C>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38506865,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"c.8729C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38507821,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"c.8926C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38511590,
"dbSnpId": "rs147303895",
"call": "G/G",
"alleles": [
"c.9152G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38512279,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.9268G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38512321,
"dbSnpId": "rs193922832",
"call": "G/G",
"alleles": [
"c.9310G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38512367,
"dbSnpId": "rs193922833",
"call": "G/G",
"alleles": [
"c.9356G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38515052,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"c.9499C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38516167,
"dbSnpId": "rs199738299",
"call": "A/A",
"alleles": [
"c.9635A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38516181,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"c.9649T>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38516184,
"dbSnpId": "rs553055844",
"call": "G/G",
"alleles": [
"c.9652G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38516208,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.9676G>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38517431,
"dbSnpId": "rs375626634",
"call": "T/T",
"alleles": [
"c.9758T>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38517470,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"c.9797T>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38517521,
"dbSnpId": "rs757753317",
"call": "G/G",
"alleles": [
"c.9848G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38517523,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"c.9850T>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38517541,
"dbSnpId": "rs112151058",
"call": "G/G",
"alleles": [
"c.9868G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38519237,
"dbSnpId": "rs118204421",
"call": "C/C",
"alleles": [
"c.10042C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38519238,
"dbSnpId": "rs193922834",
"call": "G/G",
"alleles": [
"c.10043G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38519292,
"dbSnpId": "rs137932199",
"call": "G/G",
"alleles": [
"c.10097G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38519295,
"dbSnpId": "rs118192126",
"call": "A/A",
"alleles": [
"c.10100A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38519424,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"c.10229C>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38519432,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"c.10237A>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38519447,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"c.10252A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38525432,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"c.10556C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38525492,
"dbSnpId": "rs143987857",
"call": "G/G",
"alleles": [
"c.10616G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38527707,
"dbSnpId": "rs55876273",
"call": "G/G",
"alleles": [
"c.10747G>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38527710,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.10750G>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38528372,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.10891G>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38529002,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.11086G>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38529036,
"dbSnpId": "rs193922838",
"call": "G/G",
"alleles": [
"c.11120G>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38529042,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"c.11126C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38529048,
"dbSnpId": "rs375915752",
"call": "C/C",
"alleles": [
"c.11132C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38534726,
"dbSnpId": "rs4802584",
"call": "C/C",
"alleles": [
"c.11266C>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38534774,
"dbSnpId": "rs763112609",
"call": "C/C",
"alleles": [
"c.11314C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38534775,
"dbSnpId": "rs193922839",
"call": "G/G",
"alleles": [
"c.11315G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38535197,
"dbSnpId": "rs111565359",
"call": "G/G",
"alleles": [
"c.11416G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38535998,
"dbSnpId": "rs140616359",
"call": "G/G",
"alleles": [
"c.11518G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38543365,
"dbSnpId": "rs148399313",
"call": "G/G",
"alleles": [
"c.11708G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38543380,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"c.11723A>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38543405,
"dbSnpId": "rs193922840",
"call": "T/T",
"alleles": [
"c.11748T>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38543551,
"dbSnpId": "rs147136339",
"call": "A/A",
"alleles": [
"c.11798A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38543566,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.11813G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38543810,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"c.11947C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38543816,
"dbSnpId": "rs118204422",
"call": "T/T",
"alleles": [
"c.11953T>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38543821,
"dbSnpId": "rs193922842",
"call": "C/C",
"alleles": [
"c.11958C>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38543832,
"dbSnpId": "rs193922843",
"call": "G/G",
"alleles": [
"c.11969G>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38546460,
"dbSnpId": "rs755088027",
"call": "G/G",
"alleles": [
"c.12028G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38546496,
"dbSnpId": "rs773040531",
"call": "A/A",
"alleles": [
"c.12064A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38548253,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"c.12115A>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38548259,
"dbSnpId": "rs144685735",
"call": "C/C",
"alleles": [
"c.12121C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38548287,
"dbSnpId": "rs193922844",
"call": "C/C",
"alleles": [
"c.12149C>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38548380,
"dbSnpId": "rs373406011",
"call": "C/C",
"alleles": [
"c.12242C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38561140,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.12310G>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38561185,
"dbSnpId": "rs193922848",
"call": "A/A",
"alleles": [
"c.12355A>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38561213,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"c.12383C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38561228,
"dbSnpId": "rs201321695",
"call": "A/A",
"alleles": [
"c.12398A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38561236,
"dbSnpId": "rs193922849",
"call": "C/C",
"alleles": [
"c.12406C>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38561243,
"dbSnpId": "rs193922850",
"call": "T/T",
"alleles": [
"c.12413T>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38561362,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.12532G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38561363,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.12533G>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38561383,
"dbSnpId": "rs151119428",
"call": "G/G",
"alleles": [
"c.12553G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38565023,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"c.12689T>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38565034,
"dbSnpId": "rs193922852",
"call": "G/G",
"alleles": [
"c.12700G>C",
"c.12700G>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38565182,
"dbSnpId": "rs193922853",
"call": "A/A",
"alleles": [
"c.12848A>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38565215,
"dbSnpId": "rs587784372",
"call": "C/C",
"alleles": [
"c.12881C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38565218,
"dbSnpId": "rs193922855",
"call": "C/C",
"alleles": [
"c.12884C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38566978,
"dbSnpId": "rs139647387",
"call": "A/A",
"alleles": [
"c.13505A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38566986,
"dbSnpId": "rs150396398",
"call": "G/G",
"alleles": [
"c.13513G>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38570619,
"dbSnpId": "rs771741606",
"call": "C/C",
"alleles": [
"c.13672C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38570620,
"dbSnpId": "rs118192130",
"call": "G/G",
"alleles": [
"c.13673G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38570649,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"c.13702C>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38572032,
"dbSnpId": "rs143520367",
"call": "C/C",
"alleles": [
"c.13760C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38572185,
"dbSnpId": "rs118192135",
"call": "G/G",
"alleles": [
"c.13913G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38572190,
"dbSnpId": "rs756850145",
"call": "A/A",
"alleles": [
"c.13918A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38572206,
"dbSnpId": "rs193922860",
"call": "G/G",
"alleles": [
"c.13934G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38572262,
"dbSnpId": "rs759500310",
"call": "T/T",
"alleles": [
"c.13990T>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38572266,
"dbSnpId": "rs193922862",
"call": "TC/TC",
"alleles": [
"c.13994_13995delTCinsCT"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "TC",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38573180,
"dbSnpId": "rs193922863",
"call": "C/C",
"alleles": [
"c.14002C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38573229,
"dbSnpId": "rs193922864",
"call": "T/T",
"alleles": [
"c.14051T>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38573304,
"dbSnpId": "rs118192140",
"call": "C/C",
"alleles": [
"c.14126C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38575957,
"dbSnpId": "rs200766617",
"call": "G/G",
"alleles": [
"c.14168G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38577931,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"c.14186A>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38577942,
"dbSnpId": "rs193922865",
"call": "T/T",
"alleles": [
"c.14197T>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38577946,
"dbSnpId": "rs193922866",
"call": "G/G",
"alleles": [
"c.14201G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38577954,
"dbSnpId": "rs193922867",
"call": "C/C",
"alleles": [
"c.14209C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38577955,
"dbSnpId": "rs193922868",
"call": "G/G",
"alleles": [
"c.14210G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38578015,
"dbSnpId": "rs768360593",
"call": "G/G",
"alleles": [
"c.14270G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38578205,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.14364+1G>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38580004,
"dbSnpId": "rs118192167",
"call": "A/A",
"alleles": [
"c.14387A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38580039,
"dbSnpId": null,
"call": "TT/TT",
"alleles": [
"c.14422_14423delinsAA"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "TT",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38580041,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"c.14424C>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38580066,
"dbSnpId": "rs143988412",
"call": "A/A",
"alleles": [
"c.14449A>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38580075,
"dbSnpId": "rs193922873",
"call": "G/G",
"alleles": [
"c.14458G>A",
"c.14458G>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38580088,
"dbSnpId": "rs193922874",
"call": "T/T",
"alleles": [
"c.14471T>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38580094,
"dbSnpId": "rs121918595",
"call": "C/C",
"alleles": [
"c.14477C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38580114,
"dbSnpId": "rs193922876",
"call": "C/C",
"alleles": [
"c.14497C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38580126,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"c.14509C>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38580370,
"dbSnpId": "rs193922878",
"call": "C/C",
"alleles": [
"c.14512C>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38580382,
"dbSnpId": "rs193922879",
"call": "G/G",
"alleles": [
"c.14524G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38580397,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.14539G>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38580403,
"dbSnpId": "rs118192168",
"call": "G/G",
"alleles": [
"c.14545G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38580416,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"c.14558C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38580425,
"dbSnpId": "rs193922880",
"call": "C/C",
"alleles": [
"c.14567C>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38580439,
"dbSnpId": "rs118192181",
"call": "C/C",
"alleles": [
"c.14581C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38580440,
"dbSnpId": "rs63749869",
"call": "G/G",
"alleles": [
"c.14582G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38580485,
"dbSnpId": "rs113210953",
"call": "A/A",
"alleles": [
"c.14627A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38580497,
"dbSnpId": "rs193922883",
"call": "T/T",
"alleles": [
"c.14639T>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38584974,
"dbSnpId": "rs118192151",
"call": "G/G",
"alleles": [
"c.14678G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38584976,
"dbSnpId": "rs193922888",
"call": "G/G",
"alleles": [
"c.14680G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38584989,
"dbSnpId": "rs118192170",
"call": "T/T",
"alleles": [
"c.14693T>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38585078,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"c.14782A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38585099,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.14803G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38585947,
"dbSnpId": "rs111657878",
"call": "T/T",
"alleles": [
"c.14813T>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38585948,
"dbSnpId": "rs118192159",
"call": "C/C",
"alleles": [
"c.14814C>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38585951,
"dbSnpId": "rs193922895",
"call": "C/C",
"alleles": [
"c.14817C>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38585952,
"dbSnpId": "rs118192158",
"call": "G/G",
"alleles": [
"c.14818G>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38585959,
"dbSnpId": "rs193922896",
"call": "G/G",
"alleles": [
"c.14825G>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38586101,
"dbSnpId": "rs193922898",
"call": "T/T",
"alleles": [
"c.14879T>A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38586140,
"dbSnpId": "rs146876145",
"call": "C/C",
"alleles": [
"c.14918C>T"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38586190,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"c.14968A>G"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38587362,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.15059G>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "RYR1",
"chromosome": "chr19",
"position": 38587363,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"c.15060G>C"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"SLCO1B1": {
"alleleDefinitionVersion": "2026-02-09-10-28",
"alleleDefinitionSource": "CLINPGX",
"phenotypeVersion": "2026-02-09-10-28",
"geneSymbol": "SLCO1B1",
"chr": "chr12",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "SLCO1B1-drug text",
"version": "1",
"matches": {
"gene": "SLCO1B1",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"simvastatin",
"rosuvastatin",
"pravastatin",
"pitavastatin",
"lovastatin",
"fluvastatin",
"atorvastatin"
]
},
"exception_type": "note",
"message": "The SLCO1B1 genotype (star nomenclature) will be displayed if determinable with the provided VCF based on the SLCO1B1 star allele definition published by CPIC and recommendations are provided based on the genotype.
In case no genotype can be determined, recommendations are based on the rs4149056 genotype alone as per guideline. The minor C allele at rs4149056 defines SLCO1B1*5."
},
{
"rule_name": "reference-allele",
"version": null,
"matches": null,
"exception_type": "note",
"message": "The SLCO1B1 *1 allele assignment is characterized by the absence of variants at the positions that are included in the underlying allele definitions."
}
],
"relatedDrugs": [
{
"name": "atorvastatin",
"id": "PA448500"
},
{
"name": "elagolix",
"id": "PA166182348"
},
{
"name": "fluvastatin",
"id": "PA449688"
},
{
"name": "lovastatin",
"id": "PA450272"
},
{
"name": "pitavastatin",
"id": "PA142650384"
},
{
"name": "pravastatin",
"id": "PA451089"
},
{
"name": "rosuvastatin",
"id": "PA134308647"
},
{
"name": "simvastatin",
"id": "PA451363"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "SLCO1B1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "SLCO1B1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "SLCO1B1",
"matchScore": 70,
"phenotypes": [
"Normal Function"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Function"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "SLCO1B1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "SLCO1B1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "SLCO1B1",
"matchScore": 70,
"phenotypes": [
"Normal Function"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Function"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
],
"variants": [
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21141575,
"dbSnpId": "rs185905373",
"call": "A/A",
"alleles": [
"*56"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21172675,
"dbSnpId": "rs556524705",
"call": "G/G",
"alleles": [
"*57"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21172734,
"dbSnpId": "rs139257324",
"call": "C/C",
"alleles": [
"*33"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21172735,
"dbSnpId": "rs61760182",
"call": "G/G",
"alleles": [
"*58"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21172776,
"dbSnpId": "rs373327528",
"call": "G/G",
"alleles": [
"*23"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21172782,
"dbSnpId": "rs56101265",
"call": "T/T",
"alleles": [
"*2"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21176804,
"dbSnpId": "rs2306283",
"call": "A/A",
"alleles": [
"*14",
"*15",
"*20",
"*24",
"*25",
"*27",
"*28",
"*29",
"*30",
"*31",
"*32",
"*33",
"*37",
"*39",
"*42",
"*43",
"*44",
"*45",
"*47",
"*52",
"*53",
"*54",
"*55",
"*56",
"*57"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21176868,
"dbSnpId": "rs2306282",
"call": "A/A",
"alleles": [
"*16"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21176871,
"dbSnpId": "rs145144129",
"call": "G/G",
"alleles": [
"*55"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21176879,
"dbSnpId": "rs11045819",
"call": "C/C",
"alleles": [
"*4",
"*14",
"*25",
"*32",
"*43",
"*53",
"*55"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21176898,
"dbSnpId": "rs77271279",
"call": "G/G",
"alleles": [
"*41"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21178612,
"dbSnpId": "rs141467543",
"call": "A/A",
"alleles": [
"*42"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21178615,
"dbSnpId": "rs4149056",
"call": "T/T",
"alleles": [
"*5",
"*15",
"*40",
"*45",
"*47"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21178653,
"dbSnpId": "rs200331427",
"call": "C/C",
"alleles": [
"*50"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21178926,
"dbSnpId": "rs201722521",
"call": "A/A",
"alleles": [
"*54"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21178957,
"dbSnpId": "rs79135870",
"call": "A/A",
"alleles": [
"*30"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21196951,
"dbSnpId": "rs11045852",
"call": "A/A",
"alleles": [
"*24",
"*25",
"*28",
"*32",
"*33",
"*43",
"*44",
"*54"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21196975,
"dbSnpId": "rs183501729",
"call": "C/C",
"alleles": [
"*39"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21196976,
"dbSnpId": "rs11045853",
"call": "G/G",
"alleles": [
"*25",
"*28",
"*33"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21200544,
"dbSnpId": "rs72559747",
"call": "C/C",
"alleles": [
"*47"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21200595,
"dbSnpId": "rs55901008",
"call": "T/T",
"alleles": [
"*6"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21200673,
"dbSnpId": "rs756393362",
"call": "G/G",
"alleles": [
"*52"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21202553,
"dbSnpId": "rs1228465562",
"call": "T/T",
"alleles": [
"*36"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21202555,
"dbSnpId": "rs59113707",
"call": "C/C",
"alleles": [
"*27",
"*53",
"*55"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21202664,
"dbSnpId": "rs142965323",
"call": "G/G",
"alleles": [
"*26"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21205921,
"dbSnpId": "rs72559748",
"call": "A/A",
"alleles": [
"*8"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21205999,
"dbSnpId": "rs59502379",
"call": "G/G",
"alleles": [
"*9",
"*31"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21206031,
"dbSnpId": "rs74064213",
"call": "A/A",
"alleles": [
"*43",
"*44"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21222355,
"dbSnpId": "rs71581941",
"call": "C/C",
"alleles": [
"*45"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21224840,
"dbSnpId": "rs200994482",
"call": "G/G",
"alleles": [
"*51"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21239042,
"dbSnpId": "rs34671512",
"call": "A/A",
"alleles": [
"*19",
"*20",
"*40",
"*54"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21239077,
"dbSnpId": "rs56199088",
"call": "A/A",
"alleles": [
"*10"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21239113,
"dbSnpId": "rs55737008",
"call": "A/A",
"alleles": [
"*11"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21239145,
"dbSnpId": "rs200995543",
"call": "C/C",
"alleles": [
"*34"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "SLCO1B1",
"chromosome": "chr12",
"position": 21239158,
"dbSnpId": "rs140790673",
"call": "C/C",
"alleles": [
"*29"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"TPMT": {
"alleleDefinitionVersion": "2026-02-09-10-28",
"alleleDefinitionSource": "CLINPGX",
"phenotypeVersion": "2026-02-09-10-28",
"geneSymbol": "TPMT",
"chr": "chr6",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "TPMT reverse complement footnote",
"version": "1",
"matches": {
"gene": "TPMT",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": []
},
"exception_type": "footnote",
"message": "The TPMT gene is on the negative chromosomal strand, all genotype calls for TPMT in this report refer to the positive chromosomal strand. Therefore, genotype calls are complemented from gene bases."
},
{
"rule_name": "reference-allele",
"version": null,
"matches": null,
"exception_type": "note",
"message": "The TPMT *1 allele assignment is characterized by the absence of variants at the positions that are included in the underlying allele definitions."
}
],
"relatedDrugs": [
{
"name": "azathioprine",
"id": "PA448515"
},
{
"name": "mercaptopurine",
"id": "PA450379"
},
{
"name": "thioguanine",
"id": "PA451663"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "TPMT",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "TPMT",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "TPMT",
"matchScore": 90,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "TPMT",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "TPMT",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "TPMT",
"matchScore": 90,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
],
"variants": [
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18130687,
"dbSnpId": "rs1142345",
"call": "T/T",
"alleles": [
"*3A",
"*3C",
"*41"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18130694,
"dbSnpId": "rs150900439",
"call": "T/T",
"alleles": [
"*20"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18130725,
"dbSnpId": "rs72552736",
"call": "A/A",
"alleles": [
"*7"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18130729,
"dbSnpId": "rs139392616",
"call": "C/C",
"alleles": [
"*40"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18130730,
"dbSnpId": "rs761990479",
"call": "G/G",
"alleles": [
"*45"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18130758,
"dbSnpId": "rs398122996",
"call": "A/A",
"alleles": [
"*37"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18130762,
"dbSnpId": "rs56161402",
"call": "C/C",
"alleles": [
"*8",
"*46"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18130772,
"dbSnpId": "rs377085266",
"call": "A/A",
"alleles": [
"*25"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18130781,
"dbSnpId": "rs1800584",
"call": "C/C",
"alleles": [
"*4"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18132136,
"dbSnpId": "rs72556347",
"call": "A/A",
"alleles": [
"*26"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18132147,
"dbSnpId": "rs79901429",
"call": "A/A",
"alleles": [
"*31"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18132163,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"*36"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18133845,
"dbSnpId": "rs75543815",
"call": "T/T",
"alleles": [
"*6"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18133847,
"dbSnpId": "rs6921269",
"call": "C/C",
"alleles": [
"*24"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18133870,
"dbSnpId": "rs772832951",
"call": "A/A",
"alleles": [
"*38"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18133884,
"dbSnpId": "rs74423290",
"call": "G/G",
"alleles": [
"*23"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18133887,
"dbSnpId": "rs201695576",
"call": "T/T",
"alleles": [
"*44"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18133890,
"dbSnpId": "rs9333570",
"call": "C/C",
"alleles": [
"*15"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18138969,
"dbSnpId": "rs144041067",
"call": "C/C",
"alleles": [
"*16",
"*22"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18138970,
"dbSnpId": "rs112339338",
"call": "G/G",
"alleles": [
"*33",
"*46"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18138997,
"dbSnpId": "rs1800460",
"call": "C/C",
"alleles": [
"*3A",
"*3B"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18139027,
"dbSnpId": "rs72552737",
"call": "C/C",
"alleles": [
"*10"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18139689,
"dbSnpId": "rs72552738",
"call": "C/C",
"alleles": [
"*11"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18139710,
"dbSnpId": "rs200220210",
"call": "G/G",
"alleles": [
"*12"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18143597,
"dbSnpId": null,
"call": "T/T",
"alleles": [
"*19"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18143606,
"dbSnpId": "rs151149760",
"call": "T/T",
"alleles": [
"*9"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18143613,
"dbSnpId": null,
"call": "C/C",
"alleles": [
"*28"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18143622,
"dbSnpId": "rs115106679",
"call": "C/C",
"alleles": [
"*32"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18143643,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"*27"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18143700,
"dbSnpId": "rs753545734",
"call": "C/C",
"alleles": [
"*43"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18143718,
"dbSnpId": "rs111901354",
"call": "G/G",
"alleles": [
"*34"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18143724,
"dbSnpId": "rs1800462",
"call": "C/C",
"alleles": [
"*2"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18143728,
"dbSnpId": "rs1256618794",
"call": "C/C",
"alleles": [
"*43"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18147838,
"dbSnpId": "rs281874771",
"call": "G/G",
"alleles": [
"*39"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18147845,
"dbSnpId": "rs777686348",
"call": "C/C",
"alleles": [
"*18"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18147851,
"dbSnpId": "rs200591577",
"call": "G/G",
"alleles": [
"*21"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18147856,
"dbSnpId": null,
"call": "A/A",
"alleles": [
"*35"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18147910,
"dbSnpId": "rs72552740",
"call": "A/A",
"alleles": [
"*5"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18149004,
"dbSnpId": null,
"call": "G/G",
"alleles": [
"*17"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18149022,
"dbSnpId": "rs750424422",
"call": "C/C",
"alleles": [
"*30"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18149032,
"dbSnpId": "rs759836180",
"call": "C/C",
"alleles": [
"*42"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18149045,
"dbSnpId": "rs72552742",
"call": "T/T",
"alleles": [
"*13"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18149103,
"dbSnpId": null,
"call": "CAAGT/CAAGT",
"alleles": [
"*47"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "CAAGT",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18149126,
"dbSnpId": "rs267607275",
"call": "A/A",
"alleles": [
"*29"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "A",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "TPMT",
"chromosome": "chr6",
"position": 18149127,
"dbSnpId": "rs9333569",
"call": "T/T",
"alleles": [
"*14"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "T",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"UGT1A1": {
"alleleDefinitionVersion": "2026-02-09-10-28",
"alleleDefinitionSource": "CLINPGX",
"phenotypeVersion": "2026-02-09-10-28",
"geneSymbol": "UGT1A1",
"chr": "chr2",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "UGT1A1 repeat warning",
"version": "1",
"matches": {
"gene": "UGT1A1",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": []
},
"exception_type": "footnote",
"message": "Some alleles in UGT1A1 are distinguished by a repeat sequence; some genotyping technologies may not accurately call the repeat."
},
{
"rule_name": "reference-allele",
"version": null,
"matches": null,
"exception_type": "note",
"message": "The UGT1A1 *1 allele assignment is characterized by the absence of variants at the positions that are included in the underlying allele definitions."
}
],
"relatedDrugs": [
{
"name": "atazanavir",
"id": "PA10251"
},
{
"name": "belinostat",
"id": "PA165971474"
},
{
"name": "dolutegravir",
"id": "PA166114961"
},
{
"name": "irinotecan",
"id": "PA450085"
},
{
"name": "nilotinib",
"id": "PA165958345"
},
{
"name": "pazopanib",
"id": "PA165291492"
},
{
"name": "raltegravir",
"id": "PA164888966"
},
{
"name": "sacituzumab govitecan",
"id": "PA166225061"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "UGT1A1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "UGT1A1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "UGT1A1",
"matchScore": 8,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "UGT1A1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "UGT1A1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "UGT1A1",
"matchScore": 8,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
],
"variants": [
{
"gene": "UGT1A1",
"chromosome": "chr2",
"position": 233759924,
"dbSnpId": "rs887829",
"call": "C/C",
"alleles": [
"*80",
"*80+*28",
"*80+*37"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "UGT1A1",
"chromosome": "chr2",
"position": 233760233,
"dbSnpId": "rs3064744",
"call": "CAT/CAT",
"alleles": [
"*28",
"*36",
"*37",
"*80+*28",
"*80+*37"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "CAT",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "UGT1A1",
"chromosome": "chr2",
"position": 233760498,
"dbSnpId": "rs4148323",
"call": "G/G",
"alleles": [
"*6"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
},
{
"gene": "UGT1A1",
"chromosome": "chr2",
"position": 233760973,
"dbSnpId": "rs35350960",
"call": "C/C",
"alleles": [
"*27"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
"VKORC1": {
"alleleDefinitionVersion": "2026-02-09-10-28",
"alleleDefinitionSource": "CLINPGX",
"phenotypeVersion": "2026-02-09-10-28",
"geneSymbol": "VKORC1",
"chr": "chr16",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [
{
"rule_name": "VKORC1 reverse complement footnote",
"version": "1",
"matches": {
"gene": "VKORC1",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": []
},
"exception_type": "footnote",
"message": "The VKORC1 gene is on the negative chromosomal strand, all genotype calls for VKORC1 in this report refer to the positive chromosomal strand. Therefore, genotype calls are complemented from gene bases."
}
],
"relatedDrugs": [
{
"name": "acenocoumarol",
"id": "PA452632"
},
{
"name": "phenprocoumon",
"id": "PA450921"
},
{
"name": "warfarin",
"id": "PA451906"
}
],
"sourceDiplotypes": [
{
"allele1": {
"gene": "VKORC1",
"name": "rs9923231 reference (C)",
"function": "Normal coumarin sensitivity",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "VKORC1",
"name": "rs9923231 reference (C)",
"function": "Normal coumarin sensitivity",
"reference": true,
"activityValue": "n/a"
},
"gene": "VKORC1",
"matchScore": 2,
"phenotypes": [
"-1639 GG"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"-1639 GG"
],
"label": "rs9923231 reference (C)/rs9923231 reference (C)",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"rs9923231 reference (C)": 2.0
}
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "VKORC1",
"name": "rs9923231 reference (C)",
"function": "Normal coumarin sensitivity",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "VKORC1",
"name": "rs9923231 reference (C)",
"function": "Normal coumarin sensitivity",
"reference": true,
"activityValue": "n/a"
},
"gene": "VKORC1",
"matchScore": 2,
"phenotypes": [
"-1639 GG"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"-1639 GG"
],
"label": "rs9923231 reference (C)/rs9923231 reference (C)",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"rs9923231 reference (C)": 2.0
}
}
],
"variants": [
{
"gene": "VKORC1",
"chromosome": "chr16",
"position": 31096368,
"dbSnpId": "rs9923231",
"call": "C/C",
"alleles": [
"rs9923231 variant (T)"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
}
},
"drugs": {
"CPIC Guideline Annotation": {
"abacavir": {
"name": "abacavir",
"id": "PA448004",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104997"
],
"citations": [
{
"pmid": "22378157",
"title": "Clinical pharmacogenetics implementation consortium guidelines for HLA-B genotype and abacavir dosing.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2012,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3374459"
},
{
"pmid": "24561393",
"title": "Clinical Pharmacogenetics Implementation Consortium Guidelines for HLA-B Genotype and Abacavir Dosing: 2014 update.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2014,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3994233"
}
],
"guidelines": [
{
"id": "PA166104997",
"name": "Annotation of CPIC Guideline for abacavir and HLA-B",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104997",
"annotations": []
}
]
},
"allopurinol": {
"name": "allopurinol",
"id": "PA448320",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166105003"
],
"citations": [
{
"pmid": "23232549",
"title": "Clinical Pharmacogenetics Implementation Consortium guidelines for human leukocyte antigen-B genotype and allopurinol dosing.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2013,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3564416"
},
{
"pmid": "26094938",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) guidelines for human leukocyte antigen B (HLA-B) genotype and allopurinol dosing: 2015 update.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2016,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4675696"
}
],
"guidelines": [
{
"id": "PA166105003",
"name": "Annotation of CPIC Guideline for allopurinol and HLA-B",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166105003",
"annotations": []
}
]
},
"amikacin": {
"name": "amikacin",
"id": "PA164744372",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166229081"
],
"citations": [
{
"pmid": "34032273",
"title": "Clinical Pharmacogenetics Implementation Consortium Guideline for the Use of Aminoglycosides Based on MT-RNR1 Genotype.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2022,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8613315"
}
],
"guidelines": [
{
"id": "PA166229081",
"name": "Annotation of CPIC Guideline for amikacin, dibekacin, gentamicin, kanamycin, neomycin, netilmicin, paromomycin, plazomicin, ribostamycin, streptomycin, tobramycin and MT-RNR1",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166229081",
"annotations": []
}
]
},
"amitriptyline": {
"name": "amitriptyline",
"id": "PA448385",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166105006"
],
"citations": [
{
"pmid": "23486447",
"title": "Clinical Pharmacogenetics Implementation Consortium guideline for CYP2D6 and CYP2C19 genotypes and dosing of tricyclic antidepressants.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2013,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3689226"
},
{
"pmid": "27997040",
"title": "Clinical pharmacogenetics implementation consortium guideline (CPIC) for CYP2D6 and CYP2C19 genotypes and dosing of tricyclic antidepressants: 2016 update.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2017,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5478479"
}
],
"guidelines": [
{
"id": "PA166105006",
"name": "Annotation of CPIC Guideline for amitriptyline and CYP2C19, CYP2D6",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166105006",
"annotations": [
{
"implications": [
"CYP2C19: Greatly reduced metabolism of tertiary amines compared to normal metabolizers; Decreased conversion of tertiary amines to secondary amines may affect response or side effects",
"CYP2D6: n/a"
],
"drugRecommendation": "Avoid tertiary amine use due to potential for sub-optimal response. Consider alternative drug not metabolized by CYP2C19. TCAs without major CYP2C19 metabolism include the secondary amines nortriptyline and desipramine. For tertiary amines, consider a 50% reduction of the recommended starting dose. Utilize therapeutic drug monitoring to guide dose adjustments. Titrate dose to observed clinical response with symptom improvement and minimal (if any) side effects.",
"classification": "Moderate",
"activityScore": {
"CYP2C19": "n/a",
"CYP2D6": "No Result"
},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 6,
"phenotypes": [
"Poor Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Poor Metabolizer"
],
"label": "*2/*2",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*2": 2.0
}
},
{
"allele1": {
"gene": "CYP2D6",
"name": "Unknown",
"function": null,
"reference": false,
"activityValue": null
},
"allele2": {
"gene": "CYP2D6",
"name": "Unknown",
"function": null,
"reference": false,
"activityValue": null
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"No Result"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "No Result",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"No Result"
],
"label": "Unknown/Unknown",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Unknown": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": true,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Poor Metabolizer",
"CYP2D6": "No Result"
},
"lookupKey": [
{
"CYP2D6": "No Result",
"CYP2C19": "Poor Metabolizer"
}
]
}
]
}
]
},
"atazanavir": {
"name": "atazanavir",
"id": "PA10251",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166128738"
],
"citations": [
{
"pmid": "26417955",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for UGT1A1 and Atazanavir Prescribing.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2016,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4785051"
}
],
"guidelines": [
{
"id": "PA166128738",
"name": "Annotation of CPIC Guideline for atazanavir and UGT1A1",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166128738",
"annotations": [
{
"implications": [
"UGT1A1: Reference UGT1A1 activity; very low likelihood of bilirubin-related discontinuation of atazanavir."
],
"drugRecommendation": "There is no need to avoid prescribing of atazanavir based on UGT1A1 genetic test result. Inform the patient that some patients stop atazanavir because of jaundice (yellow eyes and skin), but that this patient’s genotype makes this unlikely (less than about a 1 in 20 chance of stopping atazanavir because of jaundice).",
"classification": "Strong",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "UGT1A1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "UGT1A1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "UGT1A1",
"matchScore": 8,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": true,
"phenotypes": {
"UGT1A1": "Normal Metabolizer"
},
"lookupKey": [
{
"UGT1A1": "Normal Metabolizer"
}
]
}
]
}
]
},
"atomoxetine": {
"name": "atomoxetine",
"id": "PA134688071",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166181885"
],
"citations": [
{
"pmid": "30801677",
"title": "Clinical Pharmacogenetics Implementation Consortium Guideline for Cytochrome P450 (CYP)2D6 Genotype and Atomoxetine Therapy.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2019,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6612570"
}
],
"guidelines": [
{
"id": "PA166181885",
"name": "Annotation of CPIC Guideline for atomoxetine and CYP2D6",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166181885",
"annotations": []
}
]
},
"atorvastatin": {
"name": "atorvastatin",
"id": "PA448500",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "SLCO1B1-drug text",
"version": "1",
"matches": {
"gene": "SLCO1B1",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"simvastatin",
"rosuvastatin",
"pravastatin",
"pitavastatin",
"lovastatin",
"fluvastatin",
"atorvastatin"
]
},
"exception_type": "note",
"message": "The SLCO1B1 genotype (star nomenclature) will be displayed if determinable with the provided VCF based on the SLCO1B1 star allele definition published by CPIC and recommendations are provided based on the genotype.
In case no genotype can be determined, recommendations are based on the rs4149056 genotype alone as per guideline. The minor C allele at rs4149056 defines SLCO1B1*5."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166262221"
],
"citations": [
{
"pmid": "35152405",
"title": "The Clinical Pharmacogenetics Implementation Consortium Guideline for SLCO1B1, ABCG2, and CYP2C9 genotypes and Statin-Associated Musculoskeletal Symptoms.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2022,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9035072"
}
],
"guidelines": [
{
"id": "PA166262221",
"name": "Annotation of CPIC Guideline for atorvastatin and SLCO1B1",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166262221",
"annotations": [
{
"implications": [
"SLCO1B1: Typical myopathy risk and statin exposure"
],
"drugRecommendation": "Prescribe desired starting dose and adjust doses based on disease-specific guidelines.",
"classification": "Strong",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "SLCO1B1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "SLCO1B1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "SLCO1B1",
"matchScore": 70,
"phenotypes": [
"Normal Function"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Function"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"SLCO1B1": "Normal Function"
},
"lookupKey": [
{
"SLCO1B1": "Normal Function"
}
]
}
]
}
]
},
"azathioprine": {
"name": "azathioprine",
"id": "PA448515",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104933"
],
"citations": [
{
"pmid": "21270794",
"title": "Clinical Pharmacogenetics Implementation Consortium guidelines for thiopurine methyltransferase genotype and thiopurine dosing.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3098761"
},
{
"pmid": "23422873",
"title": "Clinical pharmacogenetics implementation consortium guidelines for thiopurine methyltransferase genotype and thiopurine dosing: 2013 update.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2013,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3604643"
},
{
"pmid": "30447069",
"title": "Clinical Pharmacogenetics Implementation Consortium Guideline for Thiopurine Dosing Based on TPMT and NUDT15 Genotypes: 2018 Update.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2019,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6576267"
},
{
"pmid": "41618934",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for Thiopurine Dosing Based on TPMT and NUDT15 Genotypes: 2025 Update.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2026,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/41618934"
}
],
"guidelines": [
{
"id": "PA166104933",
"name": "Annotation of CPIC Guideline for azathioprine and NUDT15, TPMT",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104933",
"annotations": [
{
"implications": [
"Normal risk of thiopurine-related leukopenia, neutropenia and myelosuppression.",
"TPMT NMs have lower erythrocyte concentrations of TGN metabolites and higher concentrations of MeMPNs compared to TPMT IMs and TPMT PMs. This is the 'normal' pattern."
],
"drugRecommendation": "Initiate therapy with standard starting dose (e.g., 2 mg/kg/day for autoimmune diseases). During therapy, adjust doses of azathioprine based on disease-specific guidelines. It usually takes at least 2 weeks to reach steady state after each dose adjustment.",
"classification": "Strong",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "NUDT15",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "NUDT15",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "NUDT15",
"matchScore": 36,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
},
{
"allele1": {
"gene": "TPMT",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "TPMT",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "TPMT",
"matchScore": 90,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"NUDT15": "Normal Metabolizer",
"TPMT": "Normal Metabolizer"
},
"lookupKey": [
{
"TPMT": "Normal Metabolizer",
"NUDT15": "Normal Metabolizer"
}
]
}
]
}
]
},
"capecitabine": {
"name": "capecitabine",
"id": "PA448771",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166109594"
],
"citations": [
{
"pmid": "23988873",
"title": "Clinical Pharmacogenetics Implementation Consortium guidelines for dihydropyrimidine dehydrogenase genotype and fluoropyrimidine dosing.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2013,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3831181"
},
{
"pmid": "29152729",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for Dihydropyrimidine Dehydrogenase Genotype and Fluoropyrimidine Dosing: 2017 Update.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2018,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5760397"
}
],
"guidelines": [
{
"id": "PA166109594",
"name": "Annotation of CPIC Guideline for capecitabine and DPYD",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166109594",
"annotations": [
{
"implications": [
"DPYD: Normal DPD activity and \"normal\" risk for fluoropyrimidine toxicity"
],
"drugRecommendation": "Based on genotype, there is no indication to change dose or therapy. Use label-recommended dosage and administration.",
"classification": "Strong",
"activityScore": {
"DPYD": "2.0"
},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "DPYD",
"matchScore": 0,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": [
{
"allele1": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "DPYD",
"matchScore": 166,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
],
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"DPYD": "Normal Metabolizer"
},
"lookupKey": [
{
"DPYD": "2.0"
}
]
}
]
}
]
},
"carbamazepine": {
"name": "carbamazepine",
"id": "PA448785",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166105008"
],
"citations": [
{
"pmid": "23695185",
"title": "Clinical Pharmacogenetics Implementation Consortium guidelines for HLA-B genotype and carbamazepine dosing.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2013,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3748365"
},
{
"pmid": "29392710",
"title": "Clinical Pharmacogenetics Implementation Consortium Guideline for HLA Genotype and Use of Carbamazepine and Oxcarbazepine: 2017 Update.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2018,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5847474"
}
],
"guidelines": [
{
"id": "PA166105008",
"name": "Annotation of CPIC Guideline for carbamazepine and HLA-A, HLA-B",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166105008",
"annotations": []
}
]
},
"celecoxib": {
"name": "celecoxib",
"id": "PA448871",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166191841"
],
"citations": [
{
"pmid": "32189324",
"title": "Clinical Pharmacogenetics Implementation Consortium Guideline (CPIC) for CYP2C9 and Nonsteroidal Anti-Inflammatory Drugs.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2020,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8080882"
}
],
"guidelines": [
{
"id": "PA166191841",
"name": "Annotation of CPIC Guideline for celecoxib, flurbiprofen, ibuprofen, lornoxicam and CYP2C9",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166191841",
"annotations": [
{
"implications": [
"CYP2C9: Normal metabolism"
],
"drugRecommendation": "Initiate therapy with recommended starting dose. In accordance with the prescribing information, use the lowest effective dosage for shortest duration consistent with individual patient treatment goals.",
"classification": "Strong",
"activityScore": {
"CYP2C9": "2.0"
},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "CYP2C9",
"matchScore": 166,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C9": "Normal Metabolizer"
},
"lookupKey": [
{
"CYP2C9": "2.0"
}
]
}
]
}
]
},
"citalopram": {
"name": "citalopram",
"id": "PA449015",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166127638"
],
"citations": [
{
"pmid": "25974703",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for CYP2D6 and CYP2C19 Genotypes and Dosing of Selective Serotonin Reuptake Inhibitors.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2015,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4512908"
},
{
"pmid": "37032427",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for CYP2D6, CYP2C19, CYP2B6, SLC6A4, and HTR2A Genotypes and Serotonin Reuptake Inhibitor Antidepressants.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2023,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10564324"
}
],
"guidelines": [
{
"id": "PA166127638",
"name": "Annotation of CPIC Guideline for citalopram, escitalopram and CYP2C19",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166127638",
"annotations": [
{
"implications": [
"CYP2C19: Reduced metabolism of citalopram and escitalopram to less active compounds when compared to CYP2C19 normal and intermediate metabolizers. Higher plasma concentrations may increase the probability of side effects."
],
"drugRecommendation": "Consider a clinically appropriate antidepressant not predominantly metabolized by CYP2C19. If citalopram or escitalopram are clinically appropriate, consider a lower starting dose, slower titration schedule and 50% reduction of the standard maintenance dose as compared to normal metabolizers.",
"classification": "Strong",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 6,
"phenotypes": [
"Poor Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Poor Metabolizer"
],
"label": "*2/*2",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*2": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": true,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Poor Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Poor Metabolizer"
}
]
}
]
}
]
},
"clomipramine": {
"name": "clomipramine",
"id": "PA449048",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166105007"
],
"citations": [
{
"pmid": "23486447",
"title": "Clinical Pharmacogenetics Implementation Consortium guideline for CYP2D6 and CYP2C19 genotypes and dosing of tricyclic antidepressants.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2013,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3689226"
},
{
"pmid": "27997040",
"title": "Clinical pharmacogenetics implementation consortium guideline (CPIC) for CYP2D6 and CYP2C19 genotypes and dosing of tricyclic antidepressants: 2016 update.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2017,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5478479"
}
],
"guidelines": [
{
"id": "PA166105007",
"name": "Annotation of CPIC Guideline for clomipramine and CYP2C19, CYP2D6",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166105007",
"annotations": [
{
"implications": [
"CYP2C19: Greatly reduced metabolism of tertiary amines compared to normal metabolizers; Decreased conversion of tertiary amines to secondary amines may affect response or side effects",
"CYP2D6: n/a"
],
"drugRecommendation": "Avoid tertiary amine use due to potential for sub-optimal response. Consider alternative drug not metabolized by CYP2C19. TCAs without major CYP2C19 metabolism include the secondary amines nortriptyline and desipramine. For tertiary amines, consider a 50% reduction of the recommended starting dose. Utilize therapeutic drug monitoring to guide dose adjustments. Titrate dose to observed clinical response with symptom improvement and minimal (if any) side effects.",
"classification": "Optional",
"activityScore": {
"CYP2C19": "n/a",
"CYP2D6": "No Result"
},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 6,
"phenotypes": [
"Poor Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Poor Metabolizer"
],
"label": "*2/*2",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*2": 2.0
}
},
{
"allele1": {
"gene": "CYP2D6",
"name": "Unknown",
"function": null,
"reference": false,
"activityValue": null
},
"allele2": {
"gene": "CYP2D6",
"name": "Unknown",
"function": null,
"reference": false,
"activityValue": null
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"No Result"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "No Result",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"No Result"
],
"label": "Unknown/Unknown",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Unknown": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": true,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Poor Metabolizer",
"CYP2D6": "No Result"
},
"lookupKey": [
{
"CYP2D6": "No Result",
"CYP2C19": "Poor Metabolizer"
}
]
}
]
}
]
},
"clopidogrel": {
"name": "clopidogrel",
"id": "PA449053",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104948"
],
"citations": [
{
"pmid": "21716271",
"title": "Clinical Pharmacogenetics Implementation Consortium guidelines for cytochrome P450-2C19 (CYP2C19) genotype and clopidogrel therapy.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3234301"
},
{
"pmid": "23698643",
"title": "Clinical Pharmacogenetics Implementation Consortium guidelines for CYP2C19 genotype and clopidogrel therapy: 2013 update.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2013,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3748366"
},
{
"pmid": "35034351",
"title": "Clinical Pharmacogenetics Implementation Consortium Guideline for CYP2C19 Genotype and Clopidogrel Therapy: 2022 Update.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2022,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9287492"
}
],
"guidelines": [
{
"id": "PA166104948",
"name": "Annotation of CPIC Guideline for clopidogrel and CYP2C19",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104948",
"annotations": [
{
"implications": [
"CYP2C19: Significantly reduced clopidogrel active metabolite formation; increased on-treatment platelet reactivity; increased risk for adverse cardiac and cerebrovascular events"
],
"drugRecommendation": "Avoid clopidogrel if possible. Use prasugrel or ticagrelor at standard dose if no contraindication.",
"classification": "Strong",
"activityScore": {},
"population": "CVI ACS PCI",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 6,
"phenotypes": [
"Poor Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Poor Metabolizer"
],
"label": "*2/*2",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*2": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": true,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Poor Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Poor Metabolizer"
}
]
},
{
"implications": [
"CYP2C19: Significantly reduced clopidogrel active metabolite formation; increased on-treatment platelet reactivity; increased risk for adverse cardiac and cerebrovascular events"
],
"drugRecommendation": "Avoid clopidogrel if possible. Use prasugrel or ticagrelor at standard dose if no contraindication.",
"classification": "Moderate",
"activityScore": {},
"population": "CVI non-ACS non-PCI",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 6,
"phenotypes": [
"Poor Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Poor Metabolizer"
],
"label": "*2/*2",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*2": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": true,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Poor Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Poor Metabolizer"
}
]
},
{
"implications": [
"CYP2C19: Significantly reduced clopidogrel active metabolite formation; increased on-treatment platelet reactivity; increased risk for adverse cardiac and cerebrovascular events"
],
"drugRecommendation": "Avoid clopidogrel if possible. Consider an alternative P2Y12 inhibitor at standard dose if clinically indicated and no contraindication.",
"classification": "Moderate",
"activityScore": {},
"population": "NVI",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 6,
"phenotypes": [
"Poor Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Poor Metabolizer"
],
"label": "*2/*2",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*2": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": true,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Poor Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Poor Metabolizer"
}
]
}
]
}
]
},
"codeine": {
"name": "codeine",
"id": "PA449088",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104996"
],
"citations": [
{
"pmid": "22205192",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) guidelines for codeine therapy in the context of cytochrome P450 2D6 (CYP2D6) genotype.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2012,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3289963"
},
{
"pmid": "24458010",
"title": "Clinical Pharmacogenetics Implementation Consortium guidelines for cytochrome P450 2D6 genotype and codeine therapy: 2014 update.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2014,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3975212"
},
{
"pmid": "33387367",
"title": "Clinical Pharmacogenetics Implementation Consortium Guideline for CYP2D6, OPRM1, and COMT Genotypes and Select Opioid Therapy.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2021,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8249478"
}
],
"guidelines": [
{
"id": "PA166104996",
"name": "Annotation of CPIC Guideline for codeine and CYP2D6",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104996",
"annotations": []
}
]
},
"dapsone": {
"name": "dapsone",
"id": "PA449211",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "G6PD hemizygous samples",
"version": "2",
"matches": {
"gene": "G6PD",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"aminosalicylic acid",
"aspirin",
"chloramphenicol",
"chloroquine",
"ciprofloxacin",
"dapsone",
"dimercaprol",
"doxorubicin",
"furazolidone",
"glyburide",
"hydroxychloroquine",
"mafenide",
"methylene blue",
"nalidixic acid",
"nitrofurantoin",
"norfloxacin",
"ofloxacin",
"pegloticase",
"phenazopyridine",
"primaquine",
"quinine",
"rasburicase",
"sulfadiazine",
"sulfadimidine",
"sulfamethoxazole",
"trimethoprim",
"sulfanilamide",
"sulfasalazine",
"sulfisoxazole",
"tafenoquine",
"tolbutamide",
"toluidine blue",
"vitamin c",
"vitamin k"
]
},
"exception_type": "note",
"message": "PharmCAT reports based on VCF file input and some VCF files do not specify hemizygous (one X chromosome) and instead represent samples as homozygous. See PharmCAT FAQs (https://pharmcat.org/faqs/)."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166119846"
],
"citations": [
{
"pmid": "24787449",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) guidelines for rasburicase therapy in the context of G6PD deficiency genotype.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2014,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4111801"
},
{
"pmid": "36049896",
"title": "Expanded Clinical Pharmacogenetics Implementation Consortium Guideline for Medication Use in the Context of G6PD Genotype.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2023,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10281211"
}
],
"guidelines": [
{
"id": "PA166119846",
"name": "Annotation of CPIC Guideline for dapsone, methylene blue, pegloticase, rasburicase, tafenoquine, toluidine blue and G6PD",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166119846",
"annotations": [
{
"implications": [
"G6PD: Low risk of acute hemolytic anemia"
],
"drugRecommendation": "No reason to avoid based on G6PD status",
"classification": "Strong",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "G6PD",
"name": "B (reference)",
"function": "IV/Normal",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "G6PD",
"name": "B (reference)",
"function": "IV/Normal",
"reference": true,
"activityValue": "n/a"
},
"gene": "G6PD",
"matchScore": 342,
"phenotypes": [
"Normal"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal"
],
"label": "B (reference)/B (reference)",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"B (reference)": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"G6PD": "Normal"
},
"lookupKey": [
{
"G6PD": "Normal"
}
]
}
]
}
]
},
"desflurane": {
"name": "desflurane",
"id": "PA164749136",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166303941"
],
"citations": [
{
"pmid": "30499100",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for the Use of Potent Volatile Anesthetic Agents and Succinylcholine in the Context of RYR1 or CACNA1S Genotypes.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2019,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6513720"
}
],
"guidelines": [
{
"id": "PA166303941",
"name": "Annotation of CPIC Guideline for desflurane, enflurane, halothane, isoflurane, methoxyflurane, sevoflurane, succinylcholine and CACNA1S, RYR1",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166303941",
"annotations": [
{
"implications": [
"These results do not eliminate the chance that this patient is susceptible to malignant hyperthermia (MH). The genetic cause of about half of all MH survivors, with MH susceptibility confirmed by contracture test, remains unknown (PMID 28902675)."
],
"drugRecommendation": "Clinical findings, family history, further genetic testing and other laboratory data should guide use of halogenated volatile anesthetics or depolarizing muscle relaxants.",
"classification": "Strong",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CACNA1S",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CACNA1S",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CACNA1S",
"matchScore": 4,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
},
{
"allele1": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "RYR1",
"matchScore": 0,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": [
{
"allele1": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "RYR1",
"matchScore": 626,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
],
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": true,
"phenotypes": {
"CACNA1S": "Uncertain Susceptibility",
"RYR1": "Uncertain Susceptibility"
},
"lookupKey": [
{
"RYR1": "Uncertain Susceptibility",
"CACNA1S": "Uncertain Susceptibility"
}
]
}
]
}
]
},
"desipramine": {
"name": "desipramine",
"id": "PA449233",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166105002"
],
"citations": [
{
"pmid": "23486447",
"title": "Clinical Pharmacogenetics Implementation Consortium guideline for CYP2D6 and CYP2C19 genotypes and dosing of tricyclic antidepressants.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2013,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3689226"
},
{
"pmid": "27997040",
"title": "Clinical pharmacogenetics implementation consortium guideline (CPIC) for CYP2D6 and CYP2C19 genotypes and dosing of tricyclic antidepressants: 2016 update.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2017,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5478479"
}
],
"guidelines": [
{
"id": "PA166105002",
"name": "Annotation of CPIC Guideline for desipramine and CYP2D6",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166105002",
"annotations": []
}
]
},
"dexlansoprazole": {
"name": "dexlansoprazole",
"id": "PA166110257",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166219301"
],
"citations": [
{
"pmid": "32770672",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for CYP2C19 and Proton Pump Inhibitor Dosing.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2021,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7868475"
}
],
"guidelines": [
{
"id": "PA166219301",
"name": "Annotation of CPIC Guideline for dexlansoprazole and CYP2C19",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166219301",
"annotations": [
{
"implications": [
"CYP2C19: Increased plasma concentration of PPI compared to CYP2C19 NMs; increased chance of efficacy and potentially toxicity"
],
"drugRecommendation": "Initiate standard starting daily dose. For chronic therapy (>12 weeks) and efficacy achieved, consider 50% reduction in daily dose and monitor for continued efficacy.",
"classification": "Optional",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 6,
"phenotypes": [
"Poor Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Poor Metabolizer"
],
"label": "*2/*2",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*2": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Poor Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Poor Metabolizer"
}
]
}
]
}
]
},
"dibekacin": {
"name": "dibekacin",
"id": "PA166292901",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166229081"
],
"citations": [
{
"pmid": "34032273",
"title": "Clinical Pharmacogenetics Implementation Consortium Guideline for the Use of Aminoglycosides Based on MT-RNR1 Genotype.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2022,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8613315"
}
],
"guidelines": [
{
"id": "PA166229081",
"name": "Annotation of CPIC Guideline for amikacin, dibekacin, gentamicin, kanamycin, neomycin, netilmicin, paromomycin, plazomicin, ribostamycin, streptomycin, tobramycin and MT-RNR1",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166229081",
"annotations": []
}
]
},
"doxepin": {
"name": "doxepin",
"id": "PA449409",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166105000"
],
"citations": [
{
"pmid": "23486447",
"title": "Clinical Pharmacogenetics Implementation Consortium guideline for CYP2D6 and CYP2C19 genotypes and dosing of tricyclic antidepressants.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2013,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3689226"
},
{
"pmid": "27997040",
"title": "Clinical pharmacogenetics implementation consortium guideline (CPIC) for CYP2D6 and CYP2C19 genotypes and dosing of tricyclic antidepressants: 2016 update.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2017,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5478479"
}
],
"guidelines": [
{
"id": "PA166105000",
"name": "Annotation of CPIC Guideline for doxepin and CYP2C19, CYP2D6",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166105000",
"annotations": [
{
"implications": [
"CYP2C19: Greatly reduced metabolism of tertiary amines compared to normal metabolizers; Decreased conversion of tertiary amines to secondary amines may affect response or side effects",
"CYP2D6: n/a"
],
"drugRecommendation": "Avoid tertiary amine use due to potential for sub-optimal response. Consider alternative drug not metabolized by CYP2C19. TCAs without major CYP2C19 metabolism include the secondary amines nortriptyline and desipramine. For tertiary amines, consider a 50% reduction of the recommended starting dose. Utilize therapeutic drug monitoring to guide dose adjustments. Titrate dose to observed clinical response with symptom improvement and minimal (if any) side effects.",
"classification": "Optional",
"activityScore": {
"CYP2C19": "n/a",
"CYP2D6": "No Result"
},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 6,
"phenotypes": [
"Poor Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Poor Metabolizer"
],
"label": "*2/*2",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*2": 2.0
}
},
{
"allele1": {
"gene": "CYP2D6",
"name": "Unknown",
"function": null,
"reference": false,
"activityValue": null
},
"allele2": {
"gene": "CYP2D6",
"name": "Unknown",
"function": null,
"reference": false,
"activityValue": null
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"No Result"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "No Result",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"No Result"
],
"label": "Unknown/Unknown",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Unknown": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": true,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Poor Metabolizer",
"CYP2D6": "No Result"
},
"lookupKey": [
{
"CYP2D6": "No Result",
"CYP2C19": "Poor Metabolizer"
}
]
}
]
}
]
},
"efavirenz": {
"name": "efavirenz",
"id": "PA449441",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "CYP2B6 *1/*6 warning",
"version": "1",
"matches": {
"gene": "CYP2B6",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [
"*1/*6"
],
"drugs": [
"efavirenz"
]
},
"exception_type": "ambiguity",
"message": "The assigned genotype is *1/*6; however, *4/*9 cannot be ruled out without phased data."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166182603"
],
"citations": [
{
"pmid": "31006110",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for CYP2B6 and Efavirenz-Containing Antiretroviral Therapy.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2019,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6739160"
}
],
"guidelines": [
{
"id": "PA166182603",
"name": "Annotation of CPIC Guideline for efavirenz and CYP2B6",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166182603",
"annotations": [
{
"implications": [
"CYP2B6: Higher dose-adjusted trough concentrations of efavirenz compared with normal metabolizers; increased risk of CNS adverse events"
],
"drugRecommendation": "Consider initiating efavirenz with decreased dose of 400 mg/day",
"classification": "Moderate",
"activityScore": {},
"population": "child >40kg_adult",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2B6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2B6",
"name": "*6",
"function": "Decreased function",
"reference": false,
"activityValue": "n/a"
},
"gene": "CYP2B6",
"matchScore": 50,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Intermediate Metabolizer"
],
"label": "*1/*6",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 1.0,
"*6": 1.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2B6": "Intermediate Metabolizer"
},
"lookupKey": [
{
"CYP2B6": "Intermediate Metabolizer"
}
]
}
]
}
]
},
"enflurane": {
"name": "enflurane",
"id": "PA449461",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166303941"
],
"citations": [
{
"pmid": "30499100",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for the Use of Potent Volatile Anesthetic Agents and Succinylcholine in the Context of RYR1 or CACNA1S Genotypes.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2019,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6513720"
}
],
"guidelines": [
{
"id": "PA166303941",
"name": "Annotation of CPIC Guideline for desflurane, enflurane, halothane, isoflurane, methoxyflurane, sevoflurane, succinylcholine and CACNA1S, RYR1",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166303941",
"annotations": [
{
"implications": [
"These results do not eliminate the chance that this patient is susceptible to malignant hyperthermia (MH). The genetic cause of about half of all MH survivors, with MH susceptibility confirmed by contracture test, remains unknown (PMID 28902675)."
],
"drugRecommendation": "Clinical findings, family history, further genetic testing and other laboratory data should guide use of halogenated volatile anesthetics or depolarizing muscle relaxants.",
"classification": "Strong",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CACNA1S",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CACNA1S",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CACNA1S",
"matchScore": 4,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
},
{
"allele1": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "RYR1",
"matchScore": 0,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": [
{
"allele1": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "RYR1",
"matchScore": 626,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
],
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": true,
"phenotypes": {
"CACNA1S": "Uncertain Susceptibility",
"RYR1": "Uncertain Susceptibility"
},
"lookupKey": [
{
"RYR1": "Uncertain Susceptibility",
"CACNA1S": "Uncertain Susceptibility"
}
]
}
]
}
]
},
"escitalopram": {
"name": "escitalopram",
"id": "PA10074",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166127638"
],
"citations": [
{
"pmid": "25974703",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for CYP2D6 and CYP2C19 Genotypes and Dosing of Selective Serotonin Reuptake Inhibitors.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2015,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4512908"
},
{
"pmid": "37032427",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for CYP2D6, CYP2C19, CYP2B6, SLC6A4, and HTR2A Genotypes and Serotonin Reuptake Inhibitor Antidepressants.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2023,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10564324"
}
],
"guidelines": [
{
"id": "PA166127638",
"name": "Annotation of CPIC Guideline for citalopram, escitalopram and CYP2C19",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166127638",
"annotations": [
{
"implications": [
"CYP2C19: Reduced metabolism of citalopram and escitalopram to less active compounds when compared to CYP2C19 normal and intermediate metabolizers. Higher plasma concentrations may increase the probability of side effects."
],
"drugRecommendation": "Consider a clinically appropriate antidepressant not predominantly metabolized by CYP2C19. If citalopram or escitalopram are clinically appropriate, consider a lower starting dose, slower titration schedule and 50% reduction of the standard maintenance dose as compared to normal metabolizers.",
"classification": "Strong",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 6,
"phenotypes": [
"Poor Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Poor Metabolizer"
],
"label": "*2/*2",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*2": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": true,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Poor Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Poor Metabolizer"
}
]
}
]
}
]
},
"fluorouracil": {
"name": "fluorouracil",
"id": "PA128406956",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166122686"
],
"citations": [
{
"pmid": "23988873",
"title": "Clinical Pharmacogenetics Implementation Consortium guidelines for dihydropyrimidine dehydrogenase genotype and fluoropyrimidine dosing.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2013,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3831181"
},
{
"pmid": "29152729",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for Dihydropyrimidine Dehydrogenase Genotype and Fluoropyrimidine Dosing: 2017 Update.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2018,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5760397"
}
],
"guidelines": [
{
"id": "PA166122686",
"name": "Annotation of CPIC Guideline for fluorouracil and DPYD",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166122686",
"annotations": [
{
"implications": [
"DPYD: Normal DPD activity and \"normal\" risk for fluoropyrimidine toxicity"
],
"drugRecommendation": "Based on genotype, there is no indication to change dose or therapy. Use label-recommended dosage and administration.",
"classification": "Strong",
"activityScore": {
"DPYD": "2.0"
},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "DPYD",
"matchScore": 0,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": [
{
"allele1": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "DPYD",
"matchScore": 166,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
],
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"DPYD": "Normal Metabolizer"
},
"lookupKey": [
{
"DPYD": "2.0"
}
]
}
]
}
]
},
"flurbiprofen": {
"name": "flurbiprofen",
"id": "PA449683",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166191841"
],
"citations": [
{
"pmid": "32189324",
"title": "Clinical Pharmacogenetics Implementation Consortium Guideline (CPIC) for CYP2C9 and Nonsteroidal Anti-Inflammatory Drugs.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2020,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8080882"
}
],
"guidelines": [
{
"id": "PA166191841",
"name": "Annotation of CPIC Guideline for celecoxib, flurbiprofen, ibuprofen, lornoxicam and CYP2C9",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166191841",
"annotations": [
{
"implications": [
"CYP2C9: Normal metabolism"
],
"drugRecommendation": "Initiate therapy with recommended starting dose. In accordance with the prescribing information, use the lowest effective dosage for shortest duration consistent with individual patient treatment goals.",
"classification": "Strong",
"activityScore": {
"CYP2C9": "2.0"
},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "CYP2C9",
"matchScore": 166,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C9": "Normal Metabolizer"
},
"lookupKey": [
{
"CYP2C9": "2.0"
}
]
}
]
}
]
},
"fluvastatin": {
"name": "fluvastatin",
"id": "PA449688",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "SLCO1B1-drug text",
"version": "1",
"matches": {
"gene": "SLCO1B1",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"simvastatin",
"rosuvastatin",
"pravastatin",
"pitavastatin",
"lovastatin",
"fluvastatin",
"atorvastatin"
]
},
"exception_type": "note",
"message": "The SLCO1B1 genotype (star nomenclature) will be displayed if determinable with the provided VCF based on the SLCO1B1 star allele definition published by CPIC and recommendations are provided based on the genotype.
In case no genotype can be determined, recommendations are based on the rs4149056 genotype alone as per guideline. The minor C allele at rs4149056 defines SLCO1B1*5."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166262341"
],
"citations": [
{
"pmid": "35152405",
"title": "The Clinical Pharmacogenetics Implementation Consortium Guideline for SLCO1B1, ABCG2, and CYP2C9 genotypes and Statin-Associated Musculoskeletal Symptoms.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2022,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9035072"
}
],
"guidelines": [
{
"id": "PA166262341",
"name": "Annotation of CPIC Guideline for fluvastatin and CYP2C9, SLCO1B1",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166262341",
"annotations": [
{
"implications": [
"CYP2C9: Normal exposure.",
"SLCO1B1: Typical myopathy risk and statin exposure."
],
"drugRecommendation": "Prescribe desired starting dose and adjust doses of fluvastatin based on disease-specific guidelines.",
"classification": "Strong",
"activityScore": {
"CYP2C9": "2.0",
"SLCO1B1": "n/a"
},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "CYP2C9",
"matchScore": 166,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
},
{
"allele1": {
"gene": "SLCO1B1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "SLCO1B1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "SLCO1B1",
"matchScore": 70,
"phenotypes": [
"Normal Function"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Function"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C9": "Normal Metabolizer",
"SLCO1B1": "Normal Function"
},
"lookupKey": [
{
"CYP2C9": "2.0",
"SLCO1B1": "Normal Function"
}
]
}
]
}
]
},
"fluvoxamine": {
"name": "fluvoxamine",
"id": "PA449690",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166127637"
],
"citations": [
{
"pmid": "25974703",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for CYP2D6 and CYP2C19 Genotypes and Dosing of Selective Serotonin Reuptake Inhibitors.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2015,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4512908"
},
{
"pmid": "37032427",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for CYP2D6, CYP2C19, CYP2B6, SLC6A4, and HTR2A Genotypes and Serotonin Reuptake Inhibitor Antidepressants.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2023,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10564324"
}
],
"guidelines": [
{
"id": "PA166127637",
"name": "Annotation of CPIC Guideline for fluvoxamine and CYP2D6",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166127637",
"annotations": []
}
]
},
"fosphenytoin": {
"name": "fosphenytoin",
"id": "PA164746820",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "Phenytoin_HLA-B warning",
"version": "1",
"matches": {
"gene": null,
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"phenytoin",
"fosphenytoin"
]
},
"exception_type": "note",
"message": "The displayed recommendation for CYP2C9 and phenytoin is ONLY valid for non-carriers of the HLA-B*15:02 high-risk allele. PharmCAT Named Allele Matcher does not determine HLA status. CPIC guidance: Fos-/Phenytoin is contraindicated in individuals with the HLA-B*15:02 variant allele (\"HLA-B*15:02-positive\") due to significantly increased risk of fos-/phenytoin-induced cutaneous adverse reactions of Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN). In HLA-B*15:02 carriers, carbamazepine should not be used as an alternative. Alternative medications such as oxcarbazepine, eslicarbazepine acetate, and lamotrigine have some evidence linking SJS/TEN with the HLA-B*15:02 allele, and thus caution should be used in choosing alternatives to phenytoin."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166122806"
],
"citations": [
{
"pmid": "25099164",
"title": "Clinical pharmacogenetics implementation consortium guidelines for CYP2C9 and HLA-B genotypes and phenytoin dosing.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2014,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4206662"
},
{
"pmid": "32779747",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for CYP2C9 and HLA-B Genotypes and Phenytoin Dosing: 2020 Update.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2021,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7831382"
}
],
"guidelines": [
{
"id": "PA166122806",
"name": "Annotation of CPIC Guideline for fosphenytoin, phenytoin and CYP2C9, HLA-B",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166122806",
"annotations": [
{
"implications": [
"CYP2C9: Normal phenytoin metabolism",
"HLA-B: n/a"
],
"drugRecommendation": "No adjustments needed from typical dosing strategies. Subsequent doses should be adjusted according to therapeutic drug monitoring, response, and side effects. An HLA-B*15:02 negative test does not eliminate the risk of phenytoin-induced SJS/TEN and patients should be carefully monitored according to a usual standard.",
"classification": "Strong",
"activityScore": {
"CYP2C9": "2.0",
"HLA-B": "n/a"
},
"population": "PHT naive",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "CYP2C9",
"matchScore": 166,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
},
{
"allele1": {
"gene": "HLA-B",
"name": "Unknown",
"function": null,
"reference": false,
"activityValue": null
},
"allele2": {
"gene": "HLA-B",
"name": "Unknown",
"function": null,
"reference": false,
"activityValue": null
},
"gene": "HLA-B",
"matchScore": 0,
"phenotypes": [],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"No Result"
],
"label": "Unknown/Unknown",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Unknown": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C9": "Normal Metabolizer"
},
"lookupKey": [
{
"HLA-B": "No Result",
"CYP2C9": "2.0"
}
]
},
{
"implications": [
"CYP2C9: Normal phenytoin metabolism",
"HLA-B: n/a"
],
"drugRecommendation": "No adjustments needed from typical dosing strategies. Subsequent doses should be adjusted according to therapeutic drug monitoring, response, and side effects. An HLA-B*15:02 negative test does not eliminate the risk of phenytoin-induced SJS/TEN and patients should be carefully monitored according to a usual standard.",
"classification": "Strong",
"activityScore": {
"CYP2C9": "2.0",
"HLA-B": "n/a"
},
"population": "PHT use >3mos",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "CYP2C9",
"matchScore": 166,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
},
{
"allele1": {
"gene": "HLA-B",
"name": "Unknown",
"function": null,
"reference": false,
"activityValue": null
},
"allele2": {
"gene": "HLA-B",
"name": "Unknown",
"function": null,
"reference": false,
"activityValue": null
},
"gene": "HLA-B",
"matchScore": 0,
"phenotypes": [],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"No Result"
],
"label": "Unknown/Unknown",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Unknown": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C9": "Normal Metabolizer"
},
"lookupKey": [
{
"HLA-B": "No Result",
"CYP2C9": "2.0"
}
]
}
]
}
]
},
"gentamicin": {
"name": "gentamicin",
"id": "PA449753",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166229081"
],
"citations": [
{
"pmid": "34032273",
"title": "Clinical Pharmacogenetics Implementation Consortium Guideline for the Use of Aminoglycosides Based on MT-RNR1 Genotype.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2022,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8613315"
}
],
"guidelines": [
{
"id": "PA166229081",
"name": "Annotation of CPIC Guideline for amikacin, dibekacin, gentamicin, kanamycin, neomycin, netilmicin, paromomycin, plazomicin, ribostamycin, streptomycin, tobramycin and MT-RNR1",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166229081",
"annotations": []
}
]
},
"halothane": {
"name": "halothane",
"id": "PA449845",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166303941"
],
"citations": [
{
"pmid": "30499100",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for the Use of Potent Volatile Anesthetic Agents and Succinylcholine in the Context of RYR1 or CACNA1S Genotypes.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2019,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6513720"
}
],
"guidelines": [
{
"id": "PA166303941",
"name": "Annotation of CPIC Guideline for desflurane, enflurane, halothane, isoflurane, methoxyflurane, sevoflurane, succinylcholine and CACNA1S, RYR1",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166303941",
"annotations": [
{
"implications": [
"These results do not eliminate the chance that this patient is susceptible to malignant hyperthermia (MH). The genetic cause of about half of all MH survivors, with MH susceptibility confirmed by contracture test, remains unknown (PMID 28902675)."
],
"drugRecommendation": "Clinical findings, family history, further genetic testing and other laboratory data should guide use of halogenated volatile anesthetics or depolarizing muscle relaxants.",
"classification": "Strong",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CACNA1S",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CACNA1S",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CACNA1S",
"matchScore": 4,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
},
{
"allele1": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "RYR1",
"matchScore": 0,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": [
{
"allele1": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "RYR1",
"matchScore": 626,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
],
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": true,
"phenotypes": {
"CACNA1S": "Uncertain Susceptibility",
"RYR1": "Uncertain Susceptibility"
},
"lookupKey": [
{
"RYR1": "Uncertain Susceptibility",
"CACNA1S": "Uncertain Susceptibility"
}
]
}
]
}
]
},
"hydralazine": {
"name": "hydralazine",
"id": "PA449894",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166416341"
],
"citations": [
{
"pmid": "40974042",
"title": "Clinical Pharmacogenetics Implementation Consortium Guideline for NAT2 Genotype and Hydralazine Therapy.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2025,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/40974042"
}
],
"guidelines": [
{
"id": "PA166416341",
"name": "Annotation of CPIC Guideline for hydralazine and NAT2",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166416341",
"annotations": [
{
"implications": [
"Predicted to have reduced plasma concentrations and efficacy of hydralazine compared to NAT2 poor metabolizers."
],
"drugRecommendation": "Consider a starting total daily dose of at least 75 mg. Titrate up to 300 mg total daily hydralazine dose as tolerated. NAT2 rapid metabolizers typically require a 50-100% higher maintenance dose compared to poor metabolizers.",
"classification": "Moderate",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "NAT2",
"name": "*1",
"function": "Increased function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "NAT2",
"name": "*1",
"function": "Increased function",
"reference": true,
"activityValue": "n/a"
},
"gene": "NAT2",
"matchScore": 94,
"phenotypes": [
"Rapid Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Rapid Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"NAT2": "Rapid Metabolizer"
},
"lookupKey": [
{
"NAT2": "Rapid Metabolizer"
}
]
}
]
}
]
},
"hydrocodone": {
"name": "hydrocodone",
"id": "PA449900",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166228121"
],
"citations": [
{
"pmid": "33387367",
"title": "Clinical Pharmacogenetics Implementation Consortium Guideline for CYP2D6, OPRM1, and COMT Genotypes and Select Opioid Therapy.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2021,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8249478"
}
],
"guidelines": [
{
"id": "PA166228121",
"name": "Annotation of CPIC Guideline for hydrocodone and CYP2D6",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166228121",
"annotations": []
}
]
},
"ibuprofen": {
"name": "ibuprofen",
"id": "PA449957",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166191841"
],
"citations": [
{
"pmid": "32189324",
"title": "Clinical Pharmacogenetics Implementation Consortium Guideline (CPIC) for CYP2C9 and Nonsteroidal Anti-Inflammatory Drugs.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2020,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8080882"
}
],
"guidelines": [
{
"id": "PA166191841",
"name": "Annotation of CPIC Guideline for celecoxib, flurbiprofen, ibuprofen, lornoxicam and CYP2C9",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166191841",
"annotations": [
{
"implications": [
"CYP2C9: Normal metabolism"
],
"drugRecommendation": "Initiate therapy with recommended starting dose. In accordance with the prescribing information, use the lowest effective dosage for shortest duration consistent with individual patient treatment goals.",
"classification": "Strong",
"activityScore": {
"CYP2C9": "2.0"
},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "CYP2C9",
"matchScore": 166,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C9": "Normal Metabolizer"
},
"lookupKey": [
{
"CYP2C9": "2.0"
}
]
}
]
}
]
},
"imipramine": {
"name": "imipramine",
"id": "PA449969",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104999"
],
"citations": [
{
"pmid": "23486447",
"title": "Clinical Pharmacogenetics Implementation Consortium guideline for CYP2D6 and CYP2C19 genotypes and dosing of tricyclic antidepressants.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2013,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3689226"
},
{
"pmid": "27997040",
"title": "Clinical pharmacogenetics implementation consortium guideline (CPIC) for CYP2D6 and CYP2C19 genotypes and dosing of tricyclic antidepressants: 2016 update.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2017,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5478479"
}
],
"guidelines": [
{
"id": "PA166104999",
"name": "Annotation of CPIC Guideline for imipramine and CYP2C19, CYP2D6",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104999",
"annotations": [
{
"implications": [
"CYP2C19: Greatly reduced metabolism of tertiary amines compared to normal metabolizers; Decreased conversion of tertiary amines to secondary amines may affect response or side effects",
"CYP2D6: n/a"
],
"drugRecommendation": "Avoid tertiary amine use due to potential for sub-optimal response. Consider alternative drug not metabolized by CYP2C19. TCAs without major CYP2C19 metabolism include the secondary amines nortriptyline and desipramine. For tertiary amines, consider a 50% reduction of the recommended starting dose. Utilize therapeutic drug monitoring to guide dose adjustments. Titrate dose to observed clinical response with symptom improvement and minimal (if any) side effects.",
"classification": "Optional",
"activityScore": {
"CYP2C19": "n/a",
"CYP2D6": "No Result"
},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 6,
"phenotypes": [
"Poor Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Poor Metabolizer"
],
"label": "*2/*2",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*2": 2.0
}
},
{
"allele1": {
"gene": "CYP2D6",
"name": "Unknown",
"function": null,
"reference": false,
"activityValue": null
},
"allele2": {
"gene": "CYP2D6",
"name": "Unknown",
"function": null,
"reference": false,
"activityValue": null
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"No Result"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "No Result",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"No Result"
],
"label": "Unknown/Unknown",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Unknown": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": true,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Poor Metabolizer",
"CYP2D6": "No Result"
},
"lookupKey": [
{
"CYP2D6": "No Result",
"CYP2C19": "Poor Metabolizer"
}
]
}
]
}
]
},
"isoflurane": {
"name": "isoflurane",
"id": "PA450106",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166303941"
],
"citations": [
{
"pmid": "30499100",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for the Use of Potent Volatile Anesthetic Agents and Succinylcholine in the Context of RYR1 or CACNA1S Genotypes.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2019,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6513720"
}
],
"guidelines": [
{
"id": "PA166303941",
"name": "Annotation of CPIC Guideline for desflurane, enflurane, halothane, isoflurane, methoxyflurane, sevoflurane, succinylcholine and CACNA1S, RYR1",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166303941",
"annotations": [
{
"implications": [
"These results do not eliminate the chance that this patient is susceptible to malignant hyperthermia (MH). The genetic cause of about half of all MH survivors, with MH susceptibility confirmed by contracture test, remains unknown (PMID 28902675)."
],
"drugRecommendation": "Clinical findings, family history, further genetic testing and other laboratory data should guide use of halogenated volatile anesthetics or depolarizing muscle relaxants.",
"classification": "Strong",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CACNA1S",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CACNA1S",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CACNA1S",
"matchScore": 4,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
},
{
"allele1": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "RYR1",
"matchScore": 0,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": [
{
"allele1": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "RYR1",
"matchScore": 626,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
],
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": true,
"phenotypes": {
"CACNA1S": "Uncertain Susceptibility",
"RYR1": "Uncertain Susceptibility"
},
"lookupKey": [
{
"RYR1": "Uncertain Susceptibility",
"CACNA1S": "Uncertain Susceptibility"
}
]
}
]
}
]
},
"ivacaftor": {
"name": "ivacaftor",
"id": "PA165950341",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166114461"
],
"citations": [
{
"pmid": "24598717",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) guidelines for ivacaftor therapy in the context of CFTR genotype.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2014,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4026598"
}
],
"guidelines": [
{
"id": "PA166114461",
"name": "Annotation of CPIC Guideline for ivacaftor and CFTR",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166114461",
"annotations": [
{
"implications": [
"CFTR: An individual diagnosed with cystic fibrosis (CF) and negative for a CFTR variant listed in the FDA-approved drug label as being responsive to ivacaftor."
],
"drugRecommendation": "Ivacaftor is not recommended",
"classification": "Moderate",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CFTR",
"name": "ivacaftor non-responsive CFTR sequence",
"function": "ivacaftor non-responsive",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CFTR",
"name": "ivacaftor non-responsive CFTR sequence",
"function": "ivacaftor non-responsive",
"reference": true,
"activityValue": "n/a"
},
"gene": "CFTR",
"matchScore": 186,
"phenotypes": [
"ivacaftor non-responsive in CF patients"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"ivacaftor non-responsive in CF patients"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"ivacaftor non-responsive CFTR sequence": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": true,
"otherPrescribingGuidance": false,
"phenotypes": {
"CFTR": "ivacaftor non-responsive in CF patients"
},
"lookupKey": [
{
"CFTR": "ivacaftor non-responsive in CF patients"
}
]
}
]
}
]
},
"kanamycin": {
"name": "kanamycin",
"id": "PA450137",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166229081"
],
"citations": [
{
"pmid": "34032273",
"title": "Clinical Pharmacogenetics Implementation Consortium Guideline for the Use of Aminoglycosides Based on MT-RNR1 Genotype.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2022,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8613315"
}
],
"guidelines": [
{
"id": "PA166229081",
"name": "Annotation of CPIC Guideline for amikacin, dibekacin, gentamicin, kanamycin, neomycin, netilmicin, paromomycin, plazomicin, ribostamycin, streptomycin, tobramycin and MT-RNR1",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166229081",
"annotations": []
}
]
},
"lansoprazole": {
"name": "lansoprazole",
"id": "PA450180",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166219103"
],
"citations": [
{
"pmid": "32770672",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for CYP2C19 and Proton Pump Inhibitor Dosing.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2021,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7868475"
}
],
"guidelines": [
{
"id": "PA166219103",
"name": "Annotation of CPIC Guideline for lansoprazole, omeprazole, pantoprazole and CYP2C19",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166219103",
"annotations": [
{
"implications": [
"CYP2C19: Increased plasma concentration of PPI compared to CYP2C19 NMs; increased chance of efficacy and potentially toxicity"
],
"drugRecommendation": "Initiate standard starting daily dose. For chronic therapy (>12 weeks) and efficacy achieved, consider 50% reduction in daily dose and monitor for continued efficacy.",
"classification": "Moderate",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 6,
"phenotypes": [
"Poor Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Poor Metabolizer"
],
"label": "*2/*2",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*2": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Poor Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Poor Metabolizer"
}
]
}
]
}
]
},
"lornoxicam": {
"name": "lornoxicam",
"id": "PA165958395",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166191841"
],
"citations": [
{
"pmid": "32189324",
"title": "Clinical Pharmacogenetics Implementation Consortium Guideline (CPIC) for CYP2C9 and Nonsteroidal Anti-Inflammatory Drugs.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2020,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8080882"
}
],
"guidelines": [
{
"id": "PA166191841",
"name": "Annotation of CPIC Guideline for celecoxib, flurbiprofen, ibuprofen, lornoxicam and CYP2C9",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166191841",
"annotations": [
{
"implications": [
"CYP2C9: Normal metabolism"
],
"drugRecommendation": "Initiate therapy with recommended starting dose. In accordance with the prescribing information, use the lowest effective dosage for shortest duration consistent with individual patient treatment goals.",
"classification": "Strong",
"activityScore": {
"CYP2C9": "2.0"
},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "CYP2C9",
"matchScore": 166,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C9": "Normal Metabolizer"
},
"lookupKey": [
{
"CYP2C9": "2.0"
}
]
}
]
}
]
},
"lovastatin": {
"name": "lovastatin",
"id": "PA450272",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "SLCO1B1-drug text",
"version": "1",
"matches": {
"gene": "SLCO1B1",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"simvastatin",
"rosuvastatin",
"pravastatin",
"pitavastatin",
"lovastatin",
"fluvastatin",
"atorvastatin"
]
},
"exception_type": "note",
"message": "The SLCO1B1 genotype (star nomenclature) will be displayed if determinable with the provided VCF based on the SLCO1B1 star allele definition published by CPIC and recommendations are provided based on the genotype.
In case no genotype can be determined, recommendations are based on the rs4149056 genotype alone as per guideline. The minor C allele at rs4149056 defines SLCO1B1*5."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166262241"
],
"citations": [
{
"pmid": "35152405",
"title": "The Clinical Pharmacogenetics Implementation Consortium Guideline for SLCO1B1, ABCG2, and CYP2C9 genotypes and Statin-Associated Musculoskeletal Symptoms.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2022,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9035072"
}
],
"guidelines": [
{
"id": "PA166262241",
"name": "Annotation of CPIC Guideline for lovastatin and SLCO1B1",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166262241",
"annotations": [
{
"implications": [
"SLCO1B1: Typical myopathy risk and statin exposure"
],
"drugRecommendation": "Prescribe desired starting dose and adjust doses based on disease-specific guidelines.",
"classification": "Strong",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "SLCO1B1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "SLCO1B1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "SLCO1B1",
"matchScore": 70,
"phenotypes": [
"Normal Function"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Function"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"SLCO1B1": "Normal Function"
},
"lookupKey": [
{
"SLCO1B1": "Normal Function"
}
]
}
]
}
]
},
"meloxicam": {
"name": "meloxicam",
"id": "PA450353",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166192301"
],
"citations": [
{
"pmid": "32189324",
"title": "Clinical Pharmacogenetics Implementation Consortium Guideline (CPIC) for CYP2C9 and Nonsteroidal Anti-Inflammatory Drugs.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2020,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8080882"
}
],
"guidelines": [
{
"id": "PA166192301",
"name": "Annotation of CPIC Guideline for meloxicam and CYP2C9",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166192301",
"annotations": [
{
"implications": [
"CYP2C9: Normal metabolism"
],
"drugRecommendation": "Initiate therapy with recommended starting dose. In accordance with the prescribing information, use the lowest effective dosage for shortest duration consistent with individual patient treatment goals.",
"classification": "Strong",
"activityScore": {
"CYP2C9": "2.0"
},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "CYP2C9",
"matchScore": 166,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C9": "Normal Metabolizer"
},
"lookupKey": [
{
"CYP2C9": "2.0"
}
]
}
]
}
]
},
"mercaptopurine": {
"name": "mercaptopurine",
"id": "PA450379",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104945"
],
"citations": [
{
"pmid": "21270794",
"title": "Clinical Pharmacogenetics Implementation Consortium guidelines for thiopurine methyltransferase genotype and thiopurine dosing.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3098761"
},
{
"pmid": "23422873",
"title": "Clinical pharmacogenetics implementation consortium guidelines for thiopurine methyltransferase genotype and thiopurine dosing: 2013 update.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2013,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3604643"
},
{
"pmid": "30447069",
"title": "Clinical Pharmacogenetics Implementation Consortium Guideline for Thiopurine Dosing Based on TPMT and NUDT15 Genotypes: 2018 Update.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2019,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6576267"
},
{
"pmid": "41618934",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for Thiopurine Dosing Based on TPMT and NUDT15 Genotypes: 2025 Update.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2026,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/41618934"
}
],
"guidelines": [
{
"id": "PA166104945",
"name": "Annotation of CPIC Guideline for mercaptopurine and NUDT15, TPMT",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104945",
"annotations": [
{
"implications": [
"Normal risk of thiopurine-related leukopenia, neutropenia and myelosuppression.",
"TPMT NMs have lower erythrocyte concentrations of TGN metabolites and higher concentrations of MeMPNs compared to TPMT IMs and TPMT PMs. This is the 'normal' pattern."
],
"drugRecommendation": "Initiate therapy with standard starting dose of mecaptopurine (e.g., 75 mg/m2/day for malignancy or 1.5 mg/kg/day for nonmalignancy). During therapy, adjust the doses of myelosuppressive agents, as per standard clinical practice. It usually takes at least 2 weeks of stable dosing to reach steady state after each dose adjustment.",
"classification": "Strong",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "NUDT15",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "NUDT15",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "NUDT15",
"matchScore": 36,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
},
{
"allele1": {
"gene": "TPMT",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "TPMT",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "TPMT",
"matchScore": 90,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"NUDT15": "Normal Metabolizer",
"TPMT": "Normal Metabolizer"
},
"lookupKey": [
{
"TPMT": "Normal Metabolizer",
"NUDT15": "Normal Metabolizer"
}
]
}
]
}
]
},
"methoxyflurane": {
"name": "methoxyflurane",
"id": "PA450434",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166303941"
],
"citations": [
{
"pmid": "30499100",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for the Use of Potent Volatile Anesthetic Agents and Succinylcholine in the Context of RYR1 or CACNA1S Genotypes.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2019,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6513720"
}
],
"guidelines": [
{
"id": "PA166303941",
"name": "Annotation of CPIC Guideline for desflurane, enflurane, halothane, isoflurane, methoxyflurane, sevoflurane, succinylcholine and CACNA1S, RYR1",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166303941",
"annotations": [
{
"implications": [
"These results do not eliminate the chance that this patient is susceptible to malignant hyperthermia (MH). The genetic cause of about half of all MH survivors, with MH susceptibility confirmed by contracture test, remains unknown (PMID 28902675)."
],
"drugRecommendation": "Clinical findings, family history, further genetic testing and other laboratory data should guide use of halogenated volatile anesthetics or depolarizing muscle relaxants.",
"classification": "Strong",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CACNA1S",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CACNA1S",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CACNA1S",
"matchScore": 4,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
},
{
"allele1": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "RYR1",
"matchScore": 0,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": [
{
"allele1": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "RYR1",
"matchScore": 626,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
],
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": true,
"phenotypes": {
"CACNA1S": "Uncertain Susceptibility",
"RYR1": "Uncertain Susceptibility"
},
"lookupKey": [
{
"RYR1": "Uncertain Susceptibility",
"CACNA1S": "Uncertain Susceptibility"
}
]
}
]
}
]
},
"methylene blue": {
"name": "methylene blue",
"id": "PA450457",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "G6PD hemizygous samples",
"version": "2",
"matches": {
"gene": "G6PD",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"aminosalicylic acid",
"aspirin",
"chloramphenicol",
"chloroquine",
"ciprofloxacin",
"dapsone",
"dimercaprol",
"doxorubicin",
"furazolidone",
"glyburide",
"hydroxychloroquine",
"mafenide",
"methylene blue",
"nalidixic acid",
"nitrofurantoin",
"norfloxacin",
"ofloxacin",
"pegloticase",
"phenazopyridine",
"primaquine",
"quinine",
"rasburicase",
"sulfadiazine",
"sulfadimidine",
"sulfamethoxazole",
"trimethoprim",
"sulfanilamide",
"sulfasalazine",
"sulfisoxazole",
"tafenoquine",
"tolbutamide",
"toluidine blue",
"vitamin c",
"vitamin k"
]
},
"exception_type": "note",
"message": "PharmCAT reports based on VCF file input and some VCF files do not specify hemizygous (one X chromosome) and instead represent samples as homozygous. See PharmCAT FAQs (https://pharmcat.org/faqs/)."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166119846"
],
"citations": [
{
"pmid": "24787449",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) guidelines for rasburicase therapy in the context of G6PD deficiency genotype.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2014,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4111801"
},
{
"pmid": "36049896",
"title": "Expanded Clinical Pharmacogenetics Implementation Consortium Guideline for Medication Use in the Context of G6PD Genotype.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2023,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10281211"
}
],
"guidelines": [
{
"id": "PA166119846",
"name": "Annotation of CPIC Guideline for dapsone, methylene blue, pegloticase, rasburicase, tafenoquine, toluidine blue and G6PD",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166119846",
"annotations": [
{
"implications": [
"G6PD: Low risk of acute hemolytic anemia"
],
"drugRecommendation": "No reason to avoid based on G6PD status",
"classification": "Strong",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "G6PD",
"name": "B (reference)",
"function": "IV/Normal",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "G6PD",
"name": "B (reference)",
"function": "IV/Normal",
"reference": true,
"activityValue": "n/a"
},
"gene": "G6PD",
"matchScore": 342,
"phenotypes": [
"Normal"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal"
],
"label": "B (reference)/B (reference)",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"B (reference)": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"G6PD": "Normal"
},
"lookupKey": [
{
"G6PD": "Normal"
}
]
}
]
}
]
},
"metoprolol": {
"name": "metoprolol",
"id": "PA450480",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166341321"
],
"citations": [
{
"pmid": "38951961",
"title": "Clinical Pharmacogenetics Implementation Consortium Guideline (CPIC) for CYP2D6, ADRB1, ADRB2, ADRA2C, GRK4, and GRK5 Genotypes and Beta-Blocker Therapy.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2024,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC11502236"
}
],
"guidelines": [
{
"id": "PA166341321",
"name": "Annotation of CPIC Guideline for metoprolol and CYP2D6",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166341321",
"annotations": []
}
]
},
"neomycin": {
"name": "neomycin",
"id": "PA450608",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166229081"
],
"citations": [
{
"pmid": "34032273",
"title": "Clinical Pharmacogenetics Implementation Consortium Guideline for the Use of Aminoglycosides Based on MT-RNR1 Genotype.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2022,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8613315"
}
],
"guidelines": [
{
"id": "PA166229081",
"name": "Annotation of CPIC Guideline for amikacin, dibekacin, gentamicin, kanamycin, neomycin, netilmicin, paromomycin, plazomicin, ribostamycin, streptomycin, tobramycin and MT-RNR1",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166229081",
"annotations": []
}
]
},
"netilmicin": {
"name": "netilmicin",
"id": "PA164754913",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166229081"
],
"citations": [
{
"pmid": "34032273",
"title": "Clinical Pharmacogenetics Implementation Consortium Guideline for the Use of Aminoglycosides Based on MT-RNR1 Genotype.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2022,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8613315"
}
],
"guidelines": [
{
"id": "PA166229081",
"name": "Annotation of CPIC Guideline for amikacin, dibekacin, gentamicin, kanamycin, neomycin, netilmicin, paromomycin, plazomicin, ribostamycin, streptomycin, tobramycin and MT-RNR1",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166229081",
"annotations": []
}
]
},
"nitrofurantoin": {
"name": "nitrofurantoin",
"id": "PA450640",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "G6PD hemizygous samples",
"version": "2",
"matches": {
"gene": "G6PD",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"aminosalicylic acid",
"aspirin",
"chloramphenicol",
"chloroquine",
"ciprofloxacin",
"dapsone",
"dimercaprol",
"doxorubicin",
"furazolidone",
"glyburide",
"hydroxychloroquine",
"mafenide",
"methylene blue",
"nalidixic acid",
"nitrofurantoin",
"norfloxacin",
"ofloxacin",
"pegloticase",
"phenazopyridine",
"primaquine",
"quinine",
"rasburicase",
"sulfadiazine",
"sulfadimidine",
"sulfamethoxazole",
"trimethoprim",
"sulfanilamide",
"sulfasalazine",
"sulfisoxazole",
"tafenoquine",
"tolbutamide",
"toluidine blue",
"vitamin c",
"vitamin k"
]
},
"exception_type": "note",
"message": "PharmCAT reports based on VCF file input and some VCF files do not specify hemizygous (one X chromosome) and instead represent samples as homozygous. See PharmCAT FAQs (https://pharmcat.org/faqs/)."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166279721"
],
"citations": [],
"guidelines": [
{
"id": "PA166279721",
"name": "Annotation of CPIC Guideline for nitrofurantoin and G6PD",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166279721",
"annotations": [
{
"implications": [
"G6PD: Low risk of acute hemolytic anemia"
],
"drugRecommendation": "No reason to avoid based on G6PD status",
"classification": "Strong",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "G6PD",
"name": "B (reference)",
"function": "IV/Normal",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "G6PD",
"name": "B (reference)",
"function": "IV/Normal",
"reference": true,
"activityValue": "n/a"
},
"gene": "G6PD",
"matchScore": 342,
"phenotypes": [
"Normal"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal"
],
"label": "B (reference)/B (reference)",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"B (reference)": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"G6PD": "Normal"
},
"lookupKey": [
{
"G6PD": "Normal"
}
]
}
]
}
]
},
"nortriptyline": {
"name": "nortriptyline",
"id": "PA450657",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104998"
],
"citations": [
{
"pmid": "23486447",
"title": "Clinical Pharmacogenetics Implementation Consortium guideline for CYP2D6 and CYP2C19 genotypes and dosing of tricyclic antidepressants.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2013,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3689226"
},
{
"pmid": "27997040",
"title": "Clinical pharmacogenetics implementation consortium guideline (CPIC) for CYP2D6 and CYP2C19 genotypes and dosing of tricyclic antidepressants: 2016 update.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2017,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5478479"
}
],
"guidelines": [
{
"id": "PA166104998",
"name": "Annotation of CPIC Guideline for nortriptyline and CYP2D6",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104998",
"annotations": []
}
]
},
"omeprazole": {
"name": "omeprazole",
"id": "PA450704",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166219103"
],
"citations": [
{
"pmid": "32770672",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for CYP2C19 and Proton Pump Inhibitor Dosing.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2021,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7868475"
}
],
"guidelines": [
{
"id": "PA166219103",
"name": "Annotation of CPIC Guideline for lansoprazole, omeprazole, pantoprazole and CYP2C19",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166219103",
"annotations": [
{
"implications": [
"CYP2C19: Increased plasma concentration of PPI compared to CYP2C19 NMs; increased chance of efficacy and potentially toxicity"
],
"drugRecommendation": "Initiate standard starting daily dose. For chronic therapy (>12 weeks) and efficacy achieved, consider 50% reduction in daily dose and monitor for continued efficacy.",
"classification": "Moderate",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 6,
"phenotypes": [
"Poor Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Poor Metabolizer"
],
"label": "*2/*2",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*2": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Poor Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Poor Metabolizer"
}
]
}
]
}
]
},
"ondansetron": {
"name": "ondansetron",
"id": "PA450705",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166161954"
],
"citations": [
{
"pmid": "28002639",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) guideline for CYP2D6 genotype and use of ondansetron and tropisetron.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2017,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5479760"
}
],
"guidelines": [
{
"id": "PA166161954",
"name": "Annotation of CPIC Guideline for ondansetron and CYP2D6",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166161954",
"annotations": []
}
]
},
"oxcarbazepine": {
"name": "oxcarbazepine",
"id": "PA450732",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166176623"
],
"citations": [
{
"pmid": "29392710",
"title": "Clinical Pharmacogenetics Implementation Consortium Guideline for HLA Genotype and Use of Carbamazepine and Oxcarbazepine: 2017 Update.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2018,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5847474"
}
],
"guidelines": [
{
"id": "PA166176623",
"name": "Annotation of CPIC Guideline for oxcarbazepine and HLA-B",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166176623",
"annotations": []
}
]
},
"pantoprazole": {
"name": "pantoprazole",
"id": "PA450774",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166219103"
],
"citations": [
{
"pmid": "32770672",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for CYP2C19 and Proton Pump Inhibitor Dosing.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2021,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7868475"
}
],
"guidelines": [
{
"id": "PA166219103",
"name": "Annotation of CPIC Guideline for lansoprazole, omeprazole, pantoprazole and CYP2C19",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166219103",
"annotations": [
{
"implications": [
"CYP2C19: Increased plasma concentration of PPI compared to CYP2C19 NMs; increased chance of efficacy and potentially toxicity"
],
"drugRecommendation": "Initiate standard starting daily dose. For chronic therapy (>12 weeks) and efficacy achieved, consider 50% reduction in daily dose and monitor for continued efficacy.",
"classification": "Moderate",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 6,
"phenotypes": [
"Poor Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Poor Metabolizer"
],
"label": "*2/*2",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*2": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Poor Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Poor Metabolizer"
}
]
}
]
}
]
},
"paromomycin": {
"name": "paromomycin",
"id": "PA164784023",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166229081"
],
"citations": [
{
"pmid": "34032273",
"title": "Clinical Pharmacogenetics Implementation Consortium Guideline for the Use of Aminoglycosides Based on MT-RNR1 Genotype.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2022,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8613315"
}
],
"guidelines": [
{
"id": "PA166229081",
"name": "Annotation of CPIC Guideline for amikacin, dibekacin, gentamicin, kanamycin, neomycin, netilmicin, paromomycin, plazomicin, ribostamycin, streptomycin, tobramycin and MT-RNR1",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166229081",
"annotations": []
}
]
},
"paroxetine": {
"name": "paroxetine",
"id": "PA450801",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166127636"
],
"citations": [
{
"pmid": "25974703",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for CYP2D6 and CYP2C19 Genotypes and Dosing of Selective Serotonin Reuptake Inhibitors.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2015,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4512908"
},
{
"pmid": "37032427",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for CYP2D6, CYP2C19, CYP2B6, SLC6A4, and HTR2A Genotypes and Serotonin Reuptake Inhibitor Antidepressants.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2023,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10564324"
}
],
"guidelines": [
{
"id": "PA166127636",
"name": "Annotation of CPIC Guideline for paroxetine and CYP2D6",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166127636",
"annotations": []
}
]
},
"peginterferon alfa-2a": {
"name": "peginterferon alfa-2a",
"id": "PA164749390",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166110235"
],
"citations": [
{
"pmid": "24096968",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) guidelines for IFNL3 (IL28B) genotype and PEG interferon-alpha-based regimens.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2014,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3904555"
}
],
"guidelines": [
{
"id": "PA166110235",
"name": "Annotation of CPIC Guideline for peginterferon alfa-2a, peginterferon alfa-2b, ribavirin and IFNL3",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166110235",
"annotations": []
}
]
},
"peginterferon alfa-2b": {
"name": "peginterferon alfa-2b",
"id": "PA164784024",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166110235"
],
"citations": [
{
"pmid": "24096968",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) guidelines for IFNL3 (IL28B) genotype and PEG interferon-alpha-based regimens.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2014,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3904555"
}
],
"guidelines": [
{
"id": "PA166110235",
"name": "Annotation of CPIC Guideline for peginterferon alfa-2a, peginterferon alfa-2b, ribavirin and IFNL3",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166110235",
"annotations": []
}
]
},
"pegloticase": {
"name": "pegloticase",
"id": "PA165963961",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "G6PD hemizygous samples",
"version": "2",
"matches": {
"gene": "G6PD",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"aminosalicylic acid",
"aspirin",
"chloramphenicol",
"chloroquine",
"ciprofloxacin",
"dapsone",
"dimercaprol",
"doxorubicin",
"furazolidone",
"glyburide",
"hydroxychloroquine",
"mafenide",
"methylene blue",
"nalidixic acid",
"nitrofurantoin",
"norfloxacin",
"ofloxacin",
"pegloticase",
"phenazopyridine",
"primaquine",
"quinine",
"rasburicase",
"sulfadiazine",
"sulfadimidine",
"sulfamethoxazole",
"trimethoprim",
"sulfanilamide",
"sulfasalazine",
"sulfisoxazole",
"tafenoquine",
"tolbutamide",
"toluidine blue",
"vitamin c",
"vitamin k"
]
},
"exception_type": "note",
"message": "PharmCAT reports based on VCF file input and some VCF files do not specify hemizygous (one X chromosome) and instead represent samples as homozygous. See PharmCAT FAQs (https://pharmcat.org/faqs/)."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166119846"
],
"citations": [
{
"pmid": "24787449",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) guidelines for rasburicase therapy in the context of G6PD deficiency genotype.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2014,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4111801"
},
{
"pmid": "36049896",
"title": "Expanded Clinical Pharmacogenetics Implementation Consortium Guideline for Medication Use in the Context of G6PD Genotype.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2023,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10281211"
}
],
"guidelines": [
{
"id": "PA166119846",
"name": "Annotation of CPIC Guideline for dapsone, methylene blue, pegloticase, rasburicase, tafenoquine, toluidine blue and G6PD",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166119846",
"annotations": [
{
"implications": [
"G6PD: Low risk of acute hemolytic anemia"
],
"drugRecommendation": "No reason to avoid based on G6PD status",
"classification": "Strong",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "G6PD",
"name": "B (reference)",
"function": "IV/Normal",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "G6PD",
"name": "B (reference)",
"function": "IV/Normal",
"reference": true,
"activityValue": "n/a"
},
"gene": "G6PD",
"matchScore": 342,
"phenotypes": [
"Normal"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal"
],
"label": "B (reference)/B (reference)",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"B (reference)": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"G6PD": "Normal"
},
"lookupKey": [
{
"G6PD": "Normal"
}
]
}
]
}
]
},
"phenytoin": {
"name": "phenytoin",
"id": "PA450947",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "Phenytoin_HLA-B warning",
"version": "1",
"matches": {
"gene": null,
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"phenytoin",
"fosphenytoin"
]
},
"exception_type": "note",
"message": "The displayed recommendation for CYP2C9 and phenytoin is ONLY valid for non-carriers of the HLA-B*15:02 high-risk allele. PharmCAT Named Allele Matcher does not determine HLA status. CPIC guidance: Fos-/Phenytoin is contraindicated in individuals with the HLA-B*15:02 variant allele (\"HLA-B*15:02-positive\") due to significantly increased risk of fos-/phenytoin-induced cutaneous adverse reactions of Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN). In HLA-B*15:02 carriers, carbamazepine should not be used as an alternative. Alternative medications such as oxcarbazepine, eslicarbazepine acetate, and lamotrigine have some evidence linking SJS/TEN with the HLA-B*15:02 allele, and thus caution should be used in choosing alternatives to phenytoin."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166122806"
],
"citations": [
{
"pmid": "25099164",
"title": "Clinical pharmacogenetics implementation consortium guidelines for CYP2C9 and HLA-B genotypes and phenytoin dosing.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2014,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4206662"
},
{
"pmid": "32779747",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for CYP2C9 and HLA-B Genotypes and Phenytoin Dosing: 2020 Update.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2021,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7831382"
}
],
"guidelines": [
{
"id": "PA166122806",
"name": "Annotation of CPIC Guideline for fosphenytoin, phenytoin and CYP2C9, HLA-B",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166122806",
"annotations": [
{
"implications": [
"CYP2C9: Normal phenytoin metabolism",
"HLA-B: n/a"
],
"drugRecommendation": "No adjustments needed from typical dosing strategies. Subsequent doses should be adjusted according to therapeutic drug monitoring, response, and side effects. An HLA-B*15:02 negative test does not eliminate the risk of phenytoin-induced SJS/TEN and patients should be carefully monitored according to a usual standard.",
"classification": "Strong",
"activityScore": {
"CYP2C9": "2.0",
"HLA-B": "n/a"
},
"population": "PHT naive",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "CYP2C9",
"matchScore": 166,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
},
{
"allele1": {
"gene": "HLA-B",
"name": "Unknown",
"function": null,
"reference": false,
"activityValue": null
},
"allele2": {
"gene": "HLA-B",
"name": "Unknown",
"function": null,
"reference": false,
"activityValue": null
},
"gene": "HLA-B",
"matchScore": 0,
"phenotypes": [],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"No Result"
],
"label": "Unknown/Unknown",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Unknown": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C9": "Normal Metabolizer"
},
"lookupKey": [
{
"HLA-B": "No Result",
"CYP2C9": "2.0"
}
]
},
{
"implications": [
"CYP2C9: Normal phenytoin metabolism",
"HLA-B: n/a"
],
"drugRecommendation": "No adjustments needed from typical dosing strategies. Subsequent doses should be adjusted according to therapeutic drug monitoring, response, and side effects. An HLA-B*15:02 negative test does not eliminate the risk of phenytoin-induced SJS/TEN and patients should be carefully monitored according to a usual standard.",
"classification": "Strong",
"activityScore": {
"CYP2C9": "2.0",
"HLA-B": "n/a"
},
"population": "PHT use >3mos",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "CYP2C9",
"matchScore": 166,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
},
{
"allele1": {
"gene": "HLA-B",
"name": "Unknown",
"function": null,
"reference": false,
"activityValue": null
},
"allele2": {
"gene": "HLA-B",
"name": "Unknown",
"function": null,
"reference": false,
"activityValue": null
},
"gene": "HLA-B",
"matchScore": 0,
"phenotypes": [],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"No Result"
],
"label": "Unknown/Unknown",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Unknown": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C9": "Normal Metabolizer"
},
"lookupKey": [
{
"HLA-B": "No Result",
"CYP2C9": "2.0"
}
]
}
]
}
]
},
"piroxicam": {
"name": "piroxicam",
"id": "PA450985",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166192321"
],
"citations": [
{
"pmid": "32189324",
"title": "Clinical Pharmacogenetics Implementation Consortium Guideline (CPIC) for CYP2C9 and Nonsteroidal Anti-Inflammatory Drugs.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2020,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8080882"
}
],
"guidelines": [
{
"id": "PA166192321",
"name": "Annotation of CPIC Guideline for piroxicam and CYP2C9",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166192321",
"annotations": [
{
"implications": [
"CYP2C9: Normal metabolism"
],
"drugRecommendation": "Initiate therapy with recommended starting dose. In accordance with the prescribing information, use the lowest effective dosage for shortest duration consistent with individual patient treatment goals.",
"classification": "Strong",
"activityScore": {
"CYP2C9": "2.0"
},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "CYP2C9",
"matchScore": 166,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C9": "Normal Metabolizer"
},
"lookupKey": [
{
"CYP2C9": "2.0"
}
]
}
]
}
]
},
"pitavastatin": {
"name": "pitavastatin",
"id": "PA142650384",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "SLCO1B1-drug text",
"version": "1",
"matches": {
"gene": "SLCO1B1",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"simvastatin",
"rosuvastatin",
"pravastatin",
"pitavastatin",
"lovastatin",
"fluvastatin",
"atorvastatin"
]
},
"exception_type": "note",
"message": "The SLCO1B1 genotype (star nomenclature) will be displayed if determinable with the provided VCF based on the SLCO1B1 star allele definition published by CPIC and recommendations are provided based on the genotype.
In case no genotype can be determined, recommendations are based on the rs4149056 genotype alone as per guideline. The minor C allele at rs4149056 defines SLCO1B1*5."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166262261"
],
"citations": [
{
"pmid": "35152405",
"title": "The Clinical Pharmacogenetics Implementation Consortium Guideline for SLCO1B1, ABCG2, and CYP2C9 genotypes and Statin-Associated Musculoskeletal Symptoms.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2022,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9035072"
}
],
"guidelines": [
{
"id": "PA166262261",
"name": "Annotation of CPIC Guideline for pitavastatin and SLCO1B1",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166262261",
"annotations": [
{
"implications": [
"SLCO1B1: Typical myopathy risk and statin exposure"
],
"drugRecommendation": "Prescribe desired starting dose and adjust doses based on disease-specific guidelines.",
"classification": "Strong",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "SLCO1B1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "SLCO1B1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "SLCO1B1",
"matchScore": 70,
"phenotypes": [
"Normal Function"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Function"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"SLCO1B1": "Normal Function"
},
"lookupKey": [
{
"SLCO1B1": "Normal Function"
}
]
}
]
}
]
},
"plazomicin": {
"name": "plazomicin",
"id": "PA166228921",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166229081"
],
"citations": [
{
"pmid": "34032273",
"title": "Clinical Pharmacogenetics Implementation Consortium Guideline for the Use of Aminoglycosides Based on MT-RNR1 Genotype.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2022,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8613315"
}
],
"guidelines": [
{
"id": "PA166229081",
"name": "Annotation of CPIC Guideline for amikacin, dibekacin, gentamicin, kanamycin, neomycin, netilmicin, paromomycin, plazomicin, ribostamycin, streptomycin, tobramycin and MT-RNR1",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166229081",
"annotations": []
}
]
},
"pravastatin": {
"name": "pravastatin",
"id": "PA451089",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "SLCO1B1-drug text",
"version": "1",
"matches": {
"gene": "SLCO1B1",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"simvastatin",
"rosuvastatin",
"pravastatin",
"pitavastatin",
"lovastatin",
"fluvastatin",
"atorvastatin"
]
},
"exception_type": "note",
"message": "The SLCO1B1 genotype (star nomenclature) will be displayed if determinable with the provided VCF based on the SLCO1B1 star allele definition published by CPIC and recommendations are provided based on the genotype.
In case no genotype can be determined, recommendations are based on the rs4149056 genotype alone as per guideline. The minor C allele at rs4149056 defines SLCO1B1*5."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166262281"
],
"citations": [
{
"pmid": "35152405",
"title": "The Clinical Pharmacogenetics Implementation Consortium Guideline for SLCO1B1, ABCG2, and CYP2C9 genotypes and Statin-Associated Musculoskeletal Symptoms.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2022,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9035072"
}
],
"guidelines": [
{
"id": "PA166262281",
"name": "Annotation of CPIC Guideline for pravastatin and SLCO1B1",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166262281",
"annotations": [
{
"implications": [
"SLCO1B1: Typical myopathy risk and statin exposure"
],
"drugRecommendation": "Prescribe desired starting dose and adjust doses based on disease-specific guidelines.",
"classification": "Strong",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "SLCO1B1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "SLCO1B1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "SLCO1B1",
"matchScore": 70,
"phenotypes": [
"Normal Function"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Function"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"SLCO1B1": "Normal Function"
},
"lookupKey": [
{
"SLCO1B1": "Normal Function"
}
]
}
]
}
]
},
"primaquine": {
"name": "primaquine",
"id": "PA451103",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "G6PD hemizygous samples",
"version": "2",
"matches": {
"gene": "G6PD",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"aminosalicylic acid",
"aspirin",
"chloramphenicol",
"chloroquine",
"ciprofloxacin",
"dapsone",
"dimercaprol",
"doxorubicin",
"furazolidone",
"glyburide",
"hydroxychloroquine",
"mafenide",
"methylene blue",
"nalidixic acid",
"nitrofurantoin",
"norfloxacin",
"ofloxacin",
"pegloticase",
"phenazopyridine",
"primaquine",
"quinine",
"rasburicase",
"sulfadiazine",
"sulfadimidine",
"sulfamethoxazole",
"trimethoprim",
"sulfanilamide",
"sulfasalazine",
"sulfisoxazole",
"tafenoquine",
"tolbutamide",
"toluidine blue",
"vitamin c",
"vitamin k"
]
},
"exception_type": "note",
"message": "PharmCAT reports based on VCF file input and some VCF files do not specify hemizygous (one X chromosome) and instead represent samples as homozygous. See PharmCAT FAQs (https://pharmcat.org/faqs/)."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166279621"
],
"citations": [
{
"pmid": "36049896",
"title": "Expanded Clinical Pharmacogenetics Implementation Consortium Guideline for Medication Use in the Context of G6PD Genotype.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2023,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10281211"
}
],
"guidelines": [
{
"id": "PA166279621",
"name": "Annotation of CPIC Guideline for primaquine and G6PD",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166279621",
"annotations": [
{
"implications": [
"G6PD: Low risk of acute hemolytic anemia"
],
"drugRecommendation": "No reason to avoid based on G6PD status",
"classification": "Strong",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "G6PD",
"name": "B (reference)",
"function": "IV/Normal",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "G6PD",
"name": "B (reference)",
"function": "IV/Normal",
"reference": true,
"activityValue": "n/a"
},
"gene": "G6PD",
"matchScore": 342,
"phenotypes": [
"Normal"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal"
],
"label": "B (reference)/B (reference)",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"B (reference)": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"G6PD": "Normal"
},
"lookupKey": [
{
"G6PD": "Normal"
}
]
}
]
}
]
},
"rasburicase": {
"name": "rasburicase",
"id": "PA10176",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "G6PD hemizygous samples",
"version": "2",
"matches": {
"gene": "G6PD",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"aminosalicylic acid",
"aspirin",
"chloramphenicol",
"chloroquine",
"ciprofloxacin",
"dapsone",
"dimercaprol",
"doxorubicin",
"furazolidone",
"glyburide",
"hydroxychloroquine",
"mafenide",
"methylene blue",
"nalidixic acid",
"nitrofurantoin",
"norfloxacin",
"ofloxacin",
"pegloticase",
"phenazopyridine",
"primaquine",
"quinine",
"rasburicase",
"sulfadiazine",
"sulfadimidine",
"sulfamethoxazole",
"trimethoprim",
"sulfanilamide",
"sulfasalazine",
"sulfisoxazole",
"tafenoquine",
"tolbutamide",
"toluidine blue",
"vitamin c",
"vitamin k"
]
},
"exception_type": "note",
"message": "PharmCAT reports based on VCF file input and some VCF files do not specify hemizygous (one X chromosome) and instead represent samples as homozygous. See PharmCAT FAQs (https://pharmcat.org/faqs/)."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166119846"
],
"citations": [
{
"pmid": "24787449",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) guidelines for rasburicase therapy in the context of G6PD deficiency genotype.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2014,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4111801"
},
{
"pmid": "36049896",
"title": "Expanded Clinical Pharmacogenetics Implementation Consortium Guideline for Medication Use in the Context of G6PD Genotype.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2023,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10281211"
}
],
"guidelines": [
{
"id": "PA166119846",
"name": "Annotation of CPIC Guideline for dapsone, methylene blue, pegloticase, rasburicase, tafenoquine, toluidine blue and G6PD",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166119846",
"annotations": [
{
"implications": [
"G6PD: Low risk of acute hemolytic anemia"
],
"drugRecommendation": "No reason to avoid based on G6PD status",
"classification": "Strong",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "G6PD",
"name": "B (reference)",
"function": "IV/Normal",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "G6PD",
"name": "B (reference)",
"function": "IV/Normal",
"reference": true,
"activityValue": "n/a"
},
"gene": "G6PD",
"matchScore": 342,
"phenotypes": [
"Normal"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal"
],
"label": "B (reference)/B (reference)",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"B (reference)": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"G6PD": "Normal"
},
"lookupKey": [
{
"G6PD": "Normal"
}
]
}
]
}
]
},
"ribavirin": {
"name": "ribavirin",
"id": "PA451241",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166110235"
],
"citations": [
{
"pmid": "24096968",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) guidelines for IFNL3 (IL28B) genotype and PEG interferon-alpha-based regimens.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2014,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3904555"
}
],
"guidelines": [
{
"id": "PA166110235",
"name": "Annotation of CPIC Guideline for peginterferon alfa-2a, peginterferon alfa-2b, ribavirin and IFNL3",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166110235",
"annotations": []
}
]
},
"ribostamycin": {
"name": "ribostamycin",
"id": "PA166292902",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166229081"
],
"citations": [
{
"pmid": "34032273",
"title": "Clinical Pharmacogenetics Implementation Consortium Guideline for the Use of Aminoglycosides Based on MT-RNR1 Genotype.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2022,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8613315"
}
],
"guidelines": [
{
"id": "PA166229081",
"name": "Annotation of CPIC Guideline for amikacin, dibekacin, gentamicin, kanamycin, neomycin, netilmicin, paromomycin, plazomicin, ribostamycin, streptomycin, tobramycin and MT-RNR1",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166229081",
"annotations": []
}
]
},
"rosuvastatin": {
"name": "rosuvastatin",
"id": "PA134308647",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "SLCO1B1-drug text",
"version": "1",
"matches": {
"gene": "SLCO1B1",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"simvastatin",
"rosuvastatin",
"pravastatin",
"pitavastatin",
"lovastatin",
"fluvastatin",
"atorvastatin"
]
},
"exception_type": "note",
"message": "The SLCO1B1 genotype (star nomenclature) will be displayed if determinable with the provided VCF based on the SLCO1B1 star allele definition published by CPIC and recommendations are provided based on the genotype.
In case no genotype can be determined, recommendations are based on the rs4149056 genotype alone as per guideline. The minor C allele at rs4149056 defines SLCO1B1*5."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166262321"
],
"citations": [
{
"pmid": "35152405",
"title": "The Clinical Pharmacogenetics Implementation Consortium Guideline for SLCO1B1, ABCG2, and CYP2C9 genotypes and Statin-Associated Musculoskeletal Symptoms.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2022,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9035072"
}
],
"guidelines": [
{
"id": "PA166262321",
"name": "Annotation of CPIC Guideline for rosuvastatin and ABCG2, SLCO1B1",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166262321",
"annotations": [
{
"implications": [
"ABCG2: Typical myopathy risk and rosuvastatin exposure",
"SLCO1B1: Typical myopathy risk and statin exposure"
],
"drugRecommendation": "Prescribe desired starting dose and adjust doses of rosuvastatin based on disease-specific and specific population guidelines.",
"classification": "Strong",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "ABCG2",
"name": "rs2231142 reference (G)",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "ABCG2",
"name": "rs2231142 reference (G)",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "ABCG2",
"matchScore": 2,
"phenotypes": [
"Normal Function"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Function"
],
"label": "rs2231142 reference (G)/rs2231142 reference (G)",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"rs2231142 reference (G)": 2.0
}
},
{
"allele1": {
"gene": "SLCO1B1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "SLCO1B1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "SLCO1B1",
"matchScore": 70,
"phenotypes": [
"Normal Function"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Function"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"ABCG2": "Normal Function",
"SLCO1B1": "Normal Function"
},
"lookupKey": [
{
"ABCG2": "Normal Function",
"SLCO1B1": "Normal Function"
}
]
}
]
}
]
},
"sertraline": {
"name": "sertraline",
"id": "PA451333",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166127639"
],
"citations": [
{
"pmid": "25974703",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for CYP2D6 and CYP2C19 Genotypes and Dosing of Selective Serotonin Reuptake Inhibitors.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2015,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4512908"
},
{
"pmid": "37032427",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for CYP2D6, CYP2C19, CYP2B6, SLC6A4, and HTR2A Genotypes and Serotonin Reuptake Inhibitor Antidepressants.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2023,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10564324"
}
],
"guidelines": [
{
"id": "PA166127639",
"name": "Annotation of CPIC Guideline for sertraline and CYP2B6, CYP2C19",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166127639",
"annotations": [
{
"implications": [
"CYP2B6: Reduced metabolism of sertraline to less active compounds when compared to CYP2B6 normal metabolizers.",
"CYP2C19: Greatly reduced metabolism of sertraline to less active compounds when compared to CYP2C19 normal metabolizers. Higher plasma concentrations may increase the probability of side effects."
],
"drugRecommendation": "Consider a lower starting dose, slower titration schedule and 50% reduction of standard maintenance dose as compared to CYP2C19 normal metabolizers or select a clinically appropriate alternative antidepressant not predominantly metabolized by CYP2C19.",
"classification": "Moderate",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2B6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2B6",
"name": "*6",
"function": "Decreased function",
"reference": false,
"activityValue": "n/a"
},
"gene": "CYP2B6",
"matchScore": 50,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Intermediate Metabolizer"
],
"label": "*1/*6",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 1.0,
"*6": 1.0
}
},
{
"allele1": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 6,
"phenotypes": [
"Poor Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Poor Metabolizer"
],
"label": "*2/*2",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*2": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": true,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2B6": "Intermediate Metabolizer",
"CYP2C19": "Poor Metabolizer"
},
"lookupKey": [
{
"CYP2B6": "Intermediate Metabolizer",
"CYP2C19": "Poor Metabolizer"
}
]
}
]
}
]
},
"sevoflurane": {
"name": "sevoflurane",
"id": "PA451341",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166303941"
],
"citations": [
{
"pmid": "30499100",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for the Use of Potent Volatile Anesthetic Agents and Succinylcholine in the Context of RYR1 or CACNA1S Genotypes.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2019,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6513720"
}
],
"guidelines": [
{
"id": "PA166303941",
"name": "Annotation of CPIC Guideline for desflurane, enflurane, halothane, isoflurane, methoxyflurane, sevoflurane, succinylcholine and CACNA1S, RYR1",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166303941",
"annotations": [
{
"implications": [
"These results do not eliminate the chance that this patient is susceptible to malignant hyperthermia (MH). The genetic cause of about half of all MH survivors, with MH susceptibility confirmed by contracture test, remains unknown (PMID 28902675)."
],
"drugRecommendation": "Clinical findings, family history, further genetic testing and other laboratory data should guide use of halogenated volatile anesthetics or depolarizing muscle relaxants.",
"classification": "Strong",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CACNA1S",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CACNA1S",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CACNA1S",
"matchScore": 4,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
},
{
"allele1": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "RYR1",
"matchScore": 0,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": [
{
"allele1": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "RYR1",
"matchScore": 626,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
],
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": true,
"phenotypes": {
"CACNA1S": "Uncertain Susceptibility",
"RYR1": "Uncertain Susceptibility"
},
"lookupKey": [
{
"RYR1": "Uncertain Susceptibility",
"CACNA1S": "Uncertain Susceptibility"
}
]
}
]
}
]
},
"simvastatin": {
"name": "simvastatin",
"id": "PA451363",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "SLCO1B1-drug text",
"version": "1",
"matches": {
"gene": "SLCO1B1",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"simvastatin",
"rosuvastatin",
"pravastatin",
"pitavastatin",
"lovastatin",
"fluvastatin",
"atorvastatin"
]
},
"exception_type": "note",
"message": "The SLCO1B1 genotype (star nomenclature) will be displayed if determinable with the provided VCF based on the SLCO1B1 star allele definition published by CPIC and recommendations are provided based on the genotype.
In case no genotype can be determined, recommendations are based on the rs4149056 genotype alone as per guideline. The minor C allele at rs4149056 defines SLCO1B1*5."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166105005"
],
"citations": [
{
"pmid": "22617227",
"title": "The clinical pharmacogenomics implementation consortium: CPIC guideline for SLCO1B1 and simvastatin-induced myopathy.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2012,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3384438"
},
{
"pmid": "24918167",
"title": "The clinical pharmacogenetics implementation consortium guideline for SLCO1B1 and simvastatin-induced myopathy: 2014 update.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2014,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4169720"
},
{
"pmid": "35152405",
"title": "The Clinical Pharmacogenetics Implementation Consortium Guideline for SLCO1B1, ABCG2, and CYP2C9 genotypes and Statin-Associated Musculoskeletal Symptoms.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2022,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9035072"
}
],
"guidelines": [
{
"id": "PA166105005",
"name": "Annotation of CPIC Guideline for simvastatin and SLCO1B1",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166105005",
"annotations": [
{
"implications": [
"SLCO1B1: Typical myopathy risk and statin exposure"
],
"drugRecommendation": "Prescribe desired starting dose and adjust doses based on disease-specific guidelines.",
"classification": "Strong",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "SLCO1B1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "SLCO1B1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "SLCO1B1",
"matchScore": 70,
"phenotypes": [
"Normal Function"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Function"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"SLCO1B1": "Normal Function"
},
"lookupKey": [
{
"SLCO1B1": "Normal Function"
}
]
}
]
}
]
},
"streptomycin": {
"name": "streptomycin",
"id": "PA451512",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166229081"
],
"citations": [
{
"pmid": "34032273",
"title": "Clinical Pharmacogenetics Implementation Consortium Guideline for the Use of Aminoglycosides Based on MT-RNR1 Genotype.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2022,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8613315"
}
],
"guidelines": [
{
"id": "PA166229081",
"name": "Annotation of CPIC Guideline for amikacin, dibekacin, gentamicin, kanamycin, neomycin, netilmicin, paromomycin, plazomicin, ribostamycin, streptomycin, tobramycin and MT-RNR1",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166229081",
"annotations": []
}
]
},
"succinylcholine": {
"name": "succinylcholine",
"id": "PA451522",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166303941"
],
"citations": [
{
"pmid": "30499100",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for the Use of Potent Volatile Anesthetic Agents and Succinylcholine in the Context of RYR1 or CACNA1S Genotypes.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2019,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6513720"
}
],
"guidelines": [
{
"id": "PA166303941",
"name": "Annotation of CPIC Guideline for desflurane, enflurane, halothane, isoflurane, methoxyflurane, sevoflurane, succinylcholine and CACNA1S, RYR1",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166303941",
"annotations": [
{
"implications": [
"These results do not eliminate the chance that this patient is susceptible to malignant hyperthermia (MH). The genetic cause of about half of all MH survivors, with MH susceptibility confirmed by contracture test, remains unknown (PMID 28902675)."
],
"drugRecommendation": "Clinical findings, family history, further genetic testing and other laboratory data should guide use of halogenated volatile anesthetics or depolarizing muscle relaxants.",
"classification": "Strong",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CACNA1S",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CACNA1S",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CACNA1S",
"matchScore": 4,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
},
{
"allele1": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "RYR1",
"matchScore": 0,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": [
{
"allele1": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "RYR1",
"matchScore": 626,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
],
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": true,
"phenotypes": {
"CACNA1S": "Uncertain Susceptibility",
"RYR1": "Uncertain Susceptibility"
},
"lookupKey": [
{
"RYR1": "Uncertain Susceptibility",
"CACNA1S": "Uncertain Susceptibility"
}
]
}
]
}
]
},
"tacrolimus": {
"name": "tacrolimus",
"id": "PA451578",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166124619"
],
"citations": [
{
"pmid": "25801146",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guidelines for CYP3A5 Genotype and Tacrolimus Dosing.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2015,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4481158"
}
],
"guidelines": [
{
"id": "PA166124619",
"name": "Annotation of CPIC Guideline for tacrolimus and CYP3A5",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166124619",
"annotations": [
{
"implications": [
"CYP3A5: Lower dose-adjusted trough concentrations of tacrolimus and decreased chance of achieving target tacrolimus concentrations."
],
"drugRecommendation": "Increase starting dose 1.5 to 2 times recommended starting dose. Total starting dose should not exceed 0.3 mg/kg/day. Use therapeutic drug monitoring to guide dose adjustments.",
"classification": "Strong",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP3A5",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP3A5",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP3A5",
"matchScore": 10,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP3A5": "Normal Metabolizer"
},
"lookupKey": [
{
"CYP3A5": "Normal Metabolizer"
}
]
}
]
}
]
},
"tafenoquine": {
"name": "tafenoquine",
"id": "PA166115580",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "G6PD hemizygous samples",
"version": "2",
"matches": {
"gene": "G6PD",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"aminosalicylic acid",
"aspirin",
"chloramphenicol",
"chloroquine",
"ciprofloxacin",
"dapsone",
"dimercaprol",
"doxorubicin",
"furazolidone",
"glyburide",
"hydroxychloroquine",
"mafenide",
"methylene blue",
"nalidixic acid",
"nitrofurantoin",
"norfloxacin",
"ofloxacin",
"pegloticase",
"phenazopyridine",
"primaquine",
"quinine",
"rasburicase",
"sulfadiazine",
"sulfadimidine",
"sulfamethoxazole",
"trimethoprim",
"sulfanilamide",
"sulfasalazine",
"sulfisoxazole",
"tafenoquine",
"tolbutamide",
"toluidine blue",
"vitamin c",
"vitamin k"
]
},
"exception_type": "note",
"message": "PharmCAT reports based on VCF file input and some VCF files do not specify hemizygous (one X chromosome) and instead represent samples as homozygous. See PharmCAT FAQs (https://pharmcat.org/faqs/)."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166119846"
],
"citations": [
{
"pmid": "24787449",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) guidelines for rasburicase therapy in the context of G6PD deficiency genotype.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2014,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4111801"
},
{
"pmid": "36049896",
"title": "Expanded Clinical Pharmacogenetics Implementation Consortium Guideline for Medication Use in the Context of G6PD Genotype.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2023,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10281211"
}
],
"guidelines": [
{
"id": "PA166119846",
"name": "Annotation of CPIC Guideline for dapsone, methylene blue, pegloticase, rasburicase, tafenoquine, toluidine blue and G6PD",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166119846",
"annotations": [
{
"implications": [
"G6PD: Low risk of acute hemolytic anemia"
],
"drugRecommendation": "No reason to avoid based on G6PD status",
"classification": "Strong",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "G6PD",
"name": "B (reference)",
"function": "IV/Normal",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "G6PD",
"name": "B (reference)",
"function": "IV/Normal",
"reference": true,
"activityValue": "n/a"
},
"gene": "G6PD",
"matchScore": 342,
"phenotypes": [
"Normal"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal"
],
"label": "B (reference)/B (reference)",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"B (reference)": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"G6PD": "Normal"
},
"lookupKey": [
{
"G6PD": "Normal"
}
]
}
]
}
]
},
"tamoxifen": {
"name": "tamoxifen",
"id": "PA451581",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166176068"
],
"citations": [
{
"pmid": "29385237",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for CYP2D6 and Tamoxifen Therapy.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2018,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5931215"
}
],
"guidelines": [
{
"id": "PA166176068",
"name": "Annotation of CPIC Guideline for tamoxifen and CYP2D6",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166176068",
"annotations": []
}
]
},
"tenoxicam": {
"name": "tenoxicam",
"id": "PA131890625",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166192341"
],
"citations": [
{
"pmid": "32189324",
"title": "Clinical Pharmacogenetics Implementation Consortium Guideline (CPIC) for CYP2C9 and Nonsteroidal Anti-Inflammatory Drugs.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2020,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8080882"
}
],
"guidelines": [
{
"id": "PA166192341",
"name": "Annotation of CPIC Guideline for tenoxicam and CYP2C9",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166192341",
"annotations": [
{
"implications": [
"CYP2C9: Normal metabolism"
],
"drugRecommendation": "Initiate therapy with recommended starting dose. In accordance with the prescribing information, use the lowest effective dosage for shortest duration consistent with individual patient treatment goals.",
"classification": "Strong",
"activityScore": {
"CYP2C9": "2.0"
},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "CYP2C9",
"matchScore": 166,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C9": "Normal Metabolizer"
},
"lookupKey": [
{
"CYP2C9": "2.0"
}
]
}
]
}
]
},
"thioguanine": {
"name": "thioguanine",
"id": "PA451663",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104965"
],
"citations": [
{
"pmid": "21270794",
"title": "Clinical Pharmacogenetics Implementation Consortium guidelines for thiopurine methyltransferase genotype and thiopurine dosing.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3098761"
},
{
"pmid": "23422873",
"title": "Clinical pharmacogenetics implementation consortium guidelines for thiopurine methyltransferase genotype and thiopurine dosing: 2013 update.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2013,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3604643"
},
{
"pmid": "30447069",
"title": "Clinical Pharmacogenetics Implementation Consortium Guideline for Thiopurine Dosing Based on TPMT and NUDT15 Genotypes: 2018 Update.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2019,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6576267"
},
{
"pmid": "41618934",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for Thiopurine Dosing Based on TPMT and NUDT15 Genotypes: 2025 Update.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2026,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/41618934"
}
],
"guidelines": [
{
"id": "PA166104965",
"name": "Annotation of CPIC Guideline for thioguanine and NUDT15, TPMT",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104965",
"annotations": [
{
"implications": [
"Normal risk of thiopurine-related leukopenia, neutropenia and myelosuppression.",
"TPMT NMs have lower erythrocyte concentrations of TGN metabolites compared to TPMT IMs and TPMT PMs. This is the 'normal' pattern."
],
"drugRecommendation": "Initiate therapy with standard starting dose of thioguanine (e.g., 40 mg/m2/day for malignancy). During therapy, adjust the doses of myelosuppressive agents, as per standard clinical practice. It usually takes at least 2 weeks of stable dosing to reach steady state after each dose adjustment.",
"classification": "Strong",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "NUDT15",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "NUDT15",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "NUDT15",
"matchScore": 36,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
},
{
"allele1": {
"gene": "TPMT",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "TPMT",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "TPMT",
"matchScore": 90,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"NUDT15": "Normal Metabolizer",
"TPMT": "Normal Metabolizer"
},
"lookupKey": [
{
"TPMT": "Normal Metabolizer",
"NUDT15": "Normal Metabolizer"
}
]
}
]
}
]
},
"tobramycin": {
"name": "tobramycin",
"id": "PA451704",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166229081"
],
"citations": [
{
"pmid": "34032273",
"title": "Clinical Pharmacogenetics Implementation Consortium Guideline for the Use of Aminoglycosides Based on MT-RNR1 Genotype.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2022,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8613315"
}
],
"guidelines": [
{
"id": "PA166229081",
"name": "Annotation of CPIC Guideline for amikacin, dibekacin, gentamicin, kanamycin, neomycin, netilmicin, paromomycin, plazomicin, ribostamycin, streptomycin, tobramycin and MT-RNR1",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166229081",
"annotations": []
}
]
},
"toluidine blue": {
"name": "toluidine blue",
"id": "PA166268821",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "G6PD hemizygous samples",
"version": "2",
"matches": {
"gene": "G6PD",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"aminosalicylic acid",
"aspirin",
"chloramphenicol",
"chloroquine",
"ciprofloxacin",
"dapsone",
"dimercaprol",
"doxorubicin",
"furazolidone",
"glyburide",
"hydroxychloroquine",
"mafenide",
"methylene blue",
"nalidixic acid",
"nitrofurantoin",
"norfloxacin",
"ofloxacin",
"pegloticase",
"phenazopyridine",
"primaquine",
"quinine",
"rasburicase",
"sulfadiazine",
"sulfadimidine",
"sulfamethoxazole",
"trimethoprim",
"sulfanilamide",
"sulfasalazine",
"sulfisoxazole",
"tafenoquine",
"tolbutamide",
"toluidine blue",
"vitamin c",
"vitamin k"
]
},
"exception_type": "note",
"message": "PharmCAT reports based on VCF file input and some VCF files do not specify hemizygous (one X chromosome) and instead represent samples as homozygous. See PharmCAT FAQs (https://pharmcat.org/faqs/)."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166119846"
],
"citations": [
{
"pmid": "24787449",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) guidelines for rasburicase therapy in the context of G6PD deficiency genotype.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2014,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4111801"
},
{
"pmid": "36049896",
"title": "Expanded Clinical Pharmacogenetics Implementation Consortium Guideline for Medication Use in the Context of G6PD Genotype.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2023,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10281211"
}
],
"guidelines": [
{
"id": "PA166119846",
"name": "Annotation of CPIC Guideline for dapsone, methylene blue, pegloticase, rasburicase, tafenoquine, toluidine blue and G6PD",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166119846",
"annotations": [
{
"implications": [
"G6PD: Low risk of acute hemolytic anemia"
],
"drugRecommendation": "No reason to avoid based on G6PD status",
"classification": "Strong",
"activityScore": {},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "G6PD",
"name": "B (reference)",
"function": "IV/Normal",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "G6PD",
"name": "B (reference)",
"function": "IV/Normal",
"reference": true,
"activityValue": "n/a"
},
"gene": "G6PD",
"matchScore": 342,
"phenotypes": [
"Normal"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal"
],
"label": "B (reference)/B (reference)",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"B (reference)": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"G6PD": "Normal"
},
"lookupKey": [
{
"G6PD": "Normal"
}
]
}
]
}
]
},
"tramadol": {
"name": "tramadol",
"id": "PA451735",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166228101"
],
"citations": [
{
"pmid": "33387367",
"title": "Clinical Pharmacogenetics Implementation Consortium Guideline for CYP2D6, OPRM1, and COMT Genotypes and Select Opioid Therapy.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2021,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8249478"
}
],
"guidelines": [
{
"id": "PA166228101",
"name": "Annotation of CPIC Guideline for tramadol and CYP2D6",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166228101",
"annotations": []
}
]
},
"trimipramine": {
"name": "trimipramine",
"id": "PA451791",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166105001"
],
"citations": [
{
"pmid": "23486447",
"title": "Clinical Pharmacogenetics Implementation Consortium guideline for CYP2D6 and CYP2C19 genotypes and dosing of tricyclic antidepressants.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2013,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3689226"
},
{
"pmid": "27997040",
"title": "Clinical pharmacogenetics implementation consortium guideline (CPIC) for CYP2D6 and CYP2C19 genotypes and dosing of tricyclic antidepressants: 2016 update.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2017,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5478479"
}
],
"guidelines": [
{
"id": "PA166105001",
"name": "Annotation of CPIC Guideline for trimipramine and CYP2C19, CYP2D6",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166105001",
"annotations": [
{
"implications": [
"CYP2C19: Greatly reduced metabolism of tertiary amines compared to normal metabolizers; Decreased conversion of tertiary amines to secondary amines may affect response or side effects",
"CYP2D6: n/a"
],
"drugRecommendation": "Avoid tertiary amine use due to potential for sub-optimal response. Consider alternative drug not metabolized by CYP2C19. TCAs without major CYP2C19 metabolism include the secondary amines nortriptyline and desipramine. For tertiary amines, consider a 50% reduction of the recommended starting dose. Utilize therapeutic drug monitoring to guide dose adjustments. Titrate dose to observed clinical response with symptom improvement and minimal (if any) side effects.",
"classification": "Optional",
"activityScore": {
"CYP2C19": "n/a",
"CYP2D6": "No Result"
},
"population": "general",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 6,
"phenotypes": [
"Poor Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Poor Metabolizer"
],
"label": "*2/*2",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*2": 2.0
}
},
{
"allele1": {
"gene": "CYP2D6",
"name": "Unknown",
"function": null,
"reference": false,
"activityValue": null
},
"allele2": {
"gene": "CYP2D6",
"name": "Unknown",
"function": null,
"reference": false,
"activityValue": null
},
"gene": "CYP2D6",
"matchScore": 0,
"phenotypes": [
"No Result"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "No Result",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"No Result"
],
"label": "Unknown/Unknown",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Unknown": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": true,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Poor Metabolizer",
"CYP2D6": "No Result"
},
"lookupKey": [
{
"CYP2D6": "No Result",
"CYP2C19": "Poor Metabolizer"
}
]
}
]
}
]
},
"tropisetron": {
"name": "tropisetron",
"id": "PA161925594",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166161955"
],
"citations": [
{
"pmid": "28002639",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) guideline for CYP2D6 genotype and use of ondansetron and tropisetron.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2017,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5479760"
}
],
"guidelines": [
{
"id": "PA166161955",
"name": "Annotation of CPIC Guideline for tropisetron and CYP2D6",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166161955",
"annotations": []
}
]
},
"venlafaxine": {
"name": "venlafaxine",
"id": "PA451866",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166288201"
],
"citations": [
{
"pmid": "37032427",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for CYP2D6, CYP2C19, CYP2B6, SLC6A4, and HTR2A Genotypes and Serotonin Reuptake Inhibitor Antidepressants.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2023,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10564324"
}
],
"guidelines": [
{
"id": "PA166288201",
"name": "Annotation of CPIC Guideline for venlafaxine and CYP2D6",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166288201",
"annotations": []
}
]
},
"voriconazole": {
"name": "voriconazole",
"id": "PA10233",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166161537"
],
"citations": [
{
"pmid": "27981572",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guidelines for CYP2C19 and Voriconazole Therapy.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2017,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5474211"
}
],
"guidelines": [
{
"id": "PA166161537",
"name": "Annotation of CPIC Guideline for voriconazole and CYP2C19",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166161537",
"annotations": [
{
"implications": [
"CYP2C19: Higher dose-adjusted trough concentrations of voriconazole and may increase probability of adverse events"
],
"drugRecommendation": "Choose an alternative agent that is not dependent on CYP2C19 metabolism as primary therapy in lieu of voriconazole. Such agents include isavuconazole, liposomal amphotericin B, and posaconazole. In the event that voriconazole is considered to be the most appropriate agent, based on clinical advice, for a patient with poor metabolizer genotype, voriconazole should be administered at a preferably lower than standard dosage with careful therapeutic drug monitoring.",
"classification": "Moderate",
"activityScore": {},
"population": "adults",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 6,
"phenotypes": [
"Poor Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Poor Metabolizer"
],
"label": "*2/*2",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*2": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": true,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Poor Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Poor Metabolizer"
}
]
},
{
"implications": [
"CYP2C19: Higher dose-adjusted trough concentrations of voriconazole and may increase probability of adverse events"
],
"drugRecommendation": "Choose an alternative agent that is not dependent on CYP2C19 metabolism as primary therapy in lieu of voriconazole. Such agents include liposomal amphotericin B and posaconazole. In the event that voriconazole is considered to be the most appropriate agent, based on clinical advice, for a patient with poor metabolizer genotype, voriconazole should be administered at a preferably lower than standard dosage with careful therapeutic drug monitoring.",
"classification": "Moderate",
"activityScore": {},
"population": "pediatrics",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 6,
"phenotypes": [
"Poor Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Poor Metabolizer"
],
"label": "*2/*2",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*2": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": true,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Poor Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Poor Metabolizer"
}
]
}
]
}
]
},
"vortioxetine": {
"name": "vortioxetine",
"id": "PA166122595",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166288221"
],
"citations": [
{
"pmid": "37032427",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for CYP2D6, CYP2C19, CYP2B6, SLC6A4, and HTR2A Genotypes and Serotonin Reuptake Inhibitor Antidepressants.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2023,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10564324"
}
],
"guidelines": [
{
"id": "PA166288221",
"name": "Annotation of CPIC Guideline for vortioxetine and CYP2D6",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166288221",
"annotations": []
}
]
},
"warfarin": {
"name": "warfarin",
"id": "PA451906",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "pcat-cpic-warfarin-1-flowchart",
"version": "1",
"matches": {
"gene": null,
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"warfarin"
]
},
"exception_type": "note",
"message": "Please follow the flow chart in figure 2 of the CPIC warfarin guideline to determine the appropriate dosing recommendation."
},
{
"rule_name": "pcat-cpic-warfarin-2-vkorc1",
"version": "1",
"matches": {
"gene": null,
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"warfarin"
]
},
"exception_type": "note",
"message": "The CPIC warfarin guideline only considers a single SNV in VKORC1 (rs9923231), which has varying frequency among different ancestral populations, and largely explains the differences in average dose requirements between people of European, African, and Asian descents. While other functional variants in VKORC1 have been associated with warfarin resistance (high dose requirements), there are currently no CPIC recommendations for how to use these other variants in warfarin dosing. An alternate name for rs9923231 is -1639G>A (note that VKORC1 is on the negative chromosomal strand, so displayed alleles are complemented). "
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104949"
],
"citations": [
{
"pmid": "21900891",
"title": "Clinical Pharmacogenetics Implementation Consortium Guidelines for CYP2C9 and VKORC1 genotypes and warfarin dosing.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3187550"
},
{
"pmid": "28198005",
"title": "Clinical Pharmacogenetics Implementation Consortium (CPIC) Guideline for Pharmacogenetics-Guided Warfarin Dosing: 2017 Update.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2017,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5546947"
}
],
"guidelines": [
{
"id": "PA166104949",
"name": "Annotation of CPIC Guideline for warfarin and CYP2C9, CYP4F2, VKORC1",
"source": "CPIC_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104949",
"annotations": [
{
"implications": [],
"drugRecommendation": null,
"classification": null,
"activityScore": {},
"population": "n/a",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "CYP2C9",
"matchScore": 166,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
},
{
"allele1": {
"gene": "CYP4F2",
"name": "*1",
"function": null,
"reference": true,
"activityValue": null
},
"allele2": {
"gene": "CYP4F2",
"name": "*1",
"function": null,
"reference": true,
"activityValue": null
},
"gene": "CYP4F2",
"matchScore": 40,
"phenotypes": [],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
},
{
"allele1": {
"gene": "VKORC1",
"name": "rs9923231 reference (C)",
"function": "Normal coumarin sensitivity",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "VKORC1",
"name": "rs9923231 reference (C)",
"function": "Normal coumarin sensitivity",
"reference": true,
"activityValue": "n/a"
},
"gene": "VKORC1",
"matchScore": 2,
"phenotypes": [
"-1639 GG"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"-1639 GG"
],
"label": "rs9923231 reference (C)/rs9923231 reference (C)",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"rs9923231 reference (C)": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [
"rs12777823:G/G"
],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {},
"lookupKey": []
}
]
}
]
}
},
"DPWG Guideline Annotation": {
"abacavir": {
"name": "abacavir",
"id": "PA448004",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104991"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
}
],
"guidelines": [
{
"id": "PA166104991",
"name": "Annotation of DPWG Guideline for abacavir and HLA-B",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104991",
"annotations": []
}
]
},
"acenocoumarol": {
"name": "acenocoumarol",
"id": "PA452632",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104938"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
}
],
"guidelines": [
{
"id": "PA166104938",
"name": "Annotation of DPWG Guideline for acenocoumarol and VKORC1",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104938",
"annotations": [
{
"implications": [
"The guideline does not provide a description of the impact of the -1639 GG genotype on acenocoumarol."
],
"drugRecommendation": "The guideline does not provide a recommendation for acenocoumarol in patients with the VKORC1 rs9923231 CC genotype (-1639 GG genotype).",
"classification": "No recommendation",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "VKORC1",
"name": "rs9923231 reference (C)",
"function": "Normal coumarin sensitivity",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "VKORC1",
"name": "rs9923231 reference (C)",
"function": "Normal coumarin sensitivity",
"reference": true,
"activityValue": "n/a"
},
"gene": "VKORC1",
"matchScore": 2,
"phenotypes": [
"-1639 GG"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"-1639 GG"
],
"label": "rs9923231 reference (C)/rs9923231 reference (C)",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"rs9923231 reference (C)": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"VKORC1": "-1639 GG"
},
"lookupKey": [
{
"VKORC1": {
"rs9923231 reference (C)": 2.0
}
}
]
}
]
}
]
},
"allopurinol": {
"name": "allopurinol",
"id": "PA448320",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166264961",
"https://www.clinpgx.org/guidelineAnnotation/PA166265141"
],
"citations": [
{
"pmid": "36056234",
"title": "Dutch pharmacogenetics working group guideline for the gene-drug interaction of ABCG2, HLA-B and Allopurinol, and MTHFR, folic acid and methotrexate.",
"journal": "European journal of human genetics : EJHG",
"year": 2024,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10853275"
}
],
"guidelines": [
{
"id": "PA166264961",
"name": "Annotation of DPWG Guideline for allopurinol and ABCG2",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166264961",
"annotations": [
{
"implications": [
"The guideline does not provide a description of the impact of the ABCG2 rs2231142 GG genotype (c.421CC; p.141QQ) on allopurinol."
],
"drugRecommendation": "The guideline does not provide a recommendation for allopurinol in patients with the the ABCG2 rs2231142 GG genotype (c.421CC; p.141QQ)",
"classification": "No recommendation",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "ABCG2",
"name": "rs2231142 reference (G)",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "ABCG2",
"name": "rs2231142 reference (G)",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "ABCG2",
"matchScore": 2,
"phenotypes": [
"Normal Function"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Function"
],
"label": "rs2231142 reference (G)/rs2231142 reference (G)",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"rs2231142 reference (G)": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"ABCG2": "Normal Function"
},
"lookupKey": [
{
"ABCG2": "Normal Function"
}
]
}
]
},
{
"id": "PA166265141",
"name": "Annotation of DPWG Guideline for allopurinol and HLA-B",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166265141",
"annotations": []
}
]
},
"amitriptyline": {
"name": "amitriptyline",
"id": "PA448385",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104982"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
},
{
"pmid": "41526670",
"title": "Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction between CYP2D6 and CYP2C19 and tricyclic antidepressants.",
"journal": "European journal of human genetics : EJHG",
"year": 2026,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/41526670"
}
],
"guidelines": [
{
"id": "PA166104982",
"name": "Annotation of DPWG Guideline for amitriptyline and CYP2D6",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104982",
"annotations": []
}
]
},
"aripiprazole": {
"name": "aripiprazole",
"id": "PA10026",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104937"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
},
{
"pmid": "37002327",
"title": "Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction between CYP2D6, CYP3A4 and CYP1A2 and antipsychotics.",
"journal": "European journal of human genetics : EJHG",
"year": 2024,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10923774"
}
],
"guidelines": [
{
"id": "PA166104937",
"name": "Annotation of DPWG Guideline for aripiprazole and CYP2D6",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104937",
"annotations": []
}
]
},
"atazanavir": {
"name": "atazanavir",
"id": "PA10251",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166411701"
],
"citations": [],
"guidelines": [
{
"id": "PA166411701",
"name": "Annotation of DPWG Guideline for atazanavir and UGT1A1",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166411701",
"annotations": [
{
"implications": [
"The guideline does not provide a description of the impact of a normal metabolizer phenotype on atazanavir."
],
"drugRecommendation": "The guideline does not provide a recommendation for atazanavir in normal metabolizers",
"classification": "No recommendation",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "UGT1A1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "UGT1A1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "UGT1A1",
"matchScore": 8,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"UGT1A1": "Normal Metabolizer"
},
"lookupKey": [
{
"UGT1A1": "Normal Metabolizer"
}
]
}
]
}
]
},
"atomoxetine": {
"name": "atomoxetine",
"id": "PA134688071",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104989"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
},
{
"pmid": "36509836",
"title": "Dutch pharmacogenetics working group (DPWG) guideline for the gene-drug interaction of CYP2D6 and COMT with atomoxetine and methylphenidate.",
"journal": "European journal of human genetics : EJHG",
"year": 2023,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10689464"
}
],
"guidelines": [
{
"id": "PA166104989",
"name": "Annotation of DPWG Guideline for atomoxetine and CYP2D6",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104989",
"annotations": []
}
]
},
"atorvastatin": {
"name": "atorvastatin",
"id": "PA448500",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "SLCO1B1-drug text",
"version": "1",
"matches": {
"gene": "SLCO1B1",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"simvastatin",
"rosuvastatin",
"pravastatin",
"pitavastatin",
"lovastatin",
"fluvastatin",
"atorvastatin"
]
},
"exception_type": "note",
"message": "The SLCO1B1 genotype (star nomenclature) will be displayed if determinable with the provided VCF based on the SLCO1B1 star allele definition published by CPIC and recommendations are provided based on the genotype.
In case no genotype can be determined, recommendations are based on the rs4149056 genotype alone as per guideline. The minor C allele at rs4149056 defines SLCO1B1*5."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166182843"
],
"citations": [
{
"pmid": "39676086",
"title": "Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction between SLCO1B1 and statins and CYP2C9 and sulfonylureas.",
"journal": "European journal of human genetics : EJHG",
"year": 2024,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/39676086"
}
],
"guidelines": [
{
"id": "PA166182843",
"name": "Annotation of DPWG Guideline for atorvastatin and SLCO1B1",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166182843",
"annotations": [
{
"implications": [
"The guideline does not provide a description of the impact of the normal function phenotype on atorvastatin."
],
"drugRecommendation": "The guideline does not provide a recommendation for atorvastatin in patients with normal function.",
"classification": "No recommendation",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "SLCO1B1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "SLCO1B1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "SLCO1B1",
"matchScore": 70,
"phenotypes": [
"Normal Function"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Function"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"SLCO1B1": "Normal Function"
},
"lookupKey": [
{
"SLCO1B1": "Normal Function"
}
]
}
]
}
]
},
"azathioprine": {
"name": "azathioprine",
"id": "PA448515",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166184614",
"https://www.clinpgx.org/guidelineAnnotation/PA166104934"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
},
{
"pmid": "41318725",
"title": "Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction between TPMT/NUDT15 and thiopurines.",
"journal": "European journal of human genetics : EJHG",
"year": 2025,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/41318725"
}
],
"guidelines": [
{
"id": "PA166184614",
"name": "Annotation of DPWG Guideline for azathioprine and NUDT15",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166184614",
"annotations": [
{
"implications": [
"The guideline does not provide a description of the impact of a normal metabolizer phenotype on azathioprine."
],
"drugRecommendation": "The guideline does not provide a recommendation for azathioprine in normal metabolizers",
"classification": "No recommendation",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "NUDT15",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "NUDT15",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "NUDT15",
"matchScore": 36,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"NUDT15": "Normal Metabolizer"
},
"lookupKey": [
{
"NUDT15": "Normal Metabolizer"
}
]
}
]
},
{
"id": "PA166104934",
"name": "Annotation of DPWG Guideline for azathioprine and TPMT",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104934",
"annotations": [
{
"implications": [
"The guideline does not provide a description of the impact of a normal metabolizer phenotype on azathioprine."
],
"drugRecommendation": "The guideline does not provide a recommendation for azathioprine in normal metabolizers.",
"classification": "No recommendation",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "TPMT",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "TPMT",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "TPMT",
"matchScore": 90,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"TPMT": "Normal Metabolizer"
},
"lookupKey": [
{
"TPMT": "Normal Metabolizer"
}
]
}
]
}
]
},
"brexpiprazole": {
"name": "brexpiprazole",
"id": "PA166160053",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166184527"
],
"citations": [
{
"pmid": "37002327",
"title": "Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction between CYP2D6, CYP3A4 and CYP1A2 and antipsychotics.",
"journal": "European journal of human genetics : EJHG",
"year": 2024,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10923774"
}
],
"guidelines": [
{
"id": "PA166184527",
"name": "Annotation of DPWG Guideline for brexpiprazole and CYP2D6",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166184527",
"annotations": []
}
]
},
"capecitabine": {
"name": "capecitabine",
"id": "PA448771",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104963"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
},
{
"pmid": "31745289",
"title": "Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction of DPYD and fluoropyrimidines.",
"journal": "European journal of human genetics : EJHG",
"year": 2020,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7080718"
}
],
"guidelines": [
{
"id": "PA166104963",
"name": "Annotation of DPWG Guideline for capecitabine and DPYD",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104963",
"annotations": [
{
"implications": [
"The guideline does not provide a description of the impact of a DPYD activity score of 2 on capecitabine."
],
"drugRecommendation": "The guideline does not provide a recommendation for capecitabine in patients with a DPYD activity score of 2.",
"classification": "No recommendation",
"activityScore": {
"DPYD": "2.0"
},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "DPYD",
"matchScore": 0,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": [
{
"allele1": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "DPYD",
"matchScore": 166,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
],
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"DPYD": "Normal Metabolizer"
},
"lookupKey": [
{
"DPYD": "2.0"
}
]
}
]
}
]
},
"carbamazepine": {
"name": "carbamazepine",
"id": "PA448785",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166265161",
"https://www.clinpgx.org/guidelineAnnotation/PA166265162"
],
"citations": [
{
"pmid": "38570725",
"title": "Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction of CYP2C9, HLA-A and HLA-B with anti-epileptic drugs.",
"journal": "European journal of human genetics : EJHG",
"year": 2024,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC11291682"
}
],
"guidelines": [
{
"id": "PA166265161",
"name": "Annotation of DPWG Guideline for carbamazepine and HLA-A",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166265161",
"annotations": []
},
{
"id": "PA166265162",
"name": "Annotation of DPWG Guideline for carbamazepine and HLA-B",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166265162",
"annotations": []
}
]
},
"citalopram": {
"name": "citalopram",
"id": "PA449015",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104977"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
},
{
"pmid": "34782755",
"title": "Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction between CYP2C19 and CYP2D6 and SSRIs.",
"journal": "European journal of human genetics : EJHG",
"year": 2022,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9553948"
}
],
"guidelines": [
{
"id": "PA166104977",
"name": "Annotation of DPWG Guideline for citalopram and CYP2C19",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104977",
"annotations": [
{
"implications": [
"The risk of QT prolongation and therefore also the theoretical risk of torsades de pointes is increased as the gene variation leads to an increased citalopram plasma concentration. If you follow the dose recommendation below, the increased plasma concentration and the increased risk of QT prolongation will be offset."
],
"drugRecommendation": "Do not exceed the following daily doses (50% of the standard maximum dose):\n\n- adults up to 65 years: 20mg as tablets or 16mg as drops,
\n- Adults 65 years or older: 10mg as tablets or 8mg as drops
\n
",
"classification": "Unspecified",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 6,
"phenotypes": [
"Poor Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Poor Metabolizer"
],
"label": "*2/*2",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*2": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Poor Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Poor Metabolizer"
}
]
}
]
}
]
},
"clomipramine": {
"name": "clomipramine",
"id": "PA449048",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166184528",
"https://www.clinpgx.org/guidelineAnnotation/PA166104964"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
},
{
"pmid": "41526670",
"title": "Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction between CYP2D6 and CYP2C19 and tricyclic antidepressants.",
"journal": "European journal of human genetics : EJHG",
"year": 2026,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/41526670"
}
],
"guidelines": [
{
"id": "PA166184528",
"name": "Annotation of DPWG Guideline for clomipramine and CYP2C19",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166184528",
"annotations": [
{
"implications": [
"The gene variation increases the plasma concentration of clomipramine. However, there is insufficient evidence to substantiate an increase of the plasma concentration of clomipramine+desmethylclomipramine to such an extent that it increases the risk of side effects. The increase in the plasma concentration of clomipramine is favourable for the efficacy in anxiety and obsessive compulsive disorder."
],
"drugRecommendation": "NO action is required for this gene-drug interaction.",
"classification": "Unspecified",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 6,
"phenotypes": [
"Poor Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Poor Metabolizer"
],
"label": "*2/*2",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*2": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Poor Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Poor Metabolizer"
}
]
}
]
},
{
"id": "PA166104964",
"name": "Annotation of DPWG Guideline for clomipramine and CYP2D6",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104964",
"annotations": []
}
]
},
"clopidogrel": {
"name": "clopidogrel",
"id": "PA449053",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104956"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
}
],
"guidelines": [
{
"id": "PA166104956",
"name": "Annotation of DPWG Guideline for clopidogrel and CYP2C19",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104956",
"annotations": [
{
"implications": [
"The risk of serious cardiovascular and cerebrovascular events is increased in patients undergoing balloon angioplasty or stent placement (percutaneous coronary intervention) and in patients with a stroke or TIA, because the genetic variation reduces the activation of clopidogrel. No negative clinical consequences have been proved in other patients."
],
"drugRecommendation": "PERCUTANEOUS CORONARY INTERVENTION, STROKE or TIA: avoid clopidogrel. Prasugrel, ticagrelor and acetylsalicylic acid/dipyridamole are not metabolised by CYP2C19 (or to a lesser extent).\nOTHER INDICATIONS: determine the level of inhibition of platelet aggregation by clopidogrel. Consider an alternative in poor responders. Prasugrel and ticagrelor are not metabolised by CYP2C19 (or to a lesser extent).",
"classification": "Unspecified",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 6,
"phenotypes": [
"Poor Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Poor Metabolizer"
],
"label": "*2/*2",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*2": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": true,
"otherPrescribingGuidance": true,
"phenotypes": {
"CYP2C19": "Poor Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Poor Metabolizer"
}
]
}
]
}
]
},
"codeine": {
"name": "codeine",
"id": "PA449088",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104970"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
},
{
"pmid": "34267337",
"title": "Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction between CYP2D6 and opioids (codeine, tramadol and oxycodone).",
"journal": "European journal of human genetics : EJHG",
"year": 2022,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9553935"
}
],
"guidelines": [
{
"id": "PA166104970",
"name": "Annotation of DPWG Guideline for codeine and CYP2D6",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104970",
"annotations": []
}
]
},
"doxepin": {
"name": "doxepin",
"id": "PA449409",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104994"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
},
{
"pmid": "41526670",
"title": "Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction between CYP2D6 and CYP2C19 and tricyclic antidepressants.",
"journal": "European journal of human genetics : EJHG",
"year": 2026,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/41526670"
}
],
"guidelines": [
{
"id": "PA166104994",
"name": "Annotation of DPWG Guideline for doxepin and CYP2D6",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104994",
"annotations": []
}
]
},
"efavirenz": {
"name": "efavirenz",
"id": "PA449441",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "CYP2B6 *1/*6 warning",
"version": "1",
"matches": {
"gene": "CYP2B6",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [
"*1/*6"
],
"drugs": [
"efavirenz"
]
},
"exception_type": "ambiguity",
"message": "The assigned genotype is *1/*6; however, *4/*9 cannot be ruled out without phased data."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166182846"
],
"citations": [],
"guidelines": [
{
"id": "PA166182846",
"name": "Annotation of DPWG Guideline for efavirenz and CYP2B6",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166182846",
"annotations": [
{
"implications": [
"Genetic variations increase the efavirenz plasma concentration and therefore the risk of side effects. However, the efavirenz plasma concentration remains within the therapeutic range for the majority of patients."
],
"drugRecommendation": "Determine the efavirenz plasma concentration if side effects occur and reduce the dose if needed. In 14 IM adults, a dose reduction to 400 mg/day (2/3rd of the standard dose) was sufficient to achieve therapeutic plasma concentrations and to reduce or resolve side effects. The therapeutic range established for efavirenz is 1000-4000 ng/ml.",
"classification": "Unspecified",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2B6",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2B6",
"name": "*6",
"function": "Decreased function",
"reference": false,
"activityValue": "n/a"
},
"gene": "CYP2B6",
"matchScore": 50,
"phenotypes": [
"Intermediate Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Intermediate Metabolizer"
],
"label": "*1/*6",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 1.0,
"*6": 1.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2B6": "Intermediate Metabolizer"
},
"lookupKey": [
{
"CYP2B6": "Intermediate Metabolizer"
}
]
}
]
}
]
},
"eliglustat": {
"name": "eliglustat",
"id": "PA166123486",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166182823"
],
"citations": [],
"guidelines": [
{
"id": "PA166182823",
"name": "Annotation of DPWG Guideline for eliglustat and CYP2D6",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166182823",
"annotations": []
}
]
},
"escitalopram": {
"name": "escitalopram",
"id": "PA10074",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104975"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
},
{
"pmid": "34782755",
"title": "Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction between CYP2C19 and CYP2D6 and SSRIs.",
"journal": "European journal of human genetics : EJHG",
"year": 2022,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9553948"
}
],
"guidelines": [
{
"id": "PA166104975",
"name": "Annotation of DPWG Guideline for escitalopram and CYP2C19",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104975",
"annotations": [
{
"implications": [
"The risk of switching to another antidepressant is increased. In addition, the risk of QT prolongation and torsades de pointes is theoretically increased because the gene variation leads to an increased escitalopram plasma concentration. If you follow the dose recommendation below, the increased plasma concentration, the theoretically increased risk of QT prolongation and the increased risk of switching to another antidepressant will be offset."
],
"drugRecommendation": "Do not exceed the following doses (50% of the standard maximum dose): adults < 65 years 10 mg/day, =65 years 5 mg/day",
"classification": "Unspecified",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 6,
"phenotypes": [
"Poor Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Poor Metabolizer"
],
"label": "*2/*2",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*2": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Poor Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Poor Metabolizer"
}
]
}
]
}
]
},
"flecainide": {
"name": "flecainide",
"id": "PA449646",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104969"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
}
],
"guidelines": [
{
"id": "PA166104969",
"name": "Annotation of DPWG Guideline for flecainide and CYP2D6",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104969",
"annotations": []
}
]
},
"flucloxacillin": {
"name": "flucloxacillin",
"id": "PA164781042",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166182810"
],
"citations": [],
"guidelines": [
{
"id": "PA166182810",
"name": "Annotation of DPWG Guideline for flucloxacillin and HLA-B",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166182810",
"annotations": []
}
]
},
"flucytosine": {
"name": "flucytosine",
"id": "PA449654",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166222801"
],
"citations": [],
"guidelines": [
{
"id": "PA166222801",
"name": "Annotation of DPWG Guideline for flucytosine and DPYD",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166222801",
"annotations": [
{
"implications": [
"The guideline does not provide a description of the impact of a DPYD activity score of 2 on flucytosine."
],
"drugRecommendation": "The guideline does not provide a recommendation for flucytosine in patients with a DPYD activity score of 2.",
"classification": "No recommendation",
"activityScore": {
"DPYD": "2.0"
},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "DPYD",
"matchScore": 0,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": [
{
"allele1": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "DPYD",
"matchScore": 166,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
],
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"DPYD": "Normal Metabolizer"
},
"lookupKey": [
{
"DPYD": "2.0"
}
]
}
]
}
]
},
"fluorouracil": {
"name": "fluorouracil",
"id": "PA128406956",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104939"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
},
{
"pmid": "31745289",
"title": "Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction of DPYD and fluoropyrimidines.",
"journal": "European journal of human genetics : EJHG",
"year": 2020,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7080718"
}
],
"guidelines": [
{
"id": "PA166104939",
"name": "Annotation of DPWG Guideline for fluorouracil and DPYD",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104939",
"annotations": [
{
"implications": [
"The guideline does not provide a description of the impact of a DPYD activity score of 2 on fluorouracil."
],
"drugRecommendation": "The guideline does not provide a recommendation for fluorouracil in patients with a DPYD activity score of 2.",
"classification": "No recommendation",
"activityScore": {
"DPYD": "2.0"
},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "DPYD",
"matchScore": 0,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": [
{
"allele1": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "DPYD",
"matchScore": 166,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
],
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"DPYD": "Normal Metabolizer"
},
"lookupKey": [
{
"DPYD": "2.0"
}
]
}
]
}
]
},
"haloperidol": {
"name": "haloperidol",
"id": "PA449841",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104988"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
},
{
"pmid": "37002327",
"title": "Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction between CYP2D6, CYP3A4 and CYP1A2 and antipsychotics.",
"journal": "European journal of human genetics : EJHG",
"year": 2024,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10923774"
}
],
"guidelines": [
{
"id": "PA166104988",
"name": "Annotation of DPWG Guideline for haloperidol and CYP2D6",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104988",
"annotations": []
}
]
},
"imipramine": {
"name": "imipramine",
"id": "PA449969",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104954",
"https://www.clinpgx.org/guidelineAnnotation/PA166104972"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
},
{
"pmid": "41526670",
"title": "Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction between CYP2D6 and CYP2C19 and tricyclic antidepressants.",
"journal": "European journal of human genetics : EJHG",
"year": 2026,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/41526670"
}
],
"guidelines": [
{
"id": "PA166104954",
"name": "Annotation of DPWG Guideline for imipramine and CYP2C19",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104954",
"annotations": [
{
"implications": [
"The risk of side effects is increased. The gene variation results in an increase in the plasma concentration of imipramine+desipramine."
],
"drugRecommendation": "Use 70% of the standard dose and monitor the effect and side effects or the imipramine and desipramine plasma concentrations to determine the maintenance dose, or, avoid imipramine. Antidepressants that are not or to a lesser extent metabolised by CYP2C19 include, for example, nortriptyline, fluvoxamine and mirtazapine.",
"classification": "Unspecified",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 6,
"phenotypes": [
"Poor Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Poor Metabolizer"
],
"label": "*2/*2",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*2": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": true,
"otherPrescribingGuidance": true,
"phenotypes": {
"CYP2C19": "Poor Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Poor Metabolizer"
}
]
}
]
},
{
"id": "PA166104972",
"name": "Annotation of DPWG Guideline for imipramine and CYP2D6",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104972",
"annotations": []
}
]
},
"irinotecan": {
"name": "irinotecan",
"id": "PA450085",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104951"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
},
{
"pmid": "36443464",
"title": "Dutch pharmacogenetics working group (DPWG) guideline for the gene-drug interaction between UGT1A1 and irinotecan.",
"journal": "European journal of human genetics : EJHG",
"year": 2023,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10474017"
}
],
"guidelines": [
{
"id": "PA166104951",
"name": "Annotation of DPWG Guideline for irinotecan and UGT1A1",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104951",
"annotations": [
{
"implications": [
"The guideline does not provide a description of the impact of a normal metabolizer phenotype on irinotecan."
],
"drugRecommendation": "The guideline does not provide a recommendation for irinotecan in normal metabolizers",
"classification": "No recommendation",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "UGT1A1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "UGT1A1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "UGT1A1",
"matchScore": 8,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"UGT1A1": "Normal Metabolizer"
},
"lookupKey": [
{
"UGT1A1": "Normal Metabolizer"
}
]
}
]
}
]
},
"lamotrigine": {
"name": "lamotrigine",
"id": "PA450164",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166265341"
],
"citations": [
{
"pmid": "38570725",
"title": "Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction of CYP2C9, HLA-A and HLA-B with anti-epileptic drugs.",
"journal": "European journal of human genetics : EJHG",
"year": 2024,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC11291682"
}
],
"guidelines": [
{
"id": "PA166265341",
"name": "Annotation of DPWG Guideline for lamotrigine and HLA-B",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166265341",
"annotations": []
}
]
},
"lansoprazole": {
"name": "lansoprazole",
"id": "PA450180",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104987"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
}
],
"guidelines": [
{
"id": "PA166104987",
"name": "Annotation of DPWG Guideline for lansoprazole and CYP2C19",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104987",
"annotations": [
{
"implications": [
"The higher plasma concentration of lansoprazole results in an increase in the therapeutic effectiveness, without an increase in the incidence of side effects."
],
"drugRecommendation": "NO action is needed for this gene-drug interaction.",
"classification": "Unspecified",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 6,
"phenotypes": [
"Poor Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Poor Metabolizer"
],
"label": "*2/*2",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*2": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Poor Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Poor Metabolizer"
}
]
}
]
}
]
},
"mavacamten": {
"name": "mavacamten",
"id": "PA166272922",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166418081"
],
"citations": [],
"guidelines": [
{
"id": "PA166418081",
"name": "Annotation of DPWG Guideline for mavacamten and CYP2C19",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166418081",
"annotations": [
{
"implications": [
"The risk of serious side effects, such as heart failure (decrease in left ventricular ejection fraction (LVEF)), may be increased. The gene variation can lead to a three times higher exposure to mavacamten."
],
"drugRecommendation": "\n- NO CYP3A4 inhibitor as comedication:\n
\n- start with 2.5 mg/day and give a maximum of 5 mg/day\n(This corresponds to half the normal starting dose and one third of the normal maximum dose.)
\n
\n \n- MODERATE or WEAK CYP3A4 inhibitor as comedication:\n
\n- give a maximum of 2.5 mg/day\n(This corresponds to half the normal starting dose and one-sixth of the normal maximum dose when using a moderate or weak CYP3A4 inhibitor).
\n
\n \n- STRONG CYP3A4 inhibitor as comedication:\n
\n- Mavacamten is contraindicated.
\n- avoid mavacamten
\n
\n \n
",
"classification": "Unspecified",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 6,
"phenotypes": [
"Poor Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Poor Metabolizer"
],
"label": "*2/*2",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*2": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": true,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Poor Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Poor Metabolizer"
}
]
}
]
}
]
},
"mercaptopurine": {
"name": "mercaptopurine",
"id": "PA450379",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166184613",
"https://www.clinpgx.org/guidelineAnnotation/PA166104952"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
},
{
"pmid": "41318725",
"title": "Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction between TPMT/NUDT15 and thiopurines.",
"journal": "European journal of human genetics : EJHG",
"year": 2025,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/41318725"
}
],
"guidelines": [
{
"id": "PA166184613",
"name": "Annotation of DPWG Guideline for mercaptopurine and NUDT15",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166184613",
"annotations": [
{
"implications": [
"The guideline does not provide a description of the impact of a normal metabolizer phenotype on mercaptopurine."
],
"drugRecommendation": "The guideline does not provide a recommendation for mercaptopurine in normal metabolizers",
"classification": "No recommendation",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "NUDT15",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "NUDT15",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "NUDT15",
"matchScore": 36,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"NUDT15": "Normal Metabolizer"
},
"lookupKey": [
{
"NUDT15": "Normal Metabolizer"
}
]
}
]
},
{
"id": "PA166104952",
"name": "Annotation of DPWG Guideline for mercaptopurine and TPMT",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104952",
"annotations": [
{
"implications": [
"The guideline does not provide a description of the impact of a normal metabolizer phenotype on mercaptopurine."
],
"drugRecommendation": "The guideline does not provide a recommendation for mercaptopurine in normal metabolizers.",
"classification": "No recommendation",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "TPMT",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "TPMT",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "TPMT",
"matchScore": 90,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"TPMT": "Normal Metabolizer"
},
"lookupKey": [
{
"TPMT": "Normal Metabolizer"
}
]
}
]
}
]
},
"metoprolol": {
"name": "metoprolol",
"id": "PA450480",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104995"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
}
],
"guidelines": [
{
"id": "PA166104995",
"name": "Annotation of DPWG Guideline for metoprolol and CYP2D6",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104995",
"annotations": []
}
]
},
"nortriptyline": {
"name": "nortriptyline",
"id": "PA450657",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104961"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
}
],
"guidelines": [
{
"id": "PA166104961",
"name": "Annotation of DPWG Guideline for nortriptyline and CYP2D6",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104961",
"annotations": []
}
]
},
"omeprazole": {
"name": "omeprazole",
"id": "PA450704",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104957"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
}
],
"guidelines": [
{
"id": "PA166104957",
"name": "Annotation of DPWG Guideline for omeprazole and CYP2C19",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104957",
"annotations": [
{
"implications": [
"The higher plasma concentration of omeprazole results in an increase in the therapeutic effectiveness, without an increase in the side effects."
],
"drugRecommendation": "NO action is required for this gene-drug interaction.",
"classification": "Unspecified",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 6,
"phenotypes": [
"Poor Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Poor Metabolizer"
],
"label": "*2/*2",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*2": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Poor Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Poor Metabolizer"
}
]
}
]
}
]
},
"oxcarbazepine": {
"name": "oxcarbazepine",
"id": "PA450732",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166265201"
],
"citations": [
{
"pmid": "38570725",
"title": "Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction of CYP2C9, HLA-A and HLA-B with anti-epileptic drugs.",
"journal": "European journal of human genetics : EJHG",
"year": 2024,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC11291682"
}
],
"guidelines": [
{
"id": "PA166265201",
"name": "Annotation of DPWG Guideline for oxcarbazepine and HLA-B",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166265201",
"annotations": []
}
]
},
"pantoprazole": {
"name": "pantoprazole",
"id": "PA450774",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104958"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
}
],
"guidelines": [
{
"id": "PA166104958",
"name": "Annotation of DPWG Guideline for pantoprazole and CYP2C19",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104958",
"annotations": [
{
"implications": [
"The higher plasma concentration of pantoprazole results in an increase in the therapeutic effectiveness, without an increase in the side effects."
],
"drugRecommendation": "NO action is required for this gene-drug interaction.",
"classification": "Unspecified",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 6,
"phenotypes": [
"Poor Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Poor Metabolizer"
],
"label": "*2/*2",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*2": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Poor Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Poor Metabolizer"
}
]
}
]
}
]
},
"paroxetine": {
"name": "paroxetine",
"id": "PA450801",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104976"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
},
{
"pmid": "34782755",
"title": "Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction between CYP2C19 and CYP2D6 and SSRIs.",
"journal": "European journal of human genetics : EJHG",
"year": 2022,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9553948"
}
],
"guidelines": [
{
"id": "PA166104976",
"name": "Annotation of DPWG Guideline for paroxetine and CYP2D6",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104976",
"annotations": []
}
]
},
"phenprocoumon": {
"name": "phenprocoumon",
"id": "PA450921",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104940"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
}
],
"guidelines": [
{
"id": "PA166104940",
"name": "Annotation of DPWG Guideline for phenprocoumon and VKORC1",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104940",
"annotations": [
{
"implications": [
"The guideline does not provide a description of the impact of the VKORC1 rs9923231 CC genotype (-1639 GG genotype) on phenprocoumon."
],
"drugRecommendation": "The guideline does not provide a recommendation for phenprocoumon in patients with the VKORC1 rs9923231 CC genotype (-1639 GG genotype).",
"classification": "No recommendation",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "VKORC1",
"name": "rs9923231 reference (C)",
"function": "Normal coumarin sensitivity",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "VKORC1",
"name": "rs9923231 reference (C)",
"function": "Normal coumarin sensitivity",
"reference": true,
"activityValue": "n/a"
},
"gene": "VKORC1",
"matchScore": 2,
"phenotypes": [
"-1639 GG"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"-1639 GG"
],
"label": "rs9923231 reference (C)/rs9923231 reference (C)",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"rs9923231 reference (C)": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"VKORC1": "-1639 GG"
},
"lookupKey": [
{
"VKORC1": {
"rs9923231 reference (C)": 2.0
}
}
]
}
]
}
]
},
"phenytoin": {
"name": "phenytoin",
"id": "PA450947",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "Phenytoin_HLA-B warning",
"version": "1",
"matches": {
"gene": null,
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"phenytoin",
"fosphenytoin"
]
},
"exception_type": "note",
"message": "The displayed recommendation for CYP2C9 and phenytoin is ONLY valid for non-carriers of the HLA-B*15:02 high-risk allele. PharmCAT Named Allele Matcher does not determine HLA status. CPIC guidance: Fos-/Phenytoin is contraindicated in individuals with the HLA-B*15:02 variant allele (\"HLA-B*15:02-positive\") due to significantly increased risk of fos-/phenytoin-induced cutaneous adverse reactions of Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN). In HLA-B*15:02 carriers, carbamazepine should not be used as an alternative. Alternative medications such as oxcarbazepine, eslicarbazepine acetate, and lamotrigine have some evidence linking SJS/TEN with the HLA-B*15:02 allele, and thus caution should be used in choosing alternatives to phenytoin."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104984",
"https://www.clinpgx.org/guidelineAnnotation/PA166264881"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
},
{
"pmid": "38570725",
"title": "Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction of CYP2C9, HLA-A and HLA-B with anti-epileptic drugs.",
"journal": "European journal of human genetics : EJHG",
"year": 2024,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC11291682"
}
],
"guidelines": [
{
"id": "PA166104984",
"name": "Annotation of DPWG Guideline for phenytoin and CYP2C9",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104984",
"annotations": [
{
"implications": [
"The guideline does not provide a description of the impact of a normal metabolizer phenotype on phenytoin."
],
"drugRecommendation": "The guideline does not provide a recommendation for phenytoin in normal metabolizers.",
"classification": "No recommendation",
"activityScore": {
"CYP2C9": "2.0"
},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "CYP2C9",
"matchScore": 166,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C9": "Normal Metabolizer"
},
"lookupKey": [
{
"CYP2C9": "2.0"
}
]
}
]
},
{
"id": "PA166264881",
"name": "Annotation of DPWG Guideline for phenytoin and HLA-B",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166264881",
"annotations": []
}
]
},
"pimozide": {
"name": "pimozide",
"id": "PA450965",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166182819"
],
"citations": [
{
"pmid": "37002327",
"title": "Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction between CYP2D6, CYP3A4 and CYP1A2 and antipsychotics.",
"journal": "European journal of human genetics : EJHG",
"year": 2024,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10923774"
}
],
"guidelines": [
{
"id": "PA166182819",
"name": "Annotation of DPWG Guideline for pimozide and CYP2D6",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166182819",
"annotations": []
}
]
},
"propafenone": {
"name": "propafenone",
"id": "PA451131",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104962"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
}
],
"guidelines": [
{
"id": "PA166104962",
"name": "Annotation of DPWG Guideline for propafenone and CYP2D6",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104962",
"annotations": []
}
]
},
"quetiapine": {
"name": "quetiapine",
"id": "PA451201",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "CYP3A4",
"version": "2",
"matches": {
"gene": "CYP3A4",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"quetiapine"
]
},
"exception_type": "note",
"message": "The CYP3A4 alleles are determined based on PharmVar CYP3A4 allele definitions. See PharmCAT disclaimer for further information."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166265421"
],
"citations": [
{
"pmid": "37002327",
"title": "Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction between CYP2D6, CYP3A4 and CYP1A2 and antipsychotics.",
"journal": "European journal of human genetics : EJHG",
"year": 2024,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10923774"
}
],
"guidelines": [
{
"id": "PA166265421",
"name": "Annotation of DPWG Guideline for quetiapine and CYP3A4",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166265421",
"annotations": [
{
"implications": [
"The guideline does not provide a description of the impact of a normal metabolizer phenotype on quetiapine."
],
"drugRecommendation": "The guideline does not provide a recommendation for quetiapine in normal metabolizers.",
"classification": "No recommendation",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP3A4",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP3A4",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP3A4",
"matchScore": 86,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP3A4": "Normal Metabolizer"
},
"lookupKey": [
{
"CYP3A4": "Normal Metabolizer"
}
]
}
]
}
]
},
"risperidone": {
"name": "risperidone",
"id": "PA451257",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104943"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
},
{
"pmid": "37002327",
"title": "Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction between CYP2D6, CYP3A4 and CYP1A2 and antipsychotics.",
"journal": "European journal of human genetics : EJHG",
"year": 2024,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10923774"
}
],
"guidelines": [
{
"id": "PA166104943",
"name": "Annotation of DPWG Guideline for risperidone and CYP2D6",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104943",
"annotations": []
}
]
},
"rosuvastatin": {
"name": "rosuvastatin",
"id": "PA134308647",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "SLCO1B1-drug text",
"version": "1",
"matches": {
"gene": "SLCO1B1",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"simvastatin",
"rosuvastatin",
"pravastatin",
"pitavastatin",
"lovastatin",
"fluvastatin",
"atorvastatin"
]
},
"exception_type": "note",
"message": "The SLCO1B1 genotype (star nomenclature) will be displayed if determinable with the provided VCF based on the SLCO1B1 star allele definition published by CPIC and recommendations are provided based on the genotype.
In case no genotype can be determined, recommendations are based on the rs4149056 genotype alone as per guideline. The minor C allele at rs4149056 defines SLCO1B1*5."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166363221"
],
"citations": [
{
"pmid": "39676086",
"title": "Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction between SLCO1B1 and statins and CYP2C9 and sulfonylureas.",
"journal": "European journal of human genetics : EJHG",
"year": 2024,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/39676086"
}
],
"guidelines": [
{
"id": "PA166363221",
"name": "Annotation of DPWG Guideline for rosuvastatin and SLCO1B1",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166363221",
"annotations": [
{
"implications": [
"The guideline does not provide a description of the impact of the normal function phenotype on rosuvastatin."
],
"drugRecommendation": "The guideline does not provide a recommendation for rosuvastatin in patients with normal function.",
"classification": "No recommendation",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "SLCO1B1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "SLCO1B1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "SLCO1B1",
"matchScore": 70,
"phenotypes": [
"Normal Function"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Function"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"SLCO1B1": "Normal Function"
},
"lookupKey": [
{
"SLCO1B1": "Normal Function"
}
]
}
]
}
]
},
"sertraline": {
"name": "sertraline",
"id": "PA451333",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104980"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
},
{
"pmid": "34782755",
"title": "Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction between CYP2C19 and CYP2D6 and SSRIs.",
"journal": "European journal of human genetics : EJHG",
"year": 2022,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9553948"
}
],
"guidelines": [
{
"id": "PA166104980",
"name": "Annotation of DPWG Guideline for sertraline and CYP2C19",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104980",
"annotations": [
{
"implications": [
"The risk of side effects is increased. The gene variation leads to increased plasma concentrations of sertraline."
],
"drugRecommendation": "Do not give doses exceeding 75 mg/day. Guide the dose by response and side effects and/or sertraline plasma concentration.",
"classification": "Unspecified",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 6,
"phenotypes": [
"Poor Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Poor Metabolizer"
],
"label": "*2/*2",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*2": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Poor Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Poor Metabolizer"
}
]
}
]
}
]
},
"simvastatin": {
"name": "simvastatin",
"id": "PA451363",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "SLCO1B1-drug text",
"version": "1",
"matches": {
"gene": "SLCO1B1",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"simvastatin",
"rosuvastatin",
"pravastatin",
"pitavastatin",
"lovastatin",
"fluvastatin",
"atorvastatin"
]
},
"exception_type": "note",
"message": "The SLCO1B1 genotype (star nomenclature) will be displayed if determinable with the provided VCF based on the SLCO1B1 star allele definition published by CPIC and recommendations are provided based on the genotype.
In case no genotype can be determined, recommendations are based on the rs4149056 genotype alone as per guideline. The minor C allele at rs4149056 defines SLCO1B1*5."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166182844"
],
"citations": [
{
"pmid": "39676086",
"title": "Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction between SLCO1B1 and statins and CYP2C9 and sulfonylureas.",
"journal": "European journal of human genetics : EJHG",
"year": 2024,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/39676086"
}
],
"guidelines": [
{
"id": "PA166182844",
"name": "Annotation of DPWG Guideline for simvastatin and SLCO1B1",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166182844",
"annotations": [
{
"implications": [
"The guideline does not provide a description of the impact of the normal function phenotype on simvastatin."
],
"drugRecommendation": "The guideline does not provide a recommendation for atorvastatin in patients with normal function.",
"classification": "No recommendation",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "SLCO1B1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "SLCO1B1",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "SLCO1B1",
"matchScore": 70,
"phenotypes": [
"Normal Function"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Function"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"SLCO1B1": "Normal Function"
},
"lookupKey": [
{
"SLCO1B1": "Normal Function"
}
]
}
]
}
]
},
"siponimod": {
"name": "siponimod",
"id": "PA166182736",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166211021"
],
"citations": [],
"guidelines": [
{
"id": "PA166211021",
"name": "Annotation of DPWG Guideline for siponimod and CYP2C9",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166211021",
"annotations": [
{
"implications": [
"The guideline does not provide a description of the impact of a normal metabolizer phenotype on siponimod."
],
"drugRecommendation": "The guideline does not provide a recommendation for siponimod in normal metabolizers.",
"classification": "No recommendation",
"activityScore": {
"CYP2C9": "2.0"
},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "CYP2C9",
"matchScore": 166,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C9": "Normal Metabolizer"
},
"lookupKey": [
{
"CYP2C9": "2.0"
}
]
}
]
}
]
},
"tacrolimus": {
"name": "tacrolimus",
"id": "PA451578",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104983"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
}
],
"guidelines": [
{
"id": "PA166104983",
"name": "Annotation of DPWG Guideline for tacrolimus and CYP3A5",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104983",
"annotations": [
{
"implications": [
"An increase of the initial dose can result in an increased chance of reaching a tacrolimus concentration within the target range before the start of therapeutic drug monitoring. However, there is no direct evidence that this results in improved clinical results. The genetic variation results in an increased conversion of tacrolimus to inactive metabolites and therefore a higher required dose."
],
"drugRecommendation": "LIVER TRANSPLANTATION\nIn addition to the patient’s genotype, the metabolism of tacrolimus is also determined by the genotype of the transplanted liver.\nLIVER is also of the genotype HOMOZYGOUS EXPRESSOR: Use 2.5 times the normal initial dose. Adjustment of the dose should then be based on therapeutic drug monitoring.\nLIVER has a DIFFERENT genotype: There is insufficient evidence in the literature to support a dose recommendation.\nOTHER TRANSPLANTATION\nUse 2.5 times the initial dose that would yield the desired result in non-expressers. Adjustment of the dose should then be based on therapeutic drug monitoring. For example: One Dutch study found a median trough concentration for tacrolimus after three days of 9.4 ng/mL at an initial dose of 0.15 mg/kg twice daily for 5 homozygous kidney transplant patients. Their target value was 10 - 15 ng/mL.",
"classification": "Unspecified",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP3A5",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP3A5",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP3A5",
"matchScore": 10,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP3A5": "Normal Metabolizer"
},
"lookupKey": [
{
"CYP3A5": "Normal Metabolizer"
}
]
}
]
}
]
},
"tamoxifen": {
"name": "tamoxifen",
"id": "PA451581",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104966"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
}
],
"guidelines": [
{
"id": "PA166104966",
"name": "Annotation of DPWG Guideline for tamoxifen and CYP2D6",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104966",
"annotations": []
}
]
},
"tegafur": {
"name": "tegafur",
"id": "PA452620",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104944"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
},
{
"pmid": "31745289",
"title": "Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction of DPYD and fluoropyrimidines.",
"journal": "European journal of human genetics : EJHG",
"year": 2020,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7080718"
}
],
"guidelines": [
{
"id": "PA166104944",
"name": "Annotation of DPWG Guideline for tegafur and DPYD",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104944",
"annotations": [
{
"implications": [
"The guideline does not provide a description of the impact of a DPYD activity score of 2 on tegafur."
],
"drugRecommendation": "The guideline does not provide a recommendation for tegafur in patients with a DPYD activity score of 2.",
"classification": "No recommendation",
"activityScore": {
"DPYD": "2.0"
},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "DPYD",
"matchScore": 0,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": [
{
"allele1": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "DPYD",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "DPYD",
"matchScore": 166,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
],
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"DPYD": "Normal Metabolizer"
},
"lookupKey": [
{
"DPYD": "2.0"
}
]
}
]
}
]
},
"thioguanine": {
"name": "thioguanine",
"id": "PA451663",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166184612",
"https://www.clinpgx.org/guidelineAnnotation/PA166104960"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
},
{
"pmid": "41318725",
"title": "Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction between TPMT/NUDT15 and thiopurines.",
"journal": "European journal of human genetics : EJHG",
"year": 2025,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/41318725"
}
],
"guidelines": [
{
"id": "PA166184612",
"name": "Annotation of DPWG Guideline for thioguanine and NUDT15",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166184612",
"annotations": [
{
"implications": [
"The guideline does not provide a description of the impact of a normal metabolizer phenotype on thioguanine."
],
"drugRecommendation": "The guideline does not provide a recommendation for thioguanine in normal metabolizers",
"classification": "No recommendation",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "NUDT15",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "NUDT15",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "NUDT15",
"matchScore": 36,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"NUDT15": "Normal Metabolizer"
},
"lookupKey": [
{
"NUDT15": "Normal Metabolizer"
}
]
}
]
},
{
"id": "PA166104960",
"name": "Annotation of DPWG Guideline for thioguanine and TPMT",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104960",
"annotations": [
{
"implications": [
"The guideline does not provide a description of the impact of a normal metabolizer phenotype on thioguanine."
],
"drugRecommendation": "The guideline does not provide a recommendation for thioguanine in normal metabolizers.",
"classification": "No recommendation",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "TPMT",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "TPMT",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "TPMT",
"matchScore": 90,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"TPMT": "Normal Metabolizer"
},
"lookupKey": [
{
"TPMT": "Normal Metabolizer"
}
]
}
]
}
]
},
"tramadol": {
"name": "tramadol",
"id": "PA451735",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104959"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
},
{
"pmid": "34267337",
"title": "Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction between CYP2D6 and opioids (codeine, tramadol and oxycodone).",
"journal": "European journal of human genetics : EJHG",
"year": 2022,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9553935"
}
],
"guidelines": [
{
"id": "PA166104959",
"name": "Annotation of DPWG Guideline for tramadol and CYP2D6",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104959",
"annotations": []
}
]
},
"venlafaxine": {
"name": "venlafaxine",
"id": "PA451866",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104968"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
},
{
"pmid": "38956296",
"title": "Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction between CYP2D6, CYP2C19 and non-SSRI/non-TCA antidepressants.",
"journal": "European journal of human genetics : EJHG",
"year": 2024,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/38956296"
}
],
"guidelines": [
{
"id": "PA166104968",
"name": "Annotation of DPWG Guideline for venlafaxine and CYP2D6",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104968",
"annotations": []
}
]
},
"voriconazole": {
"name": "voriconazole",
"id": "PA10233",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104990"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
}
],
"guidelines": [
{
"id": "PA166104990",
"name": "Annotation of DPWG Guideline for voriconazole and CYP2C19",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104990",
"annotations": [
{
"implications": [
"The gene variation can reduce the conversion of voriconazole and consequently increase the plasma concentration. This could result in improved efficacy or an increase in the risk of side effects. Initially, the risk of side effects is of particular interest."
],
"drugRecommendation": "Use 50% of the standard dose and monitor the plasma concentration.",
"classification": "Unspecified",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 6,
"phenotypes": [
"Poor Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Poor Metabolizer"
],
"label": "*2/*2",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*2": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Poor Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Poor Metabolizer"
}
]
}
]
}
]
},
"warfarin": {
"name": "warfarin",
"id": "PA451906",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166182842",
"https://www.clinpgx.org/guidelineAnnotation/PA166182841"
],
"citations": [],
"guidelines": [
{
"id": "PA166182842",
"name": "Annotation of DPWG Guideline for warfarin and CYP2C9",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166182842",
"annotations": [
{
"implications": [
"The guideline does not provide a description of the impact of a normal metabolizer phenotype on warfarin."
],
"drugRecommendation": "The guideline does not provide a recommendation for warfarin in normal metabolizers.",
"classification": "No recommendation",
"activityScore": {
"CYP2C9": "2.0"
},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "CYP2C9",
"matchScore": 166,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C9": "Normal Metabolizer"
},
"lookupKey": [
{
"CYP2C9": "2.0"
}
]
}
]
},
{
"id": "PA166182841",
"name": "Annotation of DPWG Guideline for warfarin and VKORC1",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166182841",
"annotations": [
{
"implications": [
"The guideline does not provide a description of the impact of the VKORC1 rs9923231 CC genotype (-1639 GG genotype) on warfarin."
],
"drugRecommendation": "The guideline does not provide a recommendation for warfarin in patients with the VKORC1 rs9923231 CC genotype (-1639 GG genotype).",
"classification": "No recommendation",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "VKORC1",
"name": "rs9923231 reference (C)",
"function": "Normal coumarin sensitivity",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "VKORC1",
"name": "rs9923231 reference (C)",
"function": "Normal coumarin sensitivity",
"reference": true,
"activityValue": "n/a"
},
"gene": "VKORC1",
"matchScore": 2,
"phenotypes": [
"-1639 GG"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"-1639 GG"
],
"label": "rs9923231 reference (C)/rs9923231 reference (C)",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"rs9923231 reference (C)": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"VKORC1": "-1639 GG"
},
"lookupKey": [
{
"VKORC1": {
"rs9923231 reference (C)": 2.0
}
}
]
}
]
}
]
},
"zuclopenthixol": {
"name": "zuclopenthixol",
"id": "PA452629",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/guidelineAnnotation/PA166104992"
],
"citations": [
{
"pmid": "21412232",
"title": "Pharmacogenetics: from bench to byte--an update of guidelines.",
"journal": "Clinical pharmacology and therapeutics",
"year": 2011,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pubmed/21412232"
},
{
"pmid": "37002327",
"title": "Dutch Pharmacogenetics Working Group (DPWG) guideline for the gene-drug interaction between CYP2D6, CYP3A4 and CYP1A2 and antipsychotics.",
"journal": "European journal of human genetics : EJHG",
"year": 2024,
"_sameAs": "https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10923774"
}
],
"guidelines": [
{
"id": "PA166104992",
"name": "Annotation of DPWG Guideline for zuclopenthixol and CYP2D6",
"source": "DPWG_GUIDELINE",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/guidelineAnnotation/PA166104992",
"annotations": []
}
]
}
},
"FDA Label Annotation": {
"abacavir": {
"name": "abacavir",
"id": "PA448004",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104833"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product ZIAGEN (abacavir sulfate), NDA020977, ViiV Healthcare Company",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=020977"
}
],
"guidelines": [
{
"id": "PA166104833",
"name": "Annotation of FDA Label for abacavir and HLA-B",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104833",
"annotations": []
}
]
},
"abrocitinib": {
"name": "abrocitinib",
"id": "PA166272921",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166272961"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Cibinqo (abrocitinib), NDA213871, Pfizer Laboratories Div Pfizer Inc",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=213871"
}
],
"guidelines": [
{
"id": "PA166272961",
"name": "Annotation of FDA Label for abrocitinib and CYP2C19",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166272961",
"annotations": [
{
"implications": [],
"drugRecommendation": ""In patients who are known or suspected to be CYP2C19 poor metabolizers, the recommended dosage of CIBINQO [abrocitinib] is 50 mg once daily. If an adequate response is not achieved with CIBINQO 50 mg orally daily after 12 weeks, consider increasing dosage to 100 mg orally once daily. Discontinue therapy if inadequate response is seen after dosage increase to 100 mg once daily." See label for more information.",
"classification": "Unspecified",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 6,
"phenotypes": [
"Poor Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Poor Metabolizer"
],
"label": "*2/*2",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*2": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Poor Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Poor Metabolizer"
}
]
}
]
}
]
},
"acetaminophen / caffeine / dihydrocodeine": {
"name": "acetaminophen / caffeine / dihydrocodeine",
"id": "PA166246281",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166246301"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Acetaminophen, Caffeine, Dihydrocodeine Bitartrate (Acetaminophen, Caffeine, Dihydrocodeine Bitartrate), ANDA204785, Xspire Pharma, Llc",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=204785"
}
],
"guidelines": [
{
"id": "PA166246301",
"name": "Annotation of FDA Label for acetaminophen / caffeine / dihydrocodeine and CYP2D6",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166246301",
"annotations": []
}
]
},
"allopurinol": {
"name": "allopurinol",
"id": "PA448320",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166234701"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Aloprim (Allopurinol), Mylan Institutional LLC - NDA020298/SUPPL-12, 02/17/2022",
"journal": null,
"year": 2022,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=020298"
}
],
"guidelines": [
{
"id": "PA166234701",
"name": "Annotation of FDA Label for allopurinol and HLA-B",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166234701",
"annotations": []
}
]
},
"amifampridine": {
"name": "amifampridine",
"id": "PA166185150",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166185151"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product RUZURGI (amifampridine) NDA 209321",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=209321"
}
],
"guidelines": [
{
"id": "PA166185151",
"name": "Annotation of FDA Label for amifampridine and NAT2",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166185151",
"annotations": []
}
]
},
"amifampridine phosphate": {
"name": "amifampridine phosphate",
"id": "PA166182002",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166182021"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Firdapse (amifampridine phosphate), NDA208078, Catalyst Pharmaceuticals, Inc.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=208078"
}
],
"guidelines": [
{
"id": "PA166182021",
"name": "Annotation of FDA Label for amifampridine phosphate and NAT2",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166182021",
"annotations": []
}
]
},
"amikacin": {
"name": "amikacin",
"id": "PA164744372",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166316321"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product ARIKAYCE (Amikacin), NDA207356, Insmed Incorporated",
"journal": null,
"year": 2023,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=207356"
}
],
"guidelines": [
{
"id": "PA166316321",
"name": "Annotation of FDA Label for amikacin and MT-RNR1",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166316321",
"annotations": []
}
]
},
"aripiprazole": {
"name": "aripiprazole",
"id": "PA10026",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104839"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product ABILIFY (ARIPIPRAZOLE), NDA021436, Rebel Distributors Corp.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=021436"
},
{
"pmid": null,
"title": "Drugs@FDA: Drug Product ABILIFY MAINTENA (aripiprazole), NDA202971, Otsuka America Pharmaceutical, Inc.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=202971"
},
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Abilify Asimtufii (Aripiprazole), Otsuka America Pharmaceutical, Inc - NDA217006/SUPPL-2, 01/22/2025",
"journal": null,
"year": 2025,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=217006"
}
],
"guidelines": [
{
"id": "PA166104839",
"name": "Annotation of FDA Label for aripiprazole and CYP2D6",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104839",
"annotations": []
}
]
},
"aripiprazole lauroxil": {
"name": "aripiprazole lauroxil",
"id": "PA166161216",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166161219"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product ARISTADA (aripiprazole lauroxil), NDA207533, Alkermes, Inc.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=207533"
},
{
"pmid": null,
"title": "Drugs@FDA: Drug Product ARISTADA INITIO (aripiprazole lauroxil), NDA209830, Alkermes, Inc.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=209830"
}
],
"guidelines": [
{
"id": "PA166161219",
"name": "Annotation of FDA Label for aripiprazole lauroxil and CYP2D6",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166161219",
"annotations": []
}
]
},
"articaine / epinephrine": {
"name": "articaine / epinephrine",
"id": "PA166182783",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166182741"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Articaine HCl and Epinephrine (articaine hydrochloride and epinephrine bitartrate), NDA022466, Safco Dental Supply Co.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=022466"
}
],
"guidelines": [
{
"id": "PA166182741",
"name": "Annotation of FDA Label for articaine / epinephrine and CYB5R3, G6PD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166182741",
"annotations": []
}
]
},
"ascorbic acid (vitamin c), combinations": {
"name": "Ascorbic acid (vitamin C), combinations",
"id": "PA164712515",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166293282"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Ascor (Ascorbic Acid), NDA209112, McGuff Pharmaceuticals, Inc.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=209112"
}
],
"guidelines": [
{
"id": "PA166293282",
"name": "Annotation of FDA Label for Ascorbic acid (vitamin C), combinations, Ascorbic acid (vitamin C), plain, sodium ascorbate and G6PD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166293282",
"annotations": []
}
]
},
"ascorbic acid (vitamin c), plain": {
"name": "Ascorbic acid (vitamin C), plain",
"id": "PA164712516",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166293282"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Ascor (Ascorbic Acid), NDA209112, McGuff Pharmaceuticals, Inc.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=209112"
}
],
"guidelines": [
{
"id": "PA166293282",
"name": "Annotation of FDA Label for Ascorbic acid (vitamin C), combinations, Ascorbic acid (vitamin C), plain, sodium ascorbate and G6PD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166293282",
"annotations": []
}
]
},
"atomoxetine": {
"name": "atomoxetine",
"id": "PA134688071",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104827"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Strattera (Atomoxetine hydrochloride), NDA021411, Eli Lilly and Company",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=021411"
}
],
"guidelines": [
{
"id": "PA166104827",
"name": "Annotation of FDA Label for atomoxetine and CYP2D6",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104827",
"annotations": []
}
]
},
"avatrombopag": {
"name": "avatrombopag",
"id": "PA166179849",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166179855"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product DOPTELET (avatrombopag maleate), AkaRx, Inc. - NDA210238/SUPPL-6, 10/14/2021",
"journal": null,
"year": 2021,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=210238"
}
],
"guidelines": [
{
"id": "PA166179855",
"name": "Annotation of FDA Label for avatrombopag and F2, F5, PROC, PROS1, SERPINC1",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166179855",
"annotations": []
}
]
},
"azathioprine": {
"name": "azathioprine",
"id": "PA448515",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104782"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product IMURAN (azathioprine), NDA016324, Sebela Pharmaceuticals Inc.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=016324"
}
],
"guidelines": [
{
"id": "PA166104782",
"name": "Annotation of FDA Label for azathioprine and NUDT15, TPMT",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104782",
"annotations": []
}
]
},
"belinostat": {
"name": "belinostat",
"id": "PA165971474",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166129553"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Beleodaq (Belinostat), NDA206256, Spectrum Pharmaceuticals, Inc.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=206256"
}
],
"guidelines": [
{
"id": "PA166129553",
"name": "Annotation of FDA Label for belinostat and UGT1A1",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166129553",
"annotations": []
}
]
},
"belzutifan": {
"name": "belzutifan",
"id": "PA166268761",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166268882"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product WELIREG (belzutifan), NDA215383, Merck Sharp & Dohme Corp.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=215383"
},
{
"pmid": null,
"title": "Drugs@FDA: Drug Product WELIREG (belzutifan), Merck Sharp & Dohme LLC - NDA215383/SUPPL-12, 05/14/2025",
"journal": null,
"year": 2025,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=215383"
}
],
"guidelines": [
{
"id": "PA166268882",
"name": "Annotation of FDA Label for belzutifan and CYP2C19, UGT2B17",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166268882",
"annotations": [
{
"implications": [],
"drugRecommendation": ""Patients who are dual UGT2B17 and CYP2C19 poor metabolizers have higher belzutifan exposures, which may increase the risk of adverse reactions of WELIREG. Monitor for increased adverse reactions in patients who are dual UGT2B17 and CYP2C19 poor metabolizers." See label for more information.",
"classification": "Unspecified",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 6,
"phenotypes": [
"Poor Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Poor Metabolizer"
],
"label": "*2/*2",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*2": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": true,
"phenotypes": {
"CYP2C19": "Poor Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Poor Metabolizer"
}
]
}
]
}
]
},
"brexpiprazole": {
"name": "brexpiprazole",
"id": "PA166160053",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166160054"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product REXULTI (brexpiprazole), NDA205422, Otsuka America Pharmaceutical, Inc.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=205422"
}
],
"guidelines": [
{
"id": "PA166160054",
"name": "Annotation of FDA Label for brexpiprazole and CYP2D6",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166160054",
"annotations": []
}
]
},
"brivaracetam": {
"name": "brivaracetam",
"id": "PA166153491",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166153492"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Briviact (brivaracetam), NDA205836, UCB, Inc.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=205836"
},
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Briviact (brivaracetam), UCB, Inc. - NDA205836/SUPPL-14, 05/17/2023",
"journal": null,
"year": 2023,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=205836"
}
],
"guidelines": [
{
"id": "PA166153492",
"name": "Annotation of FDA Label for brivaracetam and CYP2C19",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166153492",
"annotations": [
{
"implications": [],
"drugRecommendation": "The brivaracetam (BRIVIACT) label states: "CYP2C19 poor metabolizers and patients using inhibitors of CYP2C19 may require dose reduction." See label for more information.",
"classification": "Unspecified",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 6,
"phenotypes": [
"Poor Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Poor Metabolizer"
],
"label": "*2/*2",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*2": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Poor Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Poor Metabolizer"
}
]
}
]
}
]
},
"bupivacaine": {
"name": "bupivacaine",
"id": "PA135057240",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166235441"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Marcaine Spinal (Bupivacaine Hydrochloride in Dextrose), Hospira, Inc. - NDA018692/SUPPL-24, 09/28/2022",
"journal": null,
"year": 2022,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=018692"
}
],
"guidelines": [
{
"id": "PA166235441",
"name": "Annotation of FDA Label for bupivacaine and CYB5R3, G6PD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166235441",
"annotations": []
}
]
},
"capecitabine": {
"name": "capecitabine",
"id": "PA448771",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104802"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Xeloda (capecitabine), NDA020896, Genentech, Inc.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=020896"
},
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Xeloda (capecitabine), H2-Pharma, LLC - NDA020896/SUPPL-52, 10/03/2025",
"journal": null,
"year": 2025,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=020896"
}
],
"guidelines": [
{
"id": "PA166104802",
"name": "Annotation of FDA Label for capecitabine and DPYD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104802",
"annotations": []
}
]
},
"carbamazepine": {
"name": "carbamazepine",
"id": "PA448785",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166151882",
"https://www.clinpgx.org/labelAnnotation/PA166104780"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Tegretol (carbamazepine), NDA016608, REMEDYREPACK INC.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=016608"
}
],
"guidelines": [
{
"id": "PA166151882",
"name": "Annotation of FDA Label for carbamazepine and HLA-A",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166151882",
"annotations": []
},
{
"id": "PA166104780",
"name": "Annotation of FDA Label for carbamazepine and HLA-B",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104780",
"annotations": []
}
]
},
"carisoprodol": {
"name": "carisoprodol",
"id": "PA448809",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104832"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Soma (Carisoprodol), NDA011792, Rebel Distributors Corp",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=011792"
}
],
"guidelines": [
{
"id": "PA166104832",
"name": "Annotation of FDA Label for carisoprodol and CYP2C19",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104832",
"annotations": [
{
"implications": [],
"drugRecommendation": ""Patients with Reduced CYP2C19 Activity: SOMA [carisoprodol] should be used with caution in patients with reduced CYP2C19 activity." See label for more information.",
"classification": "Unspecified",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 6,
"phenotypes": [
"Poor Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Poor Metabolizer"
],
"label": "*2/*2",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*2": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": true,
"phenotypes": {
"CYP2C19": "Poor Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Poor Metabolizer"
}
]
}
]
}
]
},
"celecoxib": {
"name": "celecoxib",
"id": "PA448871",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104843"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product CELEBREX (Celecoxib), NDA020998, Aphena Pharma Solutions - Tennessee, LLC",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=020998"
},
{
"pmid": null,
"title": "Drugs@FDA: Drug Product ELYXYB - celecoxib (celecoxib), SCILEX PHARMACEUTICALS INC. - NDA212157/SUPPL-3, 11/21/2024",
"journal": null,
"year": 2024,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=212157"
}
],
"guidelines": [
{
"id": "PA166104843",
"name": "Annotation of FDA Label for celecoxib and CYP2C9",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104843",
"annotations": []
}
]
},
"cevimeline": {
"name": "cevimeline",
"id": "PA164754754",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104787"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Cevimeline (Cevimeline), NDA020989, Sun Pharmaceutical Industries, Inc.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=020989"
}
],
"guidelines": [
{
"id": "PA166104787",
"name": "Annotation of FDA Label for cevimeline and CYP2D6",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104787",
"annotations": []
}
]
},
"chloroquine": {
"name": "chloroquine",
"id": "PA448948",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "G6PD hemizygous samples",
"version": "2",
"matches": {
"gene": "G6PD",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"aminosalicylic acid",
"aspirin",
"chloramphenicol",
"chloroquine",
"ciprofloxacin",
"dapsone",
"dimercaprol",
"doxorubicin",
"furazolidone",
"glyburide",
"hydroxychloroquine",
"mafenide",
"methylene blue",
"nalidixic acid",
"nitrofurantoin",
"norfloxacin",
"ofloxacin",
"pegloticase",
"phenazopyridine",
"primaquine",
"quinine",
"rasburicase",
"sulfadiazine",
"sulfadimidine",
"sulfamethoxazole",
"trimethoprim",
"sulfanilamide",
"sulfasalazine",
"sulfisoxazole",
"tafenoquine",
"tolbutamide",
"toluidine blue",
"vitamin c",
"vitamin k"
]
},
"exception_type": "note",
"message": "PharmCAT reports based on VCF file input and some VCF files do not specify hemizygous (one X chromosome) and instead represent samples as homozygous. See PharmCAT FAQs (https://pharmcat.org/faqs/)."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104786"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product chloroquine (NDA006002)",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=006002"
}
],
"guidelines": [
{
"id": "PA166104786",
"name": "Annotation of FDA Label for chloroquine and G6PD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104786",
"annotations": []
}
]
},
"chlorpropamide": {
"name": "chlorpropamide",
"id": "PA448966",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166114910"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product chlorpropamide (NDA011641)",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=011641"
}
],
"guidelines": [
{
"id": "PA166114910",
"name": "Annotation of FDA Label for chlorpropamide and G6PD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166114910",
"annotations": []
}
]
},
"citalopram": {
"name": "citalopram",
"id": "PA449015",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104852"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Celexa (citalopram), NDA020822, Allergan, Inc.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=020822"
}
],
"guidelines": [
{
"id": "PA166104852",
"name": "Annotation of FDA Label for citalopram and CYP2C19",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104852",
"annotations": [
{
"implications": [],
"drugRecommendation": "The citalopram (CELEXA) label states: "Celexa 20 mg/day is the maximum recommended dose in CYP2C19 poor metabolizers due to the risk of QT prolongation" "In CYP2C19 poor metabolizers, citalopram steady state Cmax and AUC was increased by 68% and 107%, respectively." See label for more information.",
"classification": "Unspecified",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 6,
"phenotypes": [
"Poor Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Poor Metabolizer"
],
"label": "*2/*2",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*2": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Poor Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Poor Metabolizer"
}
]
}
]
}
]
},
"clobazam": {
"name": "clobazam",
"id": "PA10888",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104884"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Onfi (clobazam), NDA202067, Lundbeck Pharmaceuticals LLC",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=202067"
}
],
"guidelines": [
{
"id": "PA166104884",
"name": "Annotation of FDA Label for clobazam and CYP2C19",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104884",
"annotations": [
{
"implications": [],
"drugRecommendation": ""In CYP2C19 poor metabolizers ... the starting dose should be 5 mg/day and dose titration should proceed slowly according to weight, but to half the dose presented in Table 1 [of the drug label], as tolerated. If necessary and based upon clinical response, an additional titration to the maximum dose (20 mg/day or 40 mg/day, depending on the weight group) may be started on day 21." See label for more information.",
"classification": "Unspecified",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 6,
"phenotypes": [
"Poor Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Poor Metabolizer"
],
"label": "*2/*2",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*2": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Poor Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Poor Metabolizer"
}
]
}
]
}
]
},
"clopidogrel": {
"name": "clopidogrel",
"id": "PA449053",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104777"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Plavix (clopidogrel bisulfate), NDA020839, Rebel Distributors Corp",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=020839"
},
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Plavix (clopidogrel), sanofi-aventis U.S. LLC - NDA020839/SUPPL-78, 09/16/2022",
"journal": null,
"year": 2022,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=020839"
}
],
"guidelines": [
{
"id": "PA166104777",
"name": "Annotation of FDA Label for clopidogrel and CYP2C19",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104777",
"annotations": [
{
"implications": [],
"drugRecommendation": "The clopidogrel (Plavix) label states: "Consider use of another platelet P2Y12 inhibitor in patients identified as CYP2C19 poor metabolizers." See label for more information.",
"classification": "Unspecified",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 6,
"phenotypes": [
"Poor Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Poor Metabolizer"
],
"label": "*2/*2",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*2": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": true,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Poor Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Poor Metabolizer"
}
]
}
]
}
]
},
"clozapine": {
"name": "clozapine",
"id": "PA449061",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104815"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Clozaril (clozapine), NDA019758, HLS Therapeutics (USA), Inc.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=019758"
}
],
"guidelines": [
{
"id": "PA166104815",
"name": "Annotation of FDA Label for clozapine and CYP2D6",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104815",
"annotations": []
}
]
},
"codeine": {
"name": "codeine",
"id": "PA449088",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104916"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Codeine sulfate (codeine sulfate), NDA022402, West-Ward Pharmaceuticals Corp.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=022402"
}
],
"guidelines": [
{
"id": "PA166104916",
"name": "Annotation of FDA Label for codeine and CYP2D6",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104916",
"annotations": []
}
]
},
"dabrafenib": {
"name": "dabrafenib",
"id": "PA166114911",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166114913"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Tafinlar (dabrafenib), Novartis Pharmaceuticals Corporation - NDA202806/SUPPL-31, 07/11/2024",
"journal": null,
"year": 2024,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=202806"
}
],
"guidelines": [
{
"id": "PA166114913",
"name": "Annotation of FDA Label for dabrafenib and G6PD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166114913",
"annotations": []
}
]
},
"dapsone": {
"name": "dapsone",
"id": "PA449211",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "G6PD hemizygous samples",
"version": "2",
"matches": {
"gene": "G6PD",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"aminosalicylic acid",
"aspirin",
"chloramphenicol",
"chloroquine",
"ciprofloxacin",
"dapsone",
"dimercaprol",
"doxorubicin",
"furazolidone",
"glyburide",
"hydroxychloroquine",
"mafenide",
"methylene blue",
"nalidixic acid",
"nitrofurantoin",
"norfloxacin",
"ofloxacin",
"pegloticase",
"phenazopyridine",
"primaquine",
"quinine",
"rasburicase",
"sulfadiazine",
"sulfadimidine",
"sulfamethoxazole",
"trimethoprim",
"sulfanilamide",
"sulfasalazine",
"sulfisoxazole",
"tafenoquine",
"tolbutamide",
"toluidine blue",
"vitamin c",
"vitamin k"
]
},
"exception_type": "note",
"message": "PharmCAT reports based on VCF file input and some VCF files do not specify hemizygous (one X chromosome) and instead represent samples as homozygous. See PharmCAT FAQs (https://pharmcat.org/faqs/)."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166344801"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product DAPSONE (dapsone), Pacific Pharma, Inc. - NDA021794/SUPPL-16, 05/18/2018",
"journal": null,
"year": 2018,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=021794"
}
],
"guidelines": [
{
"id": "PA166344801",
"name": "Annotation of FDA Label for dapsone and G6PD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166344801",
"annotations": []
}
]
},
"desflurane": {
"name": "desflurane",
"id": "PA164749136",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166129515"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product SUPRANE (desflurane), NDA020118, Baxter Healthcare Corporation",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=020118"
}
],
"guidelines": [
{
"id": "PA166129515",
"name": "Annotation of FDA Label for desflurane and CACNA1S, RYR1",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166129515",
"annotations": [
{
"implications": [],
"drugRecommendation": ""The use of SUPRANE [desflurane] is contraindicated in...[cases of k]nown or suspected genetic susceptibility to malignant hyperthermia...SUPRANE [desflurane] can induce malignant hyperthermia in patients with known or suspected susceptibility based on genetic factors or family history, including those with certain inherited ryanodine receptor (RYR1) or dihydropyridine receptor (CACNA1S) variants. " See label for more information.",
"classification": "Unspecified",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CACNA1S",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CACNA1S",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CACNA1S",
"matchScore": 4,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
},
{
"allele1": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "RYR1",
"matchScore": 0,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": [
{
"allele1": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "RYR1",
"matchScore": 626,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
],
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": true,
"otherPrescribingGuidance": false,
"phenotypes": {
"CACNA1S": "Uncertain Susceptibility",
"RYR1": "Uncertain Susceptibility"
},
"lookupKey": [
{
"RYR1": "Uncertain Susceptibility",
"CACNA1S": "Uncertain Susceptibility"
}
]
}
]
}
]
},
"deuruxolitinib": {
"name": "deuruxolitinib",
"id": "PA166400021",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166400362"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product LEQSELVI (deuruxolitinib), NDA217900/ORIG-1, 07/25/2024",
"journal": null,
"year": 2024,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=217900"
}
],
"guidelines": [
{
"id": "PA166400362",
"name": "Annotation of FDA Label for deuruxolitinib and CYP2C9",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166400362",
"annotations": []
}
]
},
"deutetrabenazine": {
"name": "deutetrabenazine",
"id": "PA166169881",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166169882"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Austedo (Deutetrabenazine), NDA208082, Teva Neuroscience, Inc.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=208082"
}
],
"guidelines": [
{
"id": "PA166169882",
"name": "Annotation of FDA Label for deutetrabenazine and CYP2D6",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166169882",
"annotations": []
}
]
},
"dextromethorphan / quinidine": {
"name": "dextromethorphan / quinidine",
"id": "PA166175998",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104886"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Nuedexta (dextromethorphan hydrobromide and quinidine sulfate), Otsuka America Pharmaceutical, Inc - NDA021879/SUPPL-14, 06/11/2019",
"journal": null,
"year": 2019,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=021879"
}
],
"guidelines": [
{
"id": "PA166104886",
"name": "Annotation of FDA Label for dextromethorphan / quinidine and CYP2D6",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104886",
"annotations": []
}
]
},
"dextromethorphan hydrobromide / bupropion hydrochloride": {
"name": "dextromethorphan hydrobromide / bupropion hydrochloride",
"id": "PA166278341",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166278361"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA Drug Product: AUVELITY (dextromethorphan hydrobromide / bupropion hydrochloride)",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=215430"
},
{
"pmid": null,
"title": "Drugs@FDA: Drug Product AUVELITY (dextromethorphan hydrobromide, bupropion hydrochloride), Axsome Therapeutics, Inc. - NDA215430/SUPPL-8, 05/07/2024",
"journal": null,
"year": 2024,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=215430"
}
],
"guidelines": [
{
"id": "PA166278361",
"name": "Annotation of FDA Label for dextromethorphan hydrobromide / bupropion hydrochloride and CYP2D6",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166278361",
"annotations": []
}
]
},
"dronabinol": {
"name": "dronabinol",
"id": "PA449421",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166163422"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product SYNDROS (Dronabinol), NDA205525, Insys Therapeutics, Inc.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=205525"
},
{
"pmid": null,
"title": "Drugs@FDA: Drug Product SYNDROS (Dronabinol), Benuvia Operations, LLC - NDA205525/SUPPL-13, 05/17/2024",
"journal": null,
"year": 2024,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=205525"
}
],
"guidelines": [
{
"id": "PA166163422",
"name": "Annotation of FDA Label for dronabinol and CYP2C9",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166163422",
"annotations": []
}
]
},
"eliglustat": {
"name": "eliglustat",
"id": "PA166123486",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166123487"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Cerdelga (eliglustat), Genzyme Corporation - NDA205494/SUPPL-3, 08/29/2018",
"journal": null,
"year": 2018,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=205494"
}
],
"guidelines": [
{
"id": "PA166123487",
"name": "Annotation of FDA Label for eliglustat and CYP2D6",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166123487",
"annotations": []
}
]
},
"eltrombopag": {
"name": "eltrombopag",
"id": "PA165981594",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104912"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product PROMACTA (eltrombopag olamine), NDA022291, Novartis Pharmaceuticals Corporation",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=022291"
}
],
"guidelines": [
{
"id": "PA166104912",
"name": "Annotation of FDA Label for eltrombopag and F5, SERPINC1",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104912",
"annotations": []
}
]
},
"erdafitinib": {
"name": "erdafitinib",
"id": "PA166182720",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166182722"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product BALVERSA (Erdafitinib), Janssen Products LP - NDA212018/SUPPL-9, 01/19/2024",
"journal": null,
"year": 2024,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=212018"
}
],
"guidelines": [
{
"id": "PA166182722",
"name": "Annotation of FDA Label for erdafitinib and CYP2C9",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166182722",
"annotations": []
}
]
},
"ethinyl estradiol / norelgestromin": {
"name": "ethinyl estradiol / norelgestromin",
"id": "PA165290929",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166414701"
],
"citations": [],
"guidelines": [
{
"id": "PA166414701",
"name": "Annotation of FDA Label for ethinyl estradiol / norelgestromin and F5, PROC, PROS1, SERPINC1",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166414701",
"annotations": []
}
]
},
"flibanserin": {
"name": "flibanserin",
"id": "PA166153431",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166345022"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product ADDYI (flibanserin), Sprout Pharmaceuticals, Inc. - NDA022526/SUPPL-10, 09/29/2021",
"journal": null,
"year": 2021,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=022526"
}
],
"guidelines": [
{
"id": "PA166345022",
"name": "Annotation of FDA Label for flibanserin and CYP2C19",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166345022",
"annotations": [
{
"implications": [],
"drugRecommendation": "The flibanserin (ADDYI) label states: "[...]increase monitoring for adverse reactions (e.g., hypotension) in patients who are CYP2C19 poor metabolizers." See label for more information.",
"classification": "Unspecified",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 6,
"phenotypes": [
"Poor Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Poor Metabolizer"
],
"label": "*2/*2",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*2": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": true,
"phenotypes": {
"CYP2C19": "Poor Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Poor Metabolizer"
}
]
}
]
}
]
},
"fluorouracil": {
"name": "fluorouracil",
"id": "PA128406956",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104807"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Carac (fluorouracil), Bausch Health US, LLC - NDA020985/SUPPL-19, 05/26/2022",
"journal": null,
"year": 2022,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=020985"
},
{
"pmid": null,
"title": "Drugs@FDA: Drug Product FLUOROURACIL (FLUOROURACIL), Eugia US LLC - ANDA202669/SUPPL-9, 03/21/2024",
"journal": null,
"year": 2024,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=202669"
},
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Fluorouracil (Fluorouracil), BluePoint Laboratories - ANDA210124/SUPPL-9, 03/21/2024",
"journal": null,
"year": 2024,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=210124"
}
],
"guidelines": [
{
"id": "PA166104807",
"name": "Annotation of FDA Label for fluorouracil and DPYD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104807",
"annotations": []
}
]
},
"fluoxetine": {
"name": "fluoxetine",
"id": "PA449673",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104835"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Prozac Weekly (Fluoxetine hydrochloride), NDA021235, Eli Lilly and Company",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=021235"
}
],
"guidelines": [
{
"id": "PA166104835",
"name": "Annotation of FDA Label for fluoxetine and CYP2D6",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104835",
"annotations": []
}
]
},
"fluoxetine / olanzapine": {
"name": "fluoxetine / olanzapine",
"id": "PA166176027",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104788"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Symbyax (Olanzapine and Fluoxetine hydrochloride), NDA021520, Eli Lilly and Company",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=021520"
}
],
"guidelines": [
{
"id": "PA166104788",
"name": "Annotation of FDA Label for fluoxetine / olanzapine and CYP2D6",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104788",
"annotations": []
}
]
},
"flurbiprofen": {
"name": "flurbiprofen",
"id": "PA449683",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104922"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product FLURBIPROFEN SODIUM (flurbiprofen sodium), NDA019404, Rebel Distributors Corp",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=019404"
},
{
"pmid": null,
"title": "Drugs@FDA: Drug Product flurbiprofen (NDA018766)",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=018766"
}
],
"guidelines": [
{
"id": "PA166104922",
"name": "Annotation of FDA Label for flurbiprofen and CYP2C9",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104922",
"annotations": []
}
]
},
"flutamide": {
"name": "flutamide",
"id": "PA449685",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166182765"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product flutamide (NDA018554)",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=018554"
}
],
"guidelines": [
{
"id": "PA166182765",
"name": "Annotation of FDA Label for flutamide and G6PD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166182765",
"annotations": []
}
]
},
"fluvoxamine": {
"name": "fluvoxamine",
"id": "PA449690",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104854"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product fluvoxamine maleate (Fluvoxamine maleate), NDA021519, Bryant Ranch Prepack",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=021519"
}
],
"guidelines": [
{
"id": "PA166104854",
"name": "Annotation of FDA Label for fluvoxamine and CYP2D6",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104854",
"annotations": []
}
]
},
"fosphenytoin": {
"name": "fosphenytoin",
"id": "PA164746820",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "Phenytoin_HLA-B warning",
"version": "1",
"matches": {
"gene": null,
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"phenytoin",
"fosphenytoin"
]
},
"exception_type": "note",
"message": "The displayed recommendation for CYP2C9 and phenytoin is ONLY valid for non-carriers of the HLA-B*15:02 high-risk allele. PharmCAT Named Allele Matcher does not determine HLA status. CPIC guidance: Fos-/Phenytoin is contraindicated in individuals with the HLA-B*15:02 variant allele (\"HLA-B*15:02-positive\") due to significantly increased risk of fos-/phenytoin-induced cutaneous adverse reactions of Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN). In HLA-B*15:02 carriers, carbamazepine should not be used as an alternative. Alternative medications such as oxcarbazepine, eslicarbazepine acetate, and lamotrigine have some evidence linking SJS/TEN with the HLA-B*15:02 allele, and thus caution should be used in choosing alternatives to phenytoin."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166182766"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product CEREBYX (Fosphenytoin Sodium), NDA020450, Pfizer Laboratories Div Pfizer Inc",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=020450"
}
],
"guidelines": [
{
"id": "PA166182766",
"name": "Annotation of FDA Label for fosphenytoin and CYP2C9, HLA-B",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166182766",
"annotations": []
}
]
},
"gefitinib": {
"name": "gefitinib",
"id": "PA131301952",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166170929"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product IRESSA (Gefitinib), NDA206995, AstraZeneca Pharmaceuticals LP",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=206995"
}
],
"guidelines": [
{
"id": "PA166170929",
"name": "Annotation of FDA Label for gefitinib and CYP2D6",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166170929",
"annotations": []
}
]
},
"gentamicin": {
"name": "gentamicin",
"id": "PA449753",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166316381"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Gentamicin Sulfate in Sodium Chloride (Gentamicin Sulfate), ANDA062373, Baxter Healthcare Corporation",
"journal": null,
"year": 2023,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=062373"
}
],
"guidelines": [
{
"id": "PA166316381",
"name": "Annotation of FDA Label for gentamicin and MT-RNR1",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166316381",
"annotations": []
}
]
},
"glimepiride": {
"name": "glimepiride",
"id": "PA449761",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166105147"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product AMARYL (glimepiride), NDA020496, Sanofi-Aventis U.S. LLC",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=020496"
}
],
"guidelines": [
{
"id": "PA166105147",
"name": "Annotation of FDA Label for glimepiride and G6PD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166105147",
"annotations": []
}
]
},
"glipizide": {
"name": "glipizide",
"id": "PA449762",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166105148"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Glucotrol (glipizide), NDA017783, Roerig",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=017783"
}
],
"guidelines": [
{
"id": "PA166105148",
"name": "Annotation of FDA Label for glipizide and G6PD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166105148",
"annotations": []
}
]
},
"glyburide": {
"name": "glyburide",
"id": "PA449782",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "G6PD hemizygous samples",
"version": "2",
"matches": {
"gene": "G6PD",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"aminosalicylic acid",
"aspirin",
"chloramphenicol",
"chloroquine",
"ciprofloxacin",
"dapsone",
"dimercaprol",
"doxorubicin",
"furazolidone",
"glyburide",
"hydroxychloroquine",
"mafenide",
"methylene blue",
"nalidixic acid",
"nitrofurantoin",
"norfloxacin",
"ofloxacin",
"pegloticase",
"phenazopyridine",
"primaquine",
"quinine",
"rasburicase",
"sulfadiazine",
"sulfadimidine",
"sulfamethoxazole",
"trimethoprim",
"sulfanilamide",
"sulfasalazine",
"sulfisoxazole",
"tafenoquine",
"tolbutamide",
"toluidine blue",
"vitamin c",
"vitamin k"
]
},
"exception_type": "note",
"message": "PharmCAT reports based on VCF file input and some VCF files do not specify hemizygous (one X chromosome) and instead represent samples as homozygous. See PharmCAT FAQs (https://pharmcat.org/faqs/)."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104881"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Glynase (glyburide), NDA020051, Pharmacia and Upjohn Company LLC",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=020051"
}
],
"guidelines": [
{
"id": "PA166104881",
"name": "Annotation of FDA Label for glyburide and G6PD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104881",
"annotations": []
}
]
},
"hydralazine": {
"name": "hydralazine",
"id": "PA449894",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166356321"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Hydralazine Hydrochloride (Hydralazine Hydrochloride), American Regent, Inc. - ANDA040136/SUPPL-5, 04/26/2013",
"journal": null,
"year": 2013,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=040136"
}
],
"guidelines": [
{
"id": "PA166356321",
"name": "Annotation of FDA Label for hydralazine and NAT2",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166356321",
"annotations": []
}
]
},
"hydroxychloroquine": {
"name": "hydroxychloroquine",
"id": "PA164777036",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "G6PD hemizygous samples",
"version": "2",
"matches": {
"gene": "G6PD",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"aminosalicylic acid",
"aspirin",
"chloramphenicol",
"chloroquine",
"ciprofloxacin",
"dapsone",
"dimercaprol",
"doxorubicin",
"furazolidone",
"glyburide",
"hydroxychloroquine",
"mafenide",
"methylene blue",
"nalidixic acid",
"nitrofurantoin",
"norfloxacin",
"ofloxacin",
"pegloticase",
"phenazopyridine",
"primaquine",
"quinine",
"rasburicase",
"sulfadiazine",
"sulfadimidine",
"sulfamethoxazole",
"trimethoprim",
"sulfanilamide",
"sulfasalazine",
"sulfisoxazole",
"tafenoquine",
"tolbutamide",
"toluidine blue",
"vitamin c",
"vitamin k"
]
},
"exception_type": "note",
"message": "PharmCAT reports based on VCF file input and some VCF files do not specify hemizygous (one X chromosome) and instead represent samples as homozygous. See PharmCAT FAQs (https://pharmcat.org/faqs/)."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166182769"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Plaquenil (Hydroxychloroquine Sulfate), NDA009768, Carilion Materials Management",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=009768"
}
],
"guidelines": [
{
"id": "PA166182769",
"name": "Annotation of FDA Label for hydroxychloroquine and G6PD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166182769",
"annotations": []
}
]
},
"iloperidone": {
"name": "iloperidone",
"id": "PA161199368",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104887"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product FANAPT (Iloperidone), NDA022192, Avera McKennan Hospital",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=022192"
},
{
"pmid": null,
"title": "Drugs@FDA: Drug Product FANAPT (ILOPERIDONE), Vanda Pharmaceuticals Inc. - NDA022192/SUPPL-24, 01/22/2025",
"journal": null,
"year": 2025,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=022192"
}
],
"guidelines": [
{
"id": "PA166104887",
"name": "Annotation of FDA Label for iloperidone and CYP2D6",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104887",
"annotations": []
}
]
},
"irinotecan": {
"name": "irinotecan",
"id": "PA450085",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104831"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Camptosar (irinotecan hydrochloride), Pharmacia & Upjohn Company LLC - NDA020571/SUPPL-53, 01/27/2022",
"journal": null,
"year": 2022,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=020571"
},
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Onivyde (IRINOTECAN HYDROCHLORIDE), Ipsen Biopharmaceuticals, Inc. - NDA207793/SUPPL-16, 02/13/2024",
"journal": null,
"year": 2024,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=207793"
}
],
"guidelines": [
{
"id": "PA166104831",
"name": "Annotation of FDA Label for irinotecan and UGT1A1",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104831",
"annotations": []
}
]
},
"isoflurane": {
"name": "isoflurane",
"id": "PA450106",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166129517"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product FORANE (isoflurane), NDA017624, Baxter Healthcare Corporation",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=017624"
}
],
"guidelines": [
{
"id": "PA166129517",
"name": "Annotation of FDA Label for isoflurane and CACNA1S, RYR1",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166129517",
"annotations": [
{
"implications": [],
"drugRecommendation": ""CONTRAINDICATIONS...with known or suspected genetic susceptibility to malignant hyperthermia...FORANE [isoflurane] can induce malignant hyperthermia in patients with known or suspected susceptibility based on genetic factors or family history, including those with certain inherited ryanodine receptor (RYR1) or dihydropyridine receptor (CACNA1S) variants." See label for more information.",
"classification": "Unspecified",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CACNA1S",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CACNA1S",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CACNA1S",
"matchScore": 4,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
},
{
"allele1": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "RYR1",
"matchScore": 0,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": [
{
"allele1": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "RYR1",
"matchScore": 626,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
],
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": true,
"otherPrescribingGuidance": false,
"phenotypes": {
"CACNA1S": "Uncertain Susceptibility",
"RYR1": "Uncertain Susceptibility"
},
"lookupKey": [
{
"RYR1": "Uncertain Susceptibility",
"CACNA1S": "Uncertain Susceptibility"
}
]
}
]
}
]
},
"ivacaftor": {
"name": "ivacaftor",
"id": "PA165950341",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104890"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Kalydeco (ivacaftor), NDA203188, Vertex Pharmaceuticals Incorporated",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=203188"
}
],
"guidelines": [
{
"id": "PA166104890",
"name": "Annotation of FDA Label for ivacaftor and CFTR",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104890",
"annotations": []
}
]
},
"lesinurad": {
"name": "lesinurad",
"id": "PA166160006",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166160007"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Zurampic (lesinurad), NDA207988, Ironwood Pharmaceuticals, Inc.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=207988"
}
],
"guidelines": [
{
"id": "PA166160007",
"name": "Annotation of FDA Label for lesinurad and CYP2C9",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166160007",
"annotations": []
}
]
},
"lidocaine / prilocaine": {
"name": "lidocaine / prilocaine",
"id": "PA166176018",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166105178"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Oraqix (lidocaine and prilocaine), Dentsply Pharmaceutical - NDA021451/SUPPL-14, 11/02/2018",
"journal": null,
"year": 2018,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=021451"
}
],
"guidelines": [
{
"id": "PA166105178",
"name": "Annotation of FDA Label for lidocaine / prilocaine and CYB5R3, G6PD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166105178",
"annotations": []
}
]
},
"lidocaine and tetracaine": {
"name": "lidocaine and tetracaine",
"id": "PA166182735",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166182737"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Synera (lidocaine and tetracaine), NDA021623, Galen US Incorporated",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=021623"
}
],
"guidelines": [
{
"id": "PA166182737",
"name": "Annotation of FDA Label for lidocaine and tetracaine and G6PD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166182737",
"annotations": []
}
]
},
"lofexidine": {
"name": "lofexidine",
"id": "PA164744510",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166179848"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Lucemyra (lofexidine hydrochloride), NDA209229, US WorldMeds, LLC",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=209229"
}
],
"guidelines": [
{
"id": "PA166179848",
"name": "Annotation of FDA Label for lofexidine and CYP2D6",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166179848",
"annotations": []
}
]
},
"lusutrombopag": {
"name": "lusutrombopag",
"id": "PA166182748",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166182749"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Mulpleta (Lusutrombopag), SHIONOGI INC. - NDA210923/ORIG-1, 07/31/2018",
"journal": null,
"year": 2018,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=210923"
}
],
"guidelines": [
{
"id": "PA166182749",
"name": "Annotation of FDA Label for lusutrombopag and F2, F5, PROC, PROS1, SERPINC1",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166182749",
"annotations": []
}
]
},
"meclizine": {
"name": "meclizine",
"id": "PA450338",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166180000"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product meclizine (NDA010721)",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=010721"
}
],
"guidelines": [
{
"id": "PA166180000",
"name": "Annotation of FDA Label for meclizine and CYP2D6",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166180000",
"annotations": []
}
]
},
"mepivacaine": {
"name": "mepivacaine",
"id": "PA164748741",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166182751"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Carbocaine (Mepivacaine Hydrochloride), NDA012250, Hospira, Inc.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=012250"
}
],
"guidelines": [
{
"id": "PA166182751",
"name": "Annotation of FDA Label for mepivacaine and G6PD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166182751",
"annotations": []
}
]
},
"mercaptopurine": {
"name": "mercaptopurine",
"id": "PA450379",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104810"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product PURINETHOL (Mercaptopurine), Quinn Pharmaceuticals - NDA009053/SUPPL-40, 12/29/2020",
"journal": null,
"year": 2020,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=009053"
},
{
"pmid": null,
"title": "Drugs@FDA: Drug Product PURIXAN (mercaptopurine), Nova Laboratories, Ltd - NDA205919/SUPPL-4, 04/07/2020",
"journal": null,
"year": 2020,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=205919"
}
],
"guidelines": [
{
"id": "PA166104810",
"name": "Annotation of FDA Label for mercaptopurine and NUDT15, TPMT",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104810",
"annotations": []
}
]
},
"methylene blue": {
"name": "methylene blue",
"id": "PA450457",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "G6PD hemizygous samples",
"version": "2",
"matches": {
"gene": "G6PD",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"aminosalicylic acid",
"aspirin",
"chloramphenicol",
"chloroquine",
"ciprofloxacin",
"dapsone",
"dimercaprol",
"doxorubicin",
"furazolidone",
"glyburide",
"hydroxychloroquine",
"mafenide",
"methylene blue",
"nalidixic acid",
"nitrofurantoin",
"norfloxacin",
"ofloxacin",
"pegloticase",
"phenazopyridine",
"primaquine",
"quinine",
"rasburicase",
"sulfadiazine",
"sulfadimidine",
"sulfamethoxazole",
"trimethoprim",
"sulfanilamide",
"sulfasalazine",
"sulfisoxazole",
"tafenoquine",
"tolbutamide",
"toluidine blue",
"vitamin c",
"vitamin k"
]
},
"exception_type": "note",
"message": "PharmCAT reports based on VCF file input and some VCF files do not specify hemizygous (one X chromosome) and instead represent samples as homozygous. See PharmCAT FAQs (https://pharmcat.org/faqs/)."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104878"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product PROVAYBLUE (methylene blue), NDA204630, American Regent, Inc.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=204630"
}
],
"guidelines": [
{
"id": "PA166104878",
"name": "Annotation of FDA Label for methylene blue and G6PD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104878",
"annotations": []
}
]
},
"metoclopramide": {
"name": "metoclopramide",
"id": "PA450475",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166178750"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Reglan (Metoclopramide Hydrochloride), ANI Pharmaceuticals, Inc. - NDA017854/SUPPL-62, 08/29/2017",
"journal": null,
"year": 2017,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=017854"
}
],
"guidelines": [
{
"id": "PA166178750",
"name": "Annotation of FDA Label for metoclopramide and CYP2D6",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166178750",
"annotations": []
}
]
},
"moviprep": {
"name": "moviprep",
"id": "PA166163260",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104897"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product MoviPrep (POLYETHYLENE GLYCOL 3350, SODIUM SULFATE, SODIUM CHLORIDE, POTASSIUM CHLORIDE, ASCORBIC ACID, SODIUM ASCORBATE), NDA021881, Salix Pharmaceuticals, Inc.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=021881"
}
],
"guidelines": [
{
"id": "PA166104897",
"name": "Annotation of FDA Label for moviprep and G6PD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104897",
"annotations": []
}
]
},
"nalidixic acid": {
"name": "nalidixic acid",
"id": "PA164746384",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "G6PD hemizygous samples",
"version": "2",
"matches": {
"gene": "G6PD",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"aminosalicylic acid",
"aspirin",
"chloramphenicol",
"chloroquine",
"ciprofloxacin",
"dapsone",
"dimercaprol",
"doxorubicin",
"furazolidone",
"glyburide",
"hydroxychloroquine",
"mafenide",
"methylene blue",
"nalidixic acid",
"nitrofurantoin",
"norfloxacin",
"ofloxacin",
"pegloticase",
"phenazopyridine",
"primaquine",
"quinine",
"rasburicase",
"sulfadiazine",
"sulfadimidine",
"sulfamethoxazole",
"trimethoprim",
"sulfanilamide",
"sulfasalazine",
"sulfisoxazole",
"tafenoquine",
"tolbutamide",
"toluidine blue",
"vitamin c",
"vitamin k"
]
},
"exception_type": "note",
"message": "PharmCAT reports based on VCF file input and some VCF files do not specify hemizygous (one X chromosome) and instead represent samples as homozygous. See PharmCAT FAQs (https://pharmcat.org/faqs/)."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104891"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product nalidixic acid (NDA014214)",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=014214"
}
],
"guidelines": [
{
"id": "PA166104891",
"name": "Annotation of FDA Label for nalidixic acid and G6PD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104891",
"annotations": []
}
]
},
"nitrofurantoin": {
"name": "nitrofurantoin",
"id": "PA450640",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "G6PD hemizygous samples",
"version": "2",
"matches": {
"gene": "G6PD",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"aminosalicylic acid",
"aspirin",
"chloramphenicol",
"chloroquine",
"ciprofloxacin",
"dapsone",
"dimercaprol",
"doxorubicin",
"furazolidone",
"glyburide",
"hydroxychloroquine",
"mafenide",
"methylene blue",
"nalidixic acid",
"nitrofurantoin",
"norfloxacin",
"ofloxacin",
"pegloticase",
"phenazopyridine",
"primaquine",
"quinine",
"rasburicase",
"sulfadiazine",
"sulfadimidine",
"sulfamethoxazole",
"trimethoprim",
"sulfanilamide",
"sulfasalazine",
"sulfisoxazole",
"tafenoquine",
"tolbutamide",
"toluidine blue",
"vitamin c",
"vitamin k"
]
},
"exception_type": "note",
"message": "PharmCAT reports based on VCF file input and some VCF files do not specify hemizygous (one X chromosome) and instead represent samples as homozygous. See PharmCAT FAQs (https://pharmcat.org/faqs/)."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104903"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Furadantin (Nitrofurantoin), NDA009175, Casper Pharma LLC",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=009175"
}
],
"guidelines": [
{
"id": "PA166104903",
"name": "Annotation of FDA Label for nitrofurantoin and G6PD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104903",
"annotations": []
}
]
},
"oliceridine": {
"name": "oliceridine",
"id": "PA166223601",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166225161"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product OLINVYK (OLICERIDINE), NDA210730, Trevena, Inc.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=210730"
}
],
"guidelines": [
{
"id": "PA166225161",
"name": "Annotation of FDA Label for oliceridine and CYP2D6",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166225161",
"annotations": []
}
]
},
"oxcarbazepine": {
"name": "oxcarbazepine",
"id": "PA450732",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166105213"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product OXTELLAR XR (OXCARBAZEPINE), NDA202810, Supernus Pharmaceuticals, Inc.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=202810"
},
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Oxtellar XR (oxcarbazepine), NDA202810/SUPPL-20, 08/14/2024",
"journal": null,
"year": 2024,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=202810"
}
],
"guidelines": [
{
"id": "PA166105213",
"name": "Annotation of FDA Label for oxcarbazepine and HLA-B",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166105213",
"annotations": []
}
]
},
"oxymetazoline and tetracaine": {
"name": "oxymetazoline and tetracaine",
"id": "PA166182885",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166184637"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product oxymetazoline and tetracaine (NDA208032)",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=208032"
}
],
"guidelines": [
{
"id": "PA166184637",
"name": "Annotation of FDA Label for oxymetazoline and tetracaine and BCHE, CYB5R3, G6PD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166184637",
"annotations": []
}
]
},
"pantoprazole": {
"name": "pantoprazole",
"id": "PA450774",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104901"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Protonix Delayed-Release (PANTOPRAZOLE SODIUM), Wyeth Pharmaceuticals LLC, a subsidiary of Pfizer Inc. - NDA020987/SUPPL-54, 06/07/2018",
"journal": null,
"year": 2018,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=020987"
}
],
"guidelines": [
{
"id": "PA166104901",
"name": "Annotation of FDA Label for pantoprazole and CYP2C19",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104901",
"annotations": [
{
"implications": [],
"drugRecommendation": ""For adult patients who are CYP2C19 poor metabolizers, no dosage adjustment is needed...For known pediatric poor metabolizers, a dose reduction should be considered." See label for more information.",
"classification": "Unspecified",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 6,
"phenotypes": [
"Poor Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Poor Metabolizer"
],
"label": "*2/*2",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*2": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Poor Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Poor Metabolizer"
}
]
}
]
}
]
},
"pegloticase": {
"name": "pegloticase",
"id": "PA165963961",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "G6PD hemizygous samples",
"version": "2",
"matches": {
"gene": "G6PD",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"aminosalicylic acid",
"aspirin",
"chloramphenicol",
"chloroquine",
"ciprofloxacin",
"dapsone",
"dimercaprol",
"doxorubicin",
"furazolidone",
"glyburide",
"hydroxychloroquine",
"mafenide",
"methylene blue",
"nalidixic acid",
"nitrofurantoin",
"norfloxacin",
"ofloxacin",
"pegloticase",
"phenazopyridine",
"primaquine",
"quinine",
"rasburicase",
"sulfadiazine",
"sulfadimidine",
"sulfamethoxazole",
"trimethoprim",
"sulfanilamide",
"sulfasalazine",
"sulfisoxazole",
"tafenoquine",
"tolbutamide",
"toluidine blue",
"vitamin c",
"vitamin k"
]
},
"exception_type": "note",
"message": "PharmCAT reports based on VCF file input and some VCF files do not specify hemizygous (one X chromosome) and instead represent samples as homozygous. See PharmCAT FAQs (https://pharmcat.org/faqs/)."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104900"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Krystexxa (pegloticase), BLA125293, Horizon Pharma Inc.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=125293"
}
],
"guidelines": [
{
"id": "PA166104900",
"name": "Annotation of FDA Label for pegloticase and G6PD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104900",
"annotations": []
}
]
},
"phenytoin": {
"name": "phenytoin",
"id": "PA450947",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "Phenytoin_HLA-B warning",
"version": "1",
"matches": {
"gene": null,
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"phenytoin",
"fosphenytoin"
]
},
"exception_type": "note",
"message": "The displayed recommendation for CYP2C9 and phenytoin is ONLY valid for non-carriers of the HLA-B*15:02 high-risk allele. PharmCAT Named Allele Matcher does not determine HLA status. CPIC guidance: Fos-/Phenytoin is contraindicated in individuals with the HLA-B*15:02 variant allele (\"HLA-B*15:02-positive\") due to significantly increased risk of fos-/phenytoin-induced cutaneous adverse reactions of Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN). In HLA-B*15:02 carriers, carbamazepine should not be used as an alternative. Alternative medications such as oxcarbazepine, eslicarbazepine acetate, and lamotrigine have some evidence linking SJS/TEN with the HLA-B*15:02 allele, and thus caution should be used in choosing alternatives to phenytoin."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104860"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA Drug Product: DILANTIN (phenytoin), NDA008762, Upjohn",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=008762"
}
],
"guidelines": [
{
"id": "PA166104860",
"name": "Annotation of FDA Label for phenytoin and CYP2C9, HLA-B",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104860",
"annotations": []
}
]
},
"pimozide": {
"name": "pimozide",
"id": "PA450965",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104870"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product ORAP (Pimozide), NDA017473, Teva Select Brands",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=017473"
}
],
"guidelines": [
{
"id": "PA166104870",
"name": "Annotation of FDA Label for pimozide and CYP2D6",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104870",
"annotations": []
}
]
},
"piroxicam": {
"name": "piroxicam",
"id": "PA450985",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166105222"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Feldene (piroxicam), NDA018147, Pfizer Laboratories Div Pfizer Inc",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=018147"
}
],
"guidelines": [
{
"id": "PA166105222",
"name": "Annotation of FDA Label for piroxicam and CYP2C9",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166105222",
"annotations": []
}
]
},
"pitolisant": {
"name": "pitolisant",
"id": "PA166185163",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166185168"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product pitolisant NDA 211150",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=211150"
},
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Wakix (PITOLISANT HYDROCHLORIDE), Harmony Biosciences, LLC - NDA211150/SUPPL-7, 05/23/2025",
"journal": null,
"year": 2025,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=211150"
}
],
"guidelines": [
{
"id": "PA166185168",
"name": "Annotation of FDA Label for pitolisant and CYP2D6",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166185168",
"annotations": []
}
]
},
"plazomicin": {
"name": "plazomicin",
"id": "PA166228921",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166316301"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Zemdri (plazomicin) (Plazomicin), Achaogen, Inc. - NDA210303/SUPPL-7, 02/10/2023",
"journal": null,
"year": 2023,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=210303"
}
],
"guidelines": [
{
"id": "PA166316301",
"name": "Annotation of FDA Label for plazomicin and MT-RNR1",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166316301",
"annotations": []
}
]
},
"primaquine": {
"name": "primaquine",
"id": "PA451103",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "G6PD hemizygous samples",
"version": "2",
"matches": {
"gene": "G6PD",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"aminosalicylic acid",
"aspirin",
"chloramphenicol",
"chloroquine",
"ciprofloxacin",
"dapsone",
"dimercaprol",
"doxorubicin",
"furazolidone",
"glyburide",
"hydroxychloroquine",
"mafenide",
"methylene blue",
"nalidixic acid",
"nitrofurantoin",
"norfloxacin",
"ofloxacin",
"pegloticase",
"phenazopyridine",
"primaquine",
"quinine",
"rasburicase",
"sulfadiazine",
"sulfadimidine",
"sulfamethoxazole",
"trimethoprim",
"sulfanilamide",
"sulfasalazine",
"sulfisoxazole",
"tafenoquine",
"tolbutamide",
"toluidine blue",
"vitamin c",
"vitamin k"
]
},
"exception_type": "note",
"message": "PharmCAT reports based on VCF file input and some VCF files do not specify hemizygous (one X chromosome) and instead represent samples as homozygous. See PharmCAT FAQs (https://pharmcat.org/faqs/)."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104876"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Primaquine Phosphate (Primaquine Phosphate), NDA008316, PD-Rx Pharmaceuticals, Inc.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=008316"
}
],
"guidelines": [
{
"id": "PA166104876",
"name": "Annotation of FDA Label for primaquine and G6PD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104876",
"annotations": []
}
]
},
"rasburicase": {
"name": "rasburicase",
"id": "PA10176",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "G6PD hemizygous samples",
"version": "2",
"matches": {
"gene": "G6PD",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"aminosalicylic acid",
"aspirin",
"chloramphenicol",
"chloroquine",
"ciprofloxacin",
"dapsone",
"dimercaprol",
"doxorubicin",
"furazolidone",
"glyburide",
"hydroxychloroquine",
"mafenide",
"methylene blue",
"nalidixic acid",
"nitrofurantoin",
"norfloxacin",
"ofloxacin",
"pegloticase",
"phenazopyridine",
"primaquine",
"quinine",
"rasburicase",
"sulfadiazine",
"sulfadimidine",
"sulfamethoxazole",
"trimethoprim",
"sulfanilamide",
"sulfasalazine",
"sulfisoxazole",
"tafenoquine",
"tolbutamide",
"toluidine blue",
"vitamin c",
"vitamin k"
]
},
"exception_type": "note",
"message": "PharmCAT reports based on VCF file input and some VCF files do not specify hemizygous (one X chromosome) and instead represent samples as homozygous. See PharmCAT FAQs (https://pharmcat.org/faqs/)."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166151881"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Elitek (rasburicase), BLA103946, sanofi-aventis U.S. LLC",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=103946"
},
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Elitek (rasburicase), Sanofi-Aventis U.S. LLC - BLA103946/SUPPL-5103, 12/12/2019",
"journal": null,
"year": 2019,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=103946"
}
],
"guidelines": [
{
"id": "PA166151881",
"name": "Annotation of FDA Label for rasburicase and G6PD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166151881",
"annotations": []
}
]
},
"relugolix / estradiol / norethindrone acetate": {
"name": "relugolix / estradiol / norethindrone acetate",
"id": "PA166397682",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166397721"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Myfembree (relugolix, estradiol hemihydrate, and norethindrone acetate), Sumitomo Pharma America, Inc - NDA214846/SUPPL-8, 07/17/2024",
"journal": null,
"year": 2024,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=214846"
}
],
"guidelines": [
{
"id": "PA166397721",
"name": "Annotation of FDA Label for relugolix / estradiol / norethindrone acetate and F5, PROC, PROS1, SERPINC1",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166397721",
"annotations": []
}
]
},
"ropivacaine": {
"name": "ropivacaine",
"id": "PA451271",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166182728"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product NAROPIN (ropivacaine hydrochloride), NDA020533, General Injectables & Vaccines, Inc",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=020533"
}
],
"guidelines": [
{
"id": "PA166182728",
"name": "Annotation of FDA Label for ropivacaine and CYB5R3, G6PD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166182728",
"annotations": []
}
]
},
"sacituzumab govitecan": {
"name": "sacituzumab govitecan",
"id": "PA166225061",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166225101"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product sacituzumab govitecan-hziy BLA761115",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=761115"
}
],
"guidelines": [
{
"id": "PA166225101",
"name": "Annotation of FDA Label for sacituzumab govitecan and UGT1A1",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166225101",
"annotations": []
}
]
},
"seladelpar": {
"name": "seladelpar",
"id": "PA166400041",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166400441"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Livdelzi (SELADELPAR LYSINE), Gilead Sciences, Inc - NDA217899/ORIG-1, 08/14/2024",
"journal": null,
"year": 2024,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=217899"
}
],
"guidelines": [
{
"id": "PA166400441",
"name": "Annotation of FDA Label for seladelpar and CYP2C9",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166400441",
"annotations": []
}
]
},
"sevoflurane": {
"name": "sevoflurane",
"id": "PA451341",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166129519"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Ultane (Sevoflurane), NDA020478, AbbVie Inc.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=020478"
}
],
"guidelines": [
{
"id": "PA166129519",
"name": "Annotation of FDA Label for sevoflurane and CACNA1S, RYR1",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166129519",
"annotations": [
{
"implications": [],
"drugRecommendation": ""CONTRAINDICATIONS: Known or suspected genetic susceptibility to malignant hyperthermia...ULTANE [sevoflurane] can induce malignant hyperthermia in patients with known or suspected susceptibility based on genetic factors or family history, including those with certain inherited ryanodine receptor (RYR1) or dihydropyridine receptor (CACNA1S) variants." See label for more information.",
"classification": "Unspecified",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CACNA1S",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CACNA1S",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CACNA1S",
"matchScore": 4,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
},
{
"allele1": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "RYR1",
"matchScore": 0,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": [
{
"allele1": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "RYR1",
"matchScore": 626,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
],
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": true,
"otherPrescribingGuidance": false,
"phenotypes": {
"CACNA1S": "Uncertain Susceptibility",
"RYR1": "Uncertain Susceptibility"
},
"lookupKey": [
{
"RYR1": "Uncertain Susceptibility",
"CACNA1S": "Uncertain Susceptibility"
}
]
}
]
}
]
},
"siponimod": {
"name": "siponimod",
"id": "PA166182736",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166182738"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product MAYZENT (siponimod), NDA209884, Novartis Pharmaceuticals Corporation",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=209884"
}
],
"guidelines": [
{
"id": "PA166182738",
"name": "Annotation of FDA Label for siponimod and CYP2C9",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166182738",
"annotations": [
{
"implications": [],
"drugRecommendation": "The MAYZENT (siponimod) label states: "Recommended Dosage in Patients With CYP2C9 Genotypes *1/*1, *1/*2, or *2/*2" "Initiate MAYZENT with a 5-day titration, as shown in Table 1... A starter pack should be used for patients who will be titrated to the 2-mg maintenance dosage" "After treatment titration (see Treatment Initiation), the recommended maintenance dosage of MAYZENT is 2 mg taken orally once daily starting on Day 6." See label for more information.",
"classification": "Unspecified",
"activityScore": {
"CYP2C9": "2.0"
},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "CYP2C9",
"matchScore": 166,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C9": "Normal Metabolizer"
},
"lookupKey": [
{
"CYP2C9": {
"*1": 2.0
}
}
]
}
]
}
]
},
"sodium ascorbate": {
"name": "sodium ascorbate",
"id": "PA166163262",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166293282"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Ascor (Ascorbic Acid), NDA209112, McGuff Pharmaceuticals, Inc.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=209112"
}
],
"guidelines": [
{
"id": "PA166293282",
"name": "Annotation of FDA Label for Ascorbic acid (vitamin C), combinations, Ascorbic acid (vitamin C), plain, sodium ascorbate and G6PD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166293282",
"annotations": []
}
]
},
"sodium nitrite": {
"name": "sodium nitrite",
"id": "PA166115361",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166115362"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Sodium Nitrite (Sodium Nitrite), NDA203922, Hope Pharmaceuticals",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=203922"
}
],
"guidelines": [
{
"id": "PA166115362",
"name": "Annotation of FDA Label for sodium nitrite and CYB5R3, G6PD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166115362",
"annotations": []
}
]
},
"streptomycin": {
"name": "streptomycin",
"id": "PA451512",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166316361"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Streptomycin (Streptomycin), ANDA064210, XGen Pharmaceuticals DJB, Inc.",
"journal": null,
"year": 2023,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=064210"
}
],
"guidelines": [
{
"id": "PA166316361",
"name": "Annotation of FDA Label for streptomycin and MT-RNR1",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166316361",
"annotations": []
}
]
},
"succinylcholine": {
"name": "succinylcholine",
"id": "PA451522",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166122970"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Anectine (Succinylcholine Chloride), NDA008453, Sandoz Inc",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=008453"
}
],
"guidelines": [
{
"id": "PA166122970",
"name": "Annotation of FDA Label for succinylcholine and BCHE, CACNA1S, RYR1",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166122970",
"annotations": [
{
"implications": [],
"drugRecommendation": ""ANECTINE [succinylcholine] is contraindicated in patients with...[k]nown or suspected genetic susceptibility to malignant hyperthermia...Anectine [succinylcholine] can induce malignant hyperthermia in patients with known or suspected susceptibility based on genetic factors or family history, including those with certain inherited ryanodine receptor (RYR1) or dihydropyridine receptor (CACNA1S) variants...Succinylcholine is metabolized by plasma cholinesterase and should be used with caution, if at all, in patients known to be or suspected of being homozygous for the atypical plasma cholinesterase gene [BCHE] ." See label for more information.",
"classification": "Unspecified",
"activityScore": {},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CACNA1S",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CACNA1S",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CACNA1S",
"matchScore": 4,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
},
{
"allele1": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "RYR1",
"matchScore": 0,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": [
{
"allele1": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "RYR1",
"name": "Reference",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "RYR1",
"matchScore": 626,
"phenotypes": [
"Uncertain Susceptibility"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Uncertain Susceptibility"
],
"label": "Reference/Reference",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
],
"combination": false,
"diplotypeKey": {
"Reference": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": true,
"otherPrescribingGuidance": true,
"phenotypes": {
"CACNA1S": "Uncertain Susceptibility",
"RYR1": "Uncertain Susceptibility"
},
"lookupKey": [
{
"RYR1": "Uncertain Susceptibility",
"CACNA1S": "Uncertain Susceptibility"
}
]
}
]
}
]
},
"sulfasalazine": {
"name": "sulfasalazine",
"id": "PA451547",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "G6PD hemizygous samples",
"version": "2",
"matches": {
"gene": "G6PD",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"aminosalicylic acid",
"aspirin",
"chloramphenicol",
"chloroquine",
"ciprofloxacin",
"dapsone",
"dimercaprol",
"doxorubicin",
"furazolidone",
"glyburide",
"hydroxychloroquine",
"mafenide",
"methylene blue",
"nalidixic acid",
"nitrofurantoin",
"norfloxacin",
"ofloxacin",
"pegloticase",
"phenazopyridine",
"primaquine",
"quinine",
"rasburicase",
"sulfadiazine",
"sulfadimidine",
"sulfamethoxazole",
"trimethoprim",
"sulfanilamide",
"sulfasalazine",
"sulfisoxazole",
"tafenoquine",
"tolbutamide",
"toluidine blue",
"vitamin c",
"vitamin k"
]
},
"exception_type": "note",
"message": "PharmCAT reports based on VCF file input and some VCF files do not specify hemizygous (one X chromosome) and instead represent samples as homozygous. See PharmCAT FAQs (https://pharmcat.org/faqs/)."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104892"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Sulfasalazine (Sulfasalazine), NDA007073, REMEDYREPACK INC.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=007073"
}
],
"guidelines": [
{
"id": "PA166104892",
"name": "Annotation of FDA Label for sulfasalazine and G6PD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104892",
"annotations": []
}
]
},
"tafenoquine": {
"name": "tafenoquine",
"id": "PA166115580",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "G6PD hemizygous samples",
"version": "2",
"matches": {
"gene": "G6PD",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"aminosalicylic acid",
"aspirin",
"chloramphenicol",
"chloroquine",
"ciprofloxacin",
"dapsone",
"dimercaprol",
"doxorubicin",
"furazolidone",
"glyburide",
"hydroxychloroquine",
"mafenide",
"methylene blue",
"nalidixic acid",
"nitrofurantoin",
"norfloxacin",
"ofloxacin",
"pegloticase",
"phenazopyridine",
"primaquine",
"quinine",
"rasburicase",
"sulfadiazine",
"sulfadimidine",
"sulfamethoxazole",
"trimethoprim",
"sulfanilamide",
"sulfasalazine",
"sulfisoxazole",
"tafenoquine",
"tolbutamide",
"toluidine blue",
"vitamin c",
"vitamin k"
]
},
"exception_type": "note",
"message": "PharmCAT reports based on VCF file input and some VCF files do not specify hemizygous (one X chromosome) and instead represent samples as homozygous. See PharmCAT FAQs (https://pharmcat.org/faqs/)."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166182739"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Arakoda (Tafenoquine), NDA210607, 60 Degrees Pharmaceuticals, LLC",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=210607"
}
],
"guidelines": [
{
"id": "PA166182739",
"name": "Annotation of FDA Label for tafenoquine and G6PD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166182739",
"annotations": []
}
]
},
"tamsulosin": {
"name": "tamsulosin",
"id": "PA451583",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166160672"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Flomax (tamsulosin hydrochloride), NDA020579, REMEDYREPACK INC.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=020579"
}
],
"guidelines": [
{
"id": "PA166160672",
"name": "Annotation of FDA Label for tamsulosin and CYP2D6",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166160672",
"annotations": []
}
]
},
"tetrabenazine": {
"name": "tetrabenazine",
"id": "PA140222719",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104829"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Xenazine (tetrabenazine), Lundbeck Pharmaceuticals LLC - NDA021894/SUPPL-13, 09/13/2017",
"journal": null,
"year": 2017,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=021894"
}
],
"guidelines": [
{
"id": "PA166104829",
"name": "Annotation of FDA Label for tetrabenazine and CYP2D6",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104829",
"annotations": []
}
]
},
"thioguanine": {
"name": "thioguanine",
"id": "PA451663",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104838"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product TABLOID (thioguanine), NDA012429, Aspen Global Inc.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=012429"
}
],
"guidelines": [
{
"id": "PA166104838",
"name": "Annotation of FDA Label for thioguanine and NUDT15, TPMT",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104838",
"annotations": []
}
]
},
"thioridazine": {
"name": "thioridazine",
"id": "PA451666",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104805"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Thioridazine Hydrochloride (thioridazine hydrochloride), ANDA088004, REMEDYREPACK INC.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=088004"
}
],
"guidelines": [
{
"id": "PA166104805",
"name": "Annotation of FDA Label for thioridazine and CYP2D6",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104805",
"annotations": []
}
]
},
"tobramycin": {
"name": "tobramycin",
"id": "PA451704",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166316341"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product BETHKIS (tobramycin), NDA201820, Chiesi USA, Inc.",
"journal": null,
"year": 2023,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=201820"
}
],
"guidelines": [
{
"id": "PA166316341",
"name": "Annotation of FDA Label for tobramycin and MT-RNR1",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166316341",
"annotations": []
}
]
},
"tolazamide": {
"name": "tolazamide",
"id": "PA164774902",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166182786"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Tolazamide (tolazamide), ANDA070259, PD-Rx Pharmaceuticals, Inc.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=070259"
}
],
"guidelines": [
{
"id": "PA166182786",
"name": "Annotation of FDA Label for tolazamide and G6PD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166182786",
"annotations": []
}
]
},
"tolbutamide": {
"name": "tolbutamide",
"id": "PA451718",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "G6PD hemizygous samples",
"version": "2",
"matches": {
"gene": "G6PD",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"aminosalicylic acid",
"aspirin",
"chloramphenicol",
"chloroquine",
"ciprofloxacin",
"dapsone",
"dimercaprol",
"doxorubicin",
"furazolidone",
"glyburide",
"hydroxychloroquine",
"mafenide",
"methylene blue",
"nalidixic acid",
"nitrofurantoin",
"norfloxacin",
"ofloxacin",
"pegloticase",
"phenazopyridine",
"primaquine",
"quinine",
"rasburicase",
"sulfadiazine",
"sulfadimidine",
"sulfamethoxazole",
"trimethoprim",
"sulfanilamide",
"sulfasalazine",
"sulfisoxazole",
"tafenoquine",
"tolbutamide",
"toluidine blue",
"vitamin c",
"vitamin k"
]
},
"exception_type": "note",
"message": "PharmCAT reports based on VCF file input and some VCF files do not specify hemizygous (one X chromosome) and instead represent samples as homozygous. See PharmCAT FAQs (https://pharmcat.org/faqs/)."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166182787"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Tolbutamide (tolbutamide), ANDA086445, Mylan Pharmaceuticals Inc.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=086445"
}
],
"guidelines": [
{
"id": "PA166182787",
"name": "Annotation of FDA Label for tolbutamide and G6PD",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166182787",
"annotations": []
}
]
},
"tramadol": {
"name": "tramadol",
"id": "PA451735",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104799"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product ULTRAM (tramadol hydrochloride), NDA020281, Janssen Pharmaceuticals, Inc.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=020281"
}
],
"guidelines": [
{
"id": "PA166104799",
"name": "Annotation of FDA Label for tramadol and CYP2D6",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104799",
"annotations": []
}
]
},
"valbenazine": {
"name": "valbenazine",
"id": "PA166170051",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166170052"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product INGREZZA (Valbenazine), NDA209241, Neurocrine Biosciences, Inc.",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=209241"
}
],
"guidelines": [
{
"id": "PA166170052",
"name": "Annotation of FDA Label for valbenazine and CYP2D6",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166170052",
"annotations": []
}
]
},
"vortioxetine": {
"name": "vortioxetine",
"id": "PA166122595",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166122607"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product Trintellix (vortioxetine), NDA204447, Cardinal Health",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=204447"
}
],
"guidelines": [
{
"id": "PA166122607",
"name": "Annotation of FDA Label for vortioxetine and CYP2D6",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166122607",
"annotations": []
}
]
},
"warfarin": {
"name": "warfarin",
"id": "PA451906",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/labelAnnotation/PA166104776"
],
"citations": [
{
"pmid": null,
"title": "Drugs@FDA: Drug Product COUMADIN (warfarin sodium), NDA009218, Bristol-Myers Squibb Pharma Company",
"journal": null,
"year": -1,
"_sameAs": "https://www.accessdata.fda.gov/scripts/cder/daf/index.cfm?event=overview.process&varApplNo=009218"
}
],
"guidelines": [
{
"id": "PA166104776",
"name": "Annotation of FDA Label for warfarin and CYP2C9, VKORC1",
"source": "FDA_LABEL",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/labelAnnotation/PA166104776",
"annotations": [
{
"implications": [],
"drugRecommendation": "Table 1 in the drug label provides ranges of expected maintenance daily doses of warfarin (COUMADIN) based on CYP2C9*2, CYP2C9*3 and VKORC1−1639G>A (rs9923231) genotypes. For CYP2C9*1/*1, VKORC1 GG (rs9923231CC), the range of expected maintenance daily dose is 5-7 mg.",
"classification": "Unspecified",
"activityScore": {
"CYP2C9": "2.0",
"VKORC1": "n/a"
},
"population": null,
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"allele2": {
"gene": "CYP2C9",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "1.0"
},
"gene": "CYP2C9",
"matchScore": 166,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": "2.0",
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"2.0"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
},
{
"allele1": {
"gene": "VKORC1",
"name": "rs9923231 reference (C)",
"function": "Normal coumarin sensitivity",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "VKORC1",
"name": "rs9923231 reference (C)",
"function": "Normal coumarin sensitivity",
"reference": true,
"activityValue": "n/a"
},
"gene": "VKORC1",
"matchScore": 2,
"phenotypes": [
"-1639 GG"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"-1639 GG"
],
"label": "rs9923231 reference (C)/rs9923231 reference (C)",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"rs9923231 reference (C)": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C9": "Normal Metabolizer",
"VKORC1": "-1639 GG"
},
"lookupKey": [
{
"CYP2C9": {
"*1": 2.0
},
"VKORC1": {
"rs9923231 reference (C)": 2.0
}
}
]
}
]
}
]
}
},
"FDA PGx Association": {
"abacavir": {
"name": "abacavir",
"id": "PA448004",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329541"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329541",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Abacavir - HLA-B",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329541",
"annotations": []
}
]
},
"abrocitinib": {
"name": "abrocitinib",
"id": "PA166272921",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329542"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329542",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Abrocitinib - CYP2C19",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329542",
"annotations": [
{
"implications": [],
"drugRecommendation": ""Results in higher systemic concentrations and may result in higher adverse reaction risk. Dosage adjustment is recommended. Refer to FDA labeling for specific dosing recommendations."",
"classification": "Unspecified",
"activityScore": {},
"population": "Affected subgroup: CYP2C19 poor metabolizers",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 6,
"phenotypes": [
"Poor Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Poor Metabolizer"
],
"label": "*2/*2",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*2": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Poor Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Poor Metabolizer"
}
]
}
]
}
]
},
"allopurinol": {
"name": "allopurinol",
"id": "PA448320",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329603"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329603",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Indicate a Potential Impact on Safety or Response]: Allopurinol - HLA-B",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329603",
"annotations": []
}
]
},
"amifampridine": {
"name": "amifampridine",
"id": "PA166185150",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329543"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329543",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Amifampridine - NAT2",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329543",
"annotations": []
}
]
},
"amifampridine phosphate": {
"name": "amifampridine phosphate",
"id": "PA166182002",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329544"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329544",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Amifampridine Phosphate - NAT2",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329544",
"annotations": []
}
]
},
"amitriptyline": {
"name": "amitriptyline",
"id": "PA448385",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329627"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329627",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Amitriptyline - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329627",
"annotations": []
}
]
},
"amoxapine": {
"name": "amoxapine",
"id": "PA448405",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329628"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329628",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Amoxapine - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329628",
"annotations": []
}
]
},
"amphetamine": {
"name": "amphetamine",
"id": "PA448408",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329545"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329545",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Amphetamine - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329545",
"annotations": []
}
]
},
"aripiprazole": {
"name": "aripiprazole",
"id": "PA10026",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329546"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329546",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Aripiprazole - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329546",
"annotations": []
}
]
},
"aripiprazole lauroxil": {
"name": "aripiprazole lauroxil",
"id": "PA166161216",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329547"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329547",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Aripiprazole Lauroxil - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329547",
"annotations": []
}
]
},
"atomoxetine": {
"name": "atomoxetine",
"id": "PA134688071",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329548"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329548",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Atomoxetine - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329548",
"annotations": []
}
]
},
"atorvastatin": {
"name": "atorvastatin",
"id": "PA448500",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "SLCO1B1-drug text",
"version": "1",
"matches": {
"gene": "SLCO1B1",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"simvastatin",
"rosuvastatin",
"pravastatin",
"pitavastatin",
"lovastatin",
"fluvastatin",
"atorvastatin"
]
},
"exception_type": "note",
"message": "The SLCO1B1 genotype (star nomenclature) will be displayed if determinable with the provided VCF based on the SLCO1B1 star allele definition published by CPIC and recommendations are provided based on the genotype.
In case no genotype can be determined, recommendations are based on the rs4149056 genotype alone as per guideline. The minor C allele at rs4149056 defines SLCO1B1*5."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329629"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329629",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Atorvastatin - SLCO1B1",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329629",
"annotations": []
}
]
},
"avatrombopag": {
"name": "avatrombopag",
"id": "PA166179849",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329630"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329630",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Avatrombopag - CYP2C9",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329630",
"annotations": []
}
]
},
"azathioprine": {
"name": "azathioprine",
"id": "PA448515",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329549"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329549",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Azathioprine - TPMT and/or NUDT15",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329549",
"annotations": []
}
]
},
"belinostat": {
"name": "belinostat",
"id": "PA165971474",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329550"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329550",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Belinostat - UGT1A1",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329550",
"annotations": []
}
]
},
"belzutifan": {
"name": "belzutifan",
"id": "PA166268761",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329551"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329551",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Belzutifan - CYP2C19 and/or UGT2B17",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329551",
"annotations": [
{
"implications": [],
"drugRecommendation": ""Results in higher systemic concentrations and may result in higher adverse reaction risk (anemia, hypoxia). Monitor patients who are poor metabolizers for both genes for adverse reactions."",
"classification": "Unspecified",
"activityScore": {},
"population": "Affected subgroup: CYP2C19 and/or UGT2B17 poor metabolizers",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 6,
"phenotypes": [
"Poor Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Poor Metabolizer"
],
"label": "*2/*2",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*2": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": true,
"phenotypes": {
"CYP2C19": "Poor Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Poor Metabolizer"
}
]
}
]
}
]
},
"brexpiprazole": {
"name": "brexpiprazole",
"id": "PA166160053",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329552"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329552",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Brexpiprazole - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329552",
"annotations": []
}
]
},
"brivaracetam": {
"name": "brivaracetam",
"id": "PA166153491",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329553"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329553",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Brivaracetam - CYP2C19",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329553",
"annotations": [
{
"implications": [],
"drugRecommendation": ""Results in higher systemic concentrations and higher adverse reaction risk. Consider dosage reductions in poor metabolizers."",
"classification": "Unspecified",
"activityScore": {},
"population": "Affected subgroup: CYP2C19 intermediate or poor metabolizers",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 6,
"phenotypes": [
"Poor Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Poor Metabolizer"
],
"label": "*2/*2",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*2": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Poor Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Poor Metabolizer"
}
]
}
]
}
]
},
"capecitabine": {
"name": "capecitabine",
"id": "PA448771",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329554"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329554",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Capecitabine - DPYD",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329554",
"annotations": []
}
]
},
"carbamazepine": {
"name": "carbamazepine",
"id": "PA448785",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329604",
"https://www.clinpgx.org/fdaPgxAssociations#PA166329555"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329604",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Indicate a Potential Impact on Safety or Response]: Carbamazepine - HLA-A",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329604",
"annotations": []
},
{
"id": "PA166329555",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Carbamazepine - HLA-B",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329555",
"annotations": []
}
]
},
"carisoprodol": {
"name": "carisoprodol",
"id": "PA448809",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329631"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329631",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Carisoprodol - CYP2C19",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329631",
"annotations": [
{
"implications": [],
"drugRecommendation": ""Results in higher systemic concentrations. Use with caution."",
"classification": "Unspecified",
"activityScore": {},
"population": "Affected subgroup: CYP2C19 poor metabolizers",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 6,
"phenotypes": [
"Poor Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Poor Metabolizer"
],
"label": "*2/*2",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*2": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": true,
"phenotypes": {
"CYP2C19": "Poor Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Poor Metabolizer"
}
]
}
]
}
]
},
"carvedilol": {
"name": "carvedilol",
"id": "PA448817",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329605"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329605",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Indicate a Potential Impact on Safety or Response]: Carvedilol - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329605",
"annotations": []
}
]
},
"celecoxib": {
"name": "celecoxib",
"id": "PA448871",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329556"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329556",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Celecoxib - CYP2C9",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329556",
"annotations": []
}
]
},
"cevimeline": {
"name": "cevimeline",
"id": "PA164754754",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329606"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329606",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Indicate a Potential Impact on Safety or Response]: Cevimeline - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329606",
"annotations": []
}
]
},
"citalopram": {
"name": "citalopram",
"id": "PA449015",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329557"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329557",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Citalopram - CYP2C19",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329557",
"annotations": [
{
"implications": [],
"drugRecommendation": ""Results in higher systemic concentrations and adverse reaction risk (QT prolongation). The maximum recommended dose is 20 mg."",
"classification": "Unspecified",
"activityScore": {},
"population": "Affected subgroup: CYP2C19 poor metabolizers",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 6,
"phenotypes": [
"Poor Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Poor Metabolizer"
],
"label": "*2/*2",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*2": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Poor Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Poor Metabolizer"
}
]
}
]
}
]
},
"clobazam": {
"name": "clobazam",
"id": "PA10888",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329558"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329558",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Clobazam - CYP2C19",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329558",
"annotations": [
{
"implications": [],
"drugRecommendation": ""Results in higher systemic active metabolite concentrations. Poor metabolism results in higher adverse reaction risk. Dosage adjustment is recommended. Refer to FDA labeling for specific dosing recommendations."",
"classification": "Unspecified",
"activityScore": {},
"population": "Affected subgroup: CYP2C19 intermediate or poor metabolizers",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 6,
"phenotypes": [
"Poor Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Poor Metabolizer"
],
"label": "*2/*2",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*2": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Poor Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Poor Metabolizer"
}
]
}
]
}
]
},
"clomipramine": {
"name": "clomipramine",
"id": "PA449048",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329632"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329632",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Clomipramine - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329632",
"annotations": []
}
]
},
"clopidogrel": {
"name": "clopidogrel",
"id": "PA449053",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329559"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329559",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Clopidogrel - CYP2C19",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329559",
"annotations": [
{
"implications": [],
"drugRecommendation": ""Results in lower systemic active metabolite concentrations, lower antiplatelet response, and may result in higher cardiovascular risk. Consider use of another platelet P2Y12 inhibitor."",
"classification": "Unspecified",
"activityScore": {},
"population": "Affected subgroup: CYP2C19 intermediate or poor metabolizers",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 6,
"phenotypes": [
"Poor Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Poor Metabolizer"
],
"label": "*2/*2",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*2": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": true,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Poor Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Poor Metabolizer"
}
]
}
]
}
]
},
"clozapine": {
"name": "clozapine",
"id": "PA449061",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329560"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329560",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Clozapine - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329560",
"annotations": []
}
]
},
"codeine": {
"name": "codeine",
"id": "PA449088",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329607",
"https://www.clinpgx.org/fdaPgxAssociations#PA166329561"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329607",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Indicate a Potential Impact on Safety or Response]: Codeine - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329607",
"annotations": []
},
{
"id": "PA166329561",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Codeine - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329561",
"annotations": []
}
]
},
"darifenacin": {
"name": "darifenacin",
"id": "PA164774901",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329633"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329633",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Darifenacin - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329633",
"annotations": []
}
]
},
"desipramine": {
"name": "desipramine",
"id": "PA449233",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329634"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329634",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Desipramine - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329634",
"annotations": []
}
]
},
"deutetrabenazine": {
"name": "deutetrabenazine",
"id": "PA166169881",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329562"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329562",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Deutetrabenazine - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329562",
"annotations": []
}
]
},
"dexlansoprazole": {
"name": "dexlansoprazole",
"id": "PA166110257",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329635"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329635",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Dexlansoprazole - CYP2C19",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329635",
"annotations": [
{
"implications": [],
"drugRecommendation": ""Results in higher systemic concentrations."",
"classification": "Unspecified",
"activityScore": {},
"population": "Affected subgroup: CYP2C19 intermediate or poor metabolizers",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 6,
"phenotypes": [
"Poor Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Poor Metabolizer"
],
"label": "*2/*2",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*2": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Poor Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Poor Metabolizer"
}
]
}
]
}
]
},
"diazepam": {
"name": "diazepam",
"id": "PA449283",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329636"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329636",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Diazepam - CYP2C19",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329636",
"annotations": [
{
"implications": [],
"drugRecommendation": ""May affect systemic concentrations."",
"classification": "Unspecified",
"activityScore": {},
"population": "Affected subgroup: CYP2C19 poor metabolizers",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 6,
"phenotypes": [
"Poor Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Poor Metabolizer"
],
"label": "*2/*2",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*2": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Poor Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Poor Metabolizer"
}
]
}
]
}
]
},
"dolutegravir": {
"name": "dolutegravir",
"id": "PA166114961",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329637"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329637",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Dolutegravir - UGT1A1",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329637",
"annotations": []
}
]
},
"donepezil": {
"name": "donepezil",
"id": "PA449394",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329638"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329638",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Donepezil - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329638",
"annotations": []
}
]
},
"doxepin": {
"name": "doxepin",
"id": "PA449409",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329639",
"https://www.clinpgx.org/fdaPgxAssociations#PA166329640"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329639",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Doxepin - CYP2C19",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329639",
"annotations": [
{
"implications": [],
"drugRecommendation": ""Results in higher systemic concentrations."",
"classification": "Unspecified",
"activityScore": {},
"population": "Affected subgroup: CYP2C19 intermediate or poor metabolizers",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 6,
"phenotypes": [
"Poor Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Poor Metabolizer"
],
"label": "*2/*2",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*2": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Poor Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Poor Metabolizer"
}
]
}
]
},
{
"id": "PA166329640",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Doxepin - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329640",
"annotations": []
}
]
},
"dronabinol": {
"name": "dronabinol",
"id": "PA449421",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329563"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329563",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Dronabinol - CYP2C9",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329563",
"annotations": []
}
]
},
"efavirenz": {
"name": "efavirenz",
"id": "PA449441",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "CYP2B6 *1/*6 warning",
"version": "1",
"matches": {
"gene": "CYP2B6",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [
"*1/*6"
],
"drugs": [
"efavirenz"
]
},
"exception_type": "ambiguity",
"message": "The assigned genotype is *1/*6; however, *4/*9 cannot be ruled out without phased data."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329608"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329608",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Indicate a Potential Impact on Safety or Response]: Efavirenz - CYP2B6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329608",
"annotations": []
}
]
},
"elagolix": {
"name": "elagolix",
"id": "PA166182348",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329641"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329641",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Elagolix - SLCO1B1",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329641",
"annotations": []
}
]
},
"eliglustat": {
"name": "eliglustat",
"id": "PA166123486",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329564"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329564",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Eliglustat - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329564",
"annotations": []
}
]
},
"erdafitinib": {
"name": "erdafitinib",
"id": "PA166182720",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329565"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329565",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Erdafitinib - CYP2C9",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329565",
"annotations": []
}
]
},
"escitalopram": {
"name": "escitalopram",
"id": "PA10074",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329642"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329642",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Escitalopram - CYP2C19",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329642",
"annotations": [
{
"implications": [],
"drugRecommendation": ""May alter systemic concentrations."",
"classification": "Unspecified",
"activityScore": {},
"population": "Affected subgroup: CYP2C19 ultrarapid, intermediate, or poor metabolizers",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 6,
"phenotypes": [
"Poor Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Poor Metabolizer"
],
"label": "*2/*2",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*2": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Poor Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Poor Metabolizer"
}
]
}
]
}
]
},
"esomeprazole": {
"name": "esomeprazole",
"id": "PA10075",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329643"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329643",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Esomeprazole - CYP2C19",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329643",
"annotations": [
{
"implications": [],
"drugRecommendation": ""Results in higher systemic concentrations."",
"classification": "Unspecified",
"activityScore": {},
"population": "Affected subgroup: CYP2C19 poor metabolizers",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 6,
"phenotypes": [
"Poor Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Poor Metabolizer"
],
"label": "*2/*2",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*2": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Poor Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Poor Metabolizer"
}
]
}
]
}
]
},
"fesoterodine": {
"name": "fesoterodine",
"id": "PA165958376",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329644"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329644",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Fesoterodine - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329644",
"annotations": []
}
]
},
"flibanserin": {
"name": "flibanserin",
"id": "PA166153431",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329566"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329566",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Flibanserin - CYP2C19",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329566",
"annotations": [
{
"implications": [],
"drugRecommendation": ""May result in higher systemic concentrations and higher adverse reaction risk. Monitor patients for adverse reactions."",
"classification": "Unspecified",
"activityScore": {},
"population": "Affected subgroup: CYP2C19 poor metabolizers",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 6,
"phenotypes": [
"Poor Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Poor Metabolizer"
],
"label": "*2/*2",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*2": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": true,
"phenotypes": {
"CYP2C19": "Poor Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Poor Metabolizer"
}
]
}
]
}
]
},
"fluorouracil": {
"name": "fluorouracil",
"id": "PA128406956",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329568"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329568",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Fluorouracil - DPYD",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329568",
"annotations": []
}
]
},
"flurbiprofen": {
"name": "flurbiprofen",
"id": "PA449683",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329567"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329567",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Flurbiprofen - CYP2C9",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329567",
"annotations": []
}
]
},
"fluvoxamine": {
"name": "fluvoxamine",
"id": "PA449690",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329645"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329645",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Fluvoxamine - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329645",
"annotations": []
}
]
},
"fosphenytoin": {
"name": "fosphenytoin",
"id": "PA164746820",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "Phenytoin_HLA-B warning",
"version": "1",
"matches": {
"gene": null,
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"phenytoin",
"fosphenytoin"
]
},
"exception_type": "note",
"message": "The displayed recommendation for CYP2C9 and phenytoin is ONLY valid for non-carriers of the HLA-B*15:02 high-risk allele. PharmCAT Named Allele Matcher does not determine HLA status. CPIC guidance: Fos-/Phenytoin is contraindicated in individuals with the HLA-B*15:02 variant allele (\"HLA-B*15:02-positive\") due to significantly increased risk of fos-/phenytoin-induced cutaneous adverse reactions of Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN). In HLA-B*15:02 carriers, carbamazepine should not be used as an alternative. Alternative medications such as oxcarbazepine, eslicarbazepine acetate, and lamotrigine have some evidence linking SJS/TEN with the HLA-B*15:02 allele, and thus caution should be used in choosing alternatives to phenytoin."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329569",
"https://www.clinpgx.org/fdaPgxAssociations#PA166329570"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329569",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Fosphenytoin - CYP2C9",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329569",
"annotations": []
},
{
"id": "PA166329570",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Fosphenytoin - HLA-B",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329570",
"annotations": []
}
]
},
"galantamine": {
"name": "galantamine",
"id": "PA449726",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329646"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329646",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Galantamine - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329646",
"annotations": []
}
]
},
"gefitinib": {
"name": "gefitinib",
"id": "PA131301952",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329571"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329571",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Gefitinib - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329571",
"annotations": []
}
]
},
"hydralazine": {
"name": "hydralazine",
"id": "PA449894",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329647"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329647",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Hydralazine - Nonspecific (NAT)",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329647",
"annotations": []
}
]
},
"ibuprofen": {
"name": "ibuprofen",
"id": "PA449957",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329648"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329648",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Ibuprofen - CYP2C9",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329648",
"annotations": []
}
]
},
"iloperidone": {
"name": "iloperidone",
"id": "PA161199368",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329572"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329572",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Iloperidone - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329572",
"annotations": []
}
]
},
"imipramine": {
"name": "imipramine",
"id": "PA449969",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329649"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329649",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Imipramine - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329649",
"annotations": []
}
]
},
"irinotecan": {
"name": "irinotecan",
"id": "PA450085",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329573"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329573",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Irinotecan - UGT1A1",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329573",
"annotations": []
}
]
},
"isoniazid": {
"name": "isoniazid",
"id": "PA450112",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329609"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329609",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Indicate a Potential Impact on Safety or Response]: Isoniazid - Nonspecific (NAT)",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329609",
"annotations": []
}
]
},
"lansoprazole": {
"name": "lansoprazole",
"id": "PA450180",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329650"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329650",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Lansoprazole - CYP2C19",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329650",
"annotations": [
{
"implications": [],
"drugRecommendation": ""Results in higher systemic concentrations."",
"classification": "Unspecified",
"activityScore": {},
"population": "Affected subgroup: CYP2C19 poor metabolizers",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 6,
"phenotypes": [
"Poor Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Poor Metabolizer"
],
"label": "*2/*2",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*2": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Poor Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Poor Metabolizer"
}
]
}
]
}
]
},
"lofexidine": {
"name": "lofexidine",
"id": "PA164744510",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329574"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329574",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Lofexidine - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329574",
"annotations": []
}
]
},
"mavacamten": {
"name": "mavacamten",
"id": "PA166272922",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329612"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329612",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Indicate a Potential Impact on Safety or Response]: Mavacamten - CYP2C19",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329612",
"annotations": [
{
"implications": [],
"drugRecommendation": ""Results in higher systemic concentrations and may have higher adverse reaction risk (heart failure). Dosage is based on individual response. The dose titration and monitoring schedule accounts for differences due to CYP2C19 genetic variation, so adjustments based on CYP2C19 genotype are not necessary. Refer to FDA labeling for specific dosing recommendations and monitoring."",
"classification": "Unspecified",
"activityScore": {},
"population": "Affected subgroup: CYP2C19 intermediate or poor metabolizers",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 6,
"phenotypes": [
"Poor Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Poor Metabolizer"
],
"label": "*2/*2",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*2": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": true,
"phenotypes": {
"CYP2C19": "Poor Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Poor Metabolizer"
}
]
}
]
}
]
},
"meclizine": {
"name": "meclizine",
"id": "PA450338",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329575"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329575",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Meclizine - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329575",
"annotations": []
}
]
},
"meloxicam": {
"name": "meloxicam",
"id": "PA450353",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329576"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329576",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Meloxicam - CYP2C9",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329576",
"annotations": []
}
]
},
"mercaptopurine": {
"name": "mercaptopurine",
"id": "PA450379",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329578"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329578",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Mercaptopurine - TPMT and/or NUDT15",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329578",
"annotations": []
}
]
},
"metoclopramide": {
"name": "metoclopramide",
"id": "PA450475",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329577"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329577",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Metoclopramide - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329577",
"annotations": []
}
]
},
"metoprolol": {
"name": "metoprolol",
"id": "PA450480",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329651"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329651",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Metoprolol - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329651",
"annotations": []
}
]
},
"mirabegron": {
"name": "mirabegron",
"id": "PA166177513",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329652"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329652",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Mirabegron - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329652",
"annotations": []
}
]
},
"nateglinide": {
"name": "nateglinide",
"id": "PA450600",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329580"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329580",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Nateglinide - CYP2C9",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329580",
"annotations": []
}
]
},
"nebivolol": {
"name": "nebivolol",
"id": "PA151958426",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329653"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329653",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Nebivolol - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329653",
"annotations": []
}
]
},
"nilotinib": {
"name": "nilotinib",
"id": "PA165958345",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329613"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329613",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Indicate a Potential Impact on Safety or Response]: Nilotinib - UGT1A1",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329613",
"annotations": []
}
]
},
"nortriptyline": {
"name": "nortriptyline",
"id": "PA450657",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329654"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329654",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Nortriptyline - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329654",
"annotations": []
}
]
},
"oliceridine": {
"name": "oliceridine",
"id": "PA166223601",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329581"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329581",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Oliceridine - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329581",
"annotations": []
}
]
},
"omeprazole": {
"name": "omeprazole",
"id": "PA450704",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329655"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329655",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Omeprazole - CYP2C19",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329655",
"annotations": [
{
"implications": [],
"drugRecommendation": ""Results in higher systemic concentrations."",
"classification": "Unspecified",
"activityScore": {},
"population": "Affected subgroup: CYP2C19 intermediate or poor metabolizers",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 6,
"phenotypes": [
"Poor Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Poor Metabolizer"
],
"label": "*2/*2",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*2": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Poor Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Poor Metabolizer"
}
]
}
]
}
]
},
"oxcarbazepine": {
"name": "oxcarbazepine",
"id": "PA450732",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329616"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329616",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Indicate a Potential Impact on Safety or Response]: Oxcarbazepine - HLA-B",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329616",
"annotations": []
}
]
},
"pantoprazole": {
"name": "pantoprazole",
"id": "PA450774",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329582"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329582",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Pantoprazole - CYP2C19",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329582",
"annotations": [
{
"implications": [],
"drugRecommendation": ""Results in higher systemic concentrations. Consider dosage reduction in children who are poor metabolizers. No dosage adjustment is needed for adult patients who are intermediate or poor metabolizers."",
"classification": "Unspecified",
"activityScore": {},
"population": "Pediatrics; Affected subgroup: CYP2C19 intermediate or poor metabolizers",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 6,
"phenotypes": [
"Poor Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Poor Metabolizer"
],
"label": "*2/*2",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*2": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Poor Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Poor Metabolizer"
}
]
}
]
}
]
},
"paroxetine": {
"name": "paroxetine",
"id": "PA450801",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329656"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329656",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Paroxetine - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329656",
"annotations": []
}
]
},
"pazopanib": {
"name": "pazopanib",
"id": "PA165291492",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329617",
"https://www.clinpgx.org/fdaPgxAssociations#PA166329618"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329617",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Indicate a Potential Impact on Safety or Response]: Pazopanib - HLA-B",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329617",
"annotations": []
},
{
"id": "PA166329618",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Indicate a Potential Impact on Safety or Response]: Pazopanib - UGT1A1",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329618",
"annotations": []
}
]
},
"perphenazine": {
"name": "perphenazine",
"id": "PA450882",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329619"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329619",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Indicate a Potential Impact on Safety or Response]: Perphenazine - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329619",
"annotations": []
}
]
},
"phenytoin": {
"name": "phenytoin",
"id": "PA450947",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "Phenytoin_HLA-B warning",
"version": "1",
"matches": {
"gene": null,
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"phenytoin",
"fosphenytoin"
]
},
"exception_type": "note",
"message": "The displayed recommendation for CYP2C9 and phenytoin is ONLY valid for non-carriers of the HLA-B*15:02 high-risk allele. PharmCAT Named Allele Matcher does not determine HLA status. CPIC guidance: Fos-/Phenytoin is contraindicated in individuals with the HLA-B*15:02 variant allele (\"HLA-B*15:02-positive\") due to significantly increased risk of fos-/phenytoin-induced cutaneous adverse reactions of Stevens-Johnson syndrome (SJS) and toxic epidermal necrolysis (TEN). In HLA-B*15:02 carriers, carbamazepine should not be used as an alternative. Alternative medications such as oxcarbazepine, eslicarbazepine acetate, and lamotrigine have some evidence linking SJS/TEN with the HLA-B*15:02 allele, and thus caution should be used in choosing alternatives to phenytoin."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329583",
"https://www.clinpgx.org/fdaPgxAssociations#PA166329584"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329583",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Phenytoin - CYP2C9",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329583",
"annotations": []
},
{
"id": "PA166329584",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Phenytoin - HLA-B",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329584",
"annotations": []
}
]
},
"pimozide": {
"name": "pimozide",
"id": "PA450965",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329585"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329585",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Pimozide - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329585",
"annotations": []
}
]
},
"piroxicam": {
"name": "piroxicam",
"id": "PA450985",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329586"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329586",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Piroxicam - CYP2C9",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329586",
"annotations": []
}
]
},
"pitolisant": {
"name": "pitolisant",
"id": "PA166185163",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329587"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329587",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Pitolisant - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329587",
"annotations": []
}
]
},
"procainamide": {
"name": "procainamide",
"id": "PA451108",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329620"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329620",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Indicate a Potential Impact on Safety or Response]: Procainamide - Nonspecific (NAT)",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329620",
"annotations": []
}
]
},
"propafenone": {
"name": "propafenone",
"id": "PA451131",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329588"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329588",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Propafenone - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329588",
"annotations": []
}
]
},
"propranolol": {
"name": "propranolol",
"id": "PA451145",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329614"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329614",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Propranolol - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329614",
"annotations": []
}
]
},
"protriptyline": {
"name": "protriptyline",
"id": "PA451168",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329615"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329615",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Protriptyline - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329615",
"annotations": []
}
]
},
"rabeprazole": {
"name": "rabeprazole",
"id": "PA451216",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329657"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329657",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Rabeprazole - CYP2C19",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329657",
"annotations": [
{
"implications": [],
"drugRecommendation": ""Results in higher systemic concentrations."",
"classification": "Unspecified",
"activityScore": {},
"population": "Affected subgroup: CYP2C19 poor metabolizers",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 6,
"phenotypes": [
"Poor Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Poor Metabolizer"
],
"label": "*2/*2",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*2": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP2C19": "Poor Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Poor Metabolizer"
}
]
}
]
}
]
},
"raltegravir": {
"name": "raltegravir",
"id": "PA164888966",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329658"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329658",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Raltegravir - UGT1A1",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329658",
"annotations": []
}
]
},
"risperidone": {
"name": "risperidone",
"id": "PA451257",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329659"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329659",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Risperidone - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329659",
"annotations": []
}
]
},
"rosuvastatin": {
"name": "rosuvastatin",
"id": "PA134308647",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "SLCO1B1-drug text",
"version": "1",
"matches": {
"gene": "SLCO1B1",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"simvastatin",
"rosuvastatin",
"pravastatin",
"pitavastatin",
"lovastatin",
"fluvastatin",
"atorvastatin"
]
},
"exception_type": "note",
"message": "The SLCO1B1 genotype (star nomenclature) will be displayed if determinable with the provided VCF based on the SLCO1B1 star allele definition published by CPIC and recommendations are provided based on the genotype.
In case no genotype can be determined, recommendations are based on the rs4149056 genotype alone as per guideline. The minor C allele at rs4149056 defines SLCO1B1*5."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329660"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329660",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Rosuvastatin - SLCO1B1",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329660",
"annotations": []
}
]
},
"sacituzumab govitecan": {
"name": "sacituzumab govitecan",
"id": "PA166225061",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329589"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329589",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Sacituzumab Govitecan-hziy - UGT1A1",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329589",
"annotations": []
}
]
},
"simvastatin": {
"name": "simvastatin",
"id": "PA451363",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "SLCO1B1-drug text",
"version": "1",
"matches": {
"gene": "SLCO1B1",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"simvastatin",
"rosuvastatin",
"pravastatin",
"pitavastatin",
"lovastatin",
"fluvastatin",
"atorvastatin"
]
},
"exception_type": "note",
"message": "The SLCO1B1 genotype (star nomenclature) will be displayed if determinable with the provided VCF based on the SLCO1B1 star allele definition published by CPIC and recommendations are provided based on the genotype.
In case no genotype can be determined, recommendations are based on the rs4149056 genotype alone as per guideline. The minor C allele at rs4149056 defines SLCO1B1*5."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329621"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329621",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Indicate a Potential Impact on Safety or Response]: Simvastatin - SLCO1B1",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329621",
"annotations": []
}
]
},
"siponimod": {
"name": "siponimod",
"id": "PA166182736",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329590"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329590",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Siponimod - CYP2C9",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329590",
"annotations": []
}
]
},
"sulfamethoxazole / trimethoprim": {
"name": "sulfamethoxazole / trimethoprim",
"id": "PA10715",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329622"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329622",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Indicate a Potential Impact on Safety or Response]: Sulfamethoxazole and Trimethoprim - Nonspecific (NAT)",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329622",
"annotations": []
}
]
},
"sulfasalazine": {
"name": "sulfasalazine",
"id": "PA451547",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [
{
"rule_name": "G6PD hemizygous samples",
"version": "2",
"matches": {
"gene": "G6PD",
"hapsCalled": [],
"hapsMissing": [],
"variantsMissing": [],
"variant": [],
"dips": [],
"drugs": [
"aminosalicylic acid",
"aspirin",
"chloramphenicol",
"chloroquine",
"ciprofloxacin",
"dapsone",
"dimercaprol",
"doxorubicin",
"furazolidone",
"glyburide",
"hydroxychloroquine",
"mafenide",
"methylene blue",
"nalidixic acid",
"nitrofurantoin",
"norfloxacin",
"ofloxacin",
"pegloticase",
"phenazopyridine",
"primaquine",
"quinine",
"rasburicase",
"sulfadiazine",
"sulfadimidine",
"sulfamethoxazole",
"trimethoprim",
"sulfanilamide",
"sulfasalazine",
"sulfisoxazole",
"tafenoquine",
"tolbutamide",
"toluidine blue",
"vitamin c",
"vitamin k"
]
},
"exception_type": "note",
"message": "PharmCAT reports based on VCF file input and some VCF files do not specify hemizygous (one X chromosome) and instead represent samples as homozygous. See PharmCAT FAQs (https://pharmcat.org/faqs/)."
}
],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329623"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329623",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Indicate a Potential Impact on Safety or Response]: Sulfasalazine - Nonspecific (NAT)",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329623",
"annotations": []
}
]
},
"tacrolimus": {
"name": "tacrolimus",
"id": "PA451578",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329592"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329592",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Tacrolimus - CYP3A5",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329592",
"annotations": [
{
"implications": [],
"drugRecommendation": ""Results in lower systemic concentrations, lower probability of achieving target concentrations and may result in higher rejection risk. Measure drug concentrations and adjust dosage based on trough whole blood tacrolimus concentrations."",
"classification": "Unspecified",
"activityScore": {},
"population": "Affected subgroup: CYP3A5 intermediate or normal metabolizers",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP3A5",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP3A5",
"name": "*1",
"function": "Normal function",
"reference": true,
"activityValue": "n/a"
},
"gene": "CYP3A5",
"matchScore": 10,
"phenotypes": [
"Normal Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Normal Metabolizer"
],
"label": "*1/*1",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*1": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": true,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": false,
"phenotypes": {
"CYP3A5": "Normal Metabolizer"
},
"lookupKey": [
{
"CYP3A5": "Normal Metabolizer"
}
]
}
]
}
]
},
"tamoxifen": {
"name": "tamoxifen",
"id": "PA451581",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329661"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329661",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Tamoxifen - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329661",
"annotations": []
}
]
},
"tamsulosin": {
"name": "tamsulosin",
"id": "PA451583",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329662"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329662",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Tamsulosin - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329662",
"annotations": []
}
]
},
"tetrabenazine": {
"name": "tetrabenazine",
"id": "PA140222719",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329593"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329593",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Tetrabenazine - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329593",
"annotations": []
}
]
},
"thioguanine": {
"name": "thioguanine",
"id": "PA451663",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329594"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329594",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Thioguanine - TPMT and/or NUDT15",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329594",
"annotations": []
}
]
},
"thioridazine": {
"name": "thioridazine",
"id": "PA451666",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329595"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329595",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Thioridazine - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329595",
"annotations": []
}
]
},
"tolterodine": {
"name": "tolterodine",
"id": "PA164746757",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329624"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329624",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Indicate a Potential Impact on Safety or Response]: Tolterodine - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329624",
"annotations": []
}
]
},
"tramadol": {
"name": "tramadol",
"id": "PA451735",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329625",
"https://www.clinpgx.org/fdaPgxAssociations#PA166329596"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329625",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Indicate a Potential Impact on Safety or Response]: Tramadol - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329625",
"annotations": []
},
{
"id": "PA166329596",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Tramadol - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329596",
"annotations": []
}
]
},
"trimipramine": {
"name": "trimipramine",
"id": "PA451791",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329663"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329663",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Trimipramine - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329663",
"annotations": []
}
]
},
"valbenazine": {
"name": "valbenazine",
"id": "PA166170051",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329597"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329597",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Valbenazine - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329597",
"annotations": []
}
]
},
"venlafaxine": {
"name": "venlafaxine",
"id": "PA451866",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329598"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329598",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Venlafaxine - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329598",
"annotations": []
}
]
},
"viloxazine": {
"name": "viloxazine",
"id": "PA166251581",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329664"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329664",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Demonstrate a Potential Impact on Pharmacokinetic Properties Only]: Viloxazine - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329664",
"annotations": []
}
]
},
"voriconazole": {
"name": "voriconazole",
"id": "PA10233",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329626"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329626",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Indicate a Potential Impact on Safety or Response]: Voriconazole - CYP2C19",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329626",
"annotations": [
{
"implications": [],
"drugRecommendation": ""Results in higher systemic concentrations and may result in higher adverse reaction risk."",
"classification": "Unspecified",
"activityScore": {},
"population": "Affected subgroup: CYP2C19 intermediate or poor metabolizers",
"genotypes": [
{
"diplotypes": [
{
"allele1": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"allele2": {
"gene": "CYP2C19",
"name": "*2",
"function": "No function",
"reference": false,
"activityValue": "n/a"
},
"gene": "CYP2C19",
"matchScore": 6,
"phenotypes": [
"Poor Metabolizer"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"Poor Metabolizer"
],
"label": "*2/*2",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"*2": 2.0
}
}
]
}
],
"messages": [],
"highlightedVariants": [],
"dosingInformation": false,
"alternateDrugAvailable": false,
"otherPrescribingGuidance": true,
"phenotypes": {
"CYP2C19": "Poor Metabolizer"
},
"lookupKey": [
{
"CYP2C19": "Poor Metabolizer"
}
]
}
]
}
]
},
"vortioxetine": {
"name": "vortioxetine",
"id": "PA166122595",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329599"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329599",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Vortioxetine - CYP2D6",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329599",
"annotations": []
}
]
},
"warfarin": {
"name": "warfarin",
"id": "PA451906",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"messages": [],
"variants": [],
"urls": [
"https://www.clinpgx.org/fdaPgxAssociations#PA166329600",
"https://www.clinpgx.org/fdaPgxAssociations#PA166329602"
],
"citations": [
{
"pmid": null,
"title": "FDA Table of Pharmacogenetic Associations",
"journal": null,
"year": -1,
"_sameAs": "https://www.fda.gov/medical-devices/precision-medicine/table-pharmacogenetic-associations"
}
],
"guidelines": [
{
"id": "PA166329600",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Warfarin - CYP2C9",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329600",
"annotations": []
},
{
"id": "PA166329602",
"name": "FDA PGx Association [Pharmacogenetic Associations for which the Data Support Therapeutic Management Recommendations]: Warfarin - VKORC1",
"source": "FDA_ASSOC",
"version": "2026-02-09-10-28",
"url": "https://www.clinpgx.org/fdaPgxAssociations#PA166329602",
"annotations": []
}
]
}
}
},
"messages": [],
"matcherMetadata": {
"namedAlleleMatcherVersion": "2.0.0",
"genomeBuild": "GRCh38.p14",
"inputFilename": "pharmcat.example2.vcf",
"timestamp": "2026-02-09T21:20:37.922Z",
"topCandidatesOnly": true,
"findCombinations": false,
"callCyp2d": false,
"sampleId": "Sample_2",
"sampleProps": null
},
"unannotatedGeneCalls": [
{
"alleleDefinitionVersion": "2026-02-09-10-28",
"alleleDefinitionSource": "CLINPGX",
"phenotypeVersion": "2026-02-09-10-28",
"geneSymbol": "F2",
"chr": "chr11",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [],
"relatedDrugs": [],
"sourceDiplotypes": [
{
"allele1": {
"gene": "F2",
"name": "rs1799963 reference (G)",
"function": "Prothrombin 20210A negative",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "F2",
"name": "rs1799963 reference (G)",
"function": "Prothrombin 20210A negative",
"reference": true,
"activityValue": "n/a"
},
"gene": "F2",
"matchScore": 2,
"phenotypes": [
"n/a"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"n/a"
],
"label": "rs1799963 reference (G)/rs1799963 reference (G)",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"rs1799963 reference (G)": 2.0
}
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "F2",
"name": "rs1799963 reference (G)",
"function": "Prothrombin 20210A negative",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "F2",
"name": "rs1799963 reference (G)",
"function": "Prothrombin 20210A negative",
"reference": true,
"activityValue": "n/a"
},
"gene": "F2",
"matchScore": 2,
"phenotypes": [
"n/a"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"n/a"
],
"label": "rs1799963 reference (G)/rs1799963 reference (G)",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"rs1799963 reference (G)": 2.0
}
}
],
"variants": [
{
"gene": "F2",
"chromosome": "chr11",
"position": 46739505,
"dbSnpId": "rs1799963",
"call": "G/G",
"alleles": [
"rs1799963 Prothrombin 20210A"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "G",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
},
{
"alleleDefinitionVersion": "2026-02-09-10-28",
"alleleDefinitionSource": "CLINPGX",
"phenotypeVersion": "2026-02-09-10-28",
"geneSymbol": "F5",
"chr": "chr1",
"phased": false,
"effectivelyPhased": true,
"callSource": "MATCHER",
"uncalledHaplotypes": [],
"messages": [],
"relatedDrugs": [],
"sourceDiplotypes": [
{
"allele1": {
"gene": "F5",
"name": "rs6025 reference (C)",
"function": "Factor V Leiden negative",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "F5",
"name": "rs6025 reference (C)",
"function": "Factor V Leiden negative",
"reference": true,
"activityValue": "n/a"
},
"gene": "F5",
"matchScore": 2,
"phenotypes": [
"n/a"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"n/a"
],
"label": "rs6025 reference (C)/rs6025 reference (C)",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"rs6025 reference (C)": 2.0
}
}
],
"matcherComponentHaplotypes": [],
"matcherHomozygousComponentHaplotypes": [],
"recommendationDiplotypes": [
{
"allele1": {
"gene": "F5",
"name": "rs6025 reference (C)",
"function": "Factor V Leiden negative",
"reference": true,
"activityValue": "n/a"
},
"allele2": {
"gene": "F5",
"name": "rs6025 reference (C)",
"function": "Factor V Leiden negative",
"reference": true,
"activityValue": "n/a"
},
"gene": "F5",
"matchScore": 2,
"phenotypes": [
"n/a"
],
"outsidePhenotype": false,
"outsidePhenotypeMismatch": null,
"activityScore": null,
"outsideActivityScore": false,
"outsideActivityScoreMismatch": null,
"variant": null,
"lookupKey": [
"n/a"
],
"label": "rs6025 reference (C)/rs6025 reference (C)",
"inferred": false,
"inferredSourceDiplotypes": null,
"combination": false,
"diplotypeKey": {
"rs6025 reference (C)": 2.0
}
}
],
"variants": [
{
"gene": "F5",
"chromosome": "chr1",
"position": 169549811,
"dbSnpId": "rs6025",
"call": "C/C",
"alleles": [
"rs6025 Factor V Leiden (T)"
],
"phased": false,
"phaseSet": null,
"referenceAllele": "C",
"hasUndocumentedVariations": false,
"warnings": []
}
],
"variantsOfInterest": [],
"hasUndocumentedVariations": false,
"treatUndocumentedVariationsAsReference": false
}
]
}